ID: 1022376566

View in Genome Browser
Species Human (GRCh38)
Location 7:29817915-29817937
Sequence AACACACTATAGTCTTGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 82}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022376566 Original CRISPR AACACACTATAGTCTTGGGT AGG (reversed) Intronic
900762905 1:4484913-4484935 AACACACTCTTTTCCTGGGTGGG + Intergenic
908168088 1:61477835-61477857 AATACACCATATTCTTGGATTGG + Intergenic
912086247 1:106009255-106009277 AACACAATATACTCTAGGCTGGG - Intergenic
914046435 1:144097073-144097095 AATACACAAAATTCTTGGGTTGG + Intergenic
914131675 1:144863613-144863635 AATACACAAAATTCTTGGGTTGG - Intergenic
916753131 1:167741735-167741757 AAAACCCTTTAGTCTTGGCTGGG + Intronic
920532908 1:206717442-206717464 ACCACACAGGAGTCTTGGGTAGG - Intronic
923003355 1:230025691-230025713 AACACACAATAGGCATGTGTTGG + Intergenic
1064877112 10:20006608-20006630 AACATGCTATTGTCTTGTGTTGG - Intronic
1067039971 10:42944800-42944822 AACACACTATAGGCTGGGCATGG + Intergenic
1074686839 10:115969650-115969672 AAGACACAATAGGCTTGGGGAGG + Intergenic
1076035832 10:127197385-127197407 AACACCCAATACTCTTTGGTGGG - Intronic
1078493405 11:11790827-11790849 AAAACACTATATTTTTGGATAGG - Intergenic
1087748175 11:101973497-101973519 CACACACTAGAGTCTTGGAGTGG + Intronic
1092335845 12:7632533-7632555 AACATTCCATAGTCATGGGTTGG - Intergenic
1097636122 12:62124380-62124402 AATATACTCTACTCTTGGGTTGG - Intronic
1100742738 12:97612414-97612436 AATACACTATATTCATGGGTTGG + Intergenic
1101813207 12:108125693-108125715 AAAATACTATAGTGTTGAGTGGG - Intergenic
1110448734 13:75617679-75617701 TACTCACTATAGGCTTGGGGTGG - Intergenic
1113114642 13:106862375-106862397 AACACAGTATACCCTGGGGTTGG + Intergenic
1115652751 14:35414863-35414885 AACACAGAATAGTGTTGGGTGGG + Intergenic
1122672769 14:103385094-103385116 TACACACTACAGGCCTGGGTTGG - Intergenic
1124180826 15:27472073-27472095 GACACACTATATTCTTGCATAGG - Intronic
1125010845 15:34872888-34872910 ATCAAAATATAGTCTTTGGTTGG - Intronic
1134322112 16:13173683-13173705 AACTCACTCTTGGCTTGGGTGGG - Intronic
1148234345 17:45957741-45957763 AACATACTGTGCTCTTGGGTGGG + Intronic
1151694407 17:75706833-75706855 AAGACTCAATAGTCTTGGTTGGG + Exonic
1153215702 18:2818938-2818960 AACACCCCATATTCTTAGGTAGG + Intergenic
1202685989 1_KI270712v1_random:50488-50510 AATACACAAAATTCTTGGGTTGG + Intergenic
926930827 2:18039043-18039065 AACACACCATAATTTTGGATAGG - Intronic
928961392 2:36929776-36929798 AATACACAAAATTCTTGGGTTGG + Intronic
929616481 2:43313606-43313628 AACACGCTCCAGTCCTGGGTAGG + Intronic
930796144 2:55393587-55393609 AAAACTCTATAGTTTTGGCTGGG - Intronic
930875703 2:56213148-56213170 AACTGACTCTAGTCTTGGTTAGG + Intronic
934245732 2:90304329-90304351 AATACACAAAATTCTTGGGTTGG - Intergenic
934263014 2:91492708-91492730 AATACACAAAATTCTTGGGTTGG + Intergenic
935274136 2:101461628-101461650 ATCACAGGATAGTCTGGGGTTGG - Intronic
937573993 2:123396963-123396985 AACACACCATAGGCTTGTGAGGG + Intergenic
937607804 2:123823076-123823098 AACTAAGTCTAGTCTTGGGTGGG - Intergenic
938593383 2:132762037-132762059 TACAGAGTATAGTCTTGGTTTGG + Intronic
947107781 2:226685724-226685746 AAAACAGTAAATTCTTGGGTAGG + Intergenic
1169580221 20:7013888-7013910 AACACACAAAAGTCTTGGAAAGG + Intergenic
1172881907 20:38206625-38206647 GACACACTATATTCATGGATAGG - Intergenic
1174454552 20:50640069-50640091 AAGACACTATGGTATTTGGTTGG + Intronic
1174472245 20:50769652-50769674 AAGACACTATGGTATTTGGTTGG - Intergenic
1181708570 22:24665181-24665203 AATATACCATAGTCATGGGTTGG - Intergenic
952660601 3:35841989-35842011 GACCCAGTACAGTCTTGGGTAGG + Intergenic
952914204 3:38220100-38220122 AACACACAATAATCTTGGCTGGG - Intronic
955686519 3:61554530-61554552 AATATACTATATTCATGGGTTGG - Intergenic
956100904 3:65766975-65766997 AACAAACTACCGTCTTGGGCAGG + Intronic
956772302 3:72536963-72536985 TACACACCATAGTCTTGAGTTGG + Intergenic
963694184 3:148544161-148544183 AACATTCTATACTCTTGGATGGG + Intergenic
965308284 3:167096354-167096376 AAAACACTATATCCTGGGGTGGG + Intergenic
966756713 3:183378224-183378246 ACCACACTATAGTCAAGGGAGGG + Intronic
970561035 4:17282478-17282500 AGCACACGATTGTCTTGTGTTGG - Intergenic
981042532 4:140236720-140236742 GACACATTATTGGCTTGGGTTGG - Intergenic
982114691 4:152088431-152088453 AACCCATTACAGTCATGGGTAGG - Intergenic
990197078 5:53329972-53329994 AATACACTATTGCCTTGGTTTGG + Intergenic
990821226 5:59842340-59842362 AATACACTAAAGTCTTGAGGAGG - Intronic
992323368 5:75636380-75636402 AACACACCATACTCTTGCCTTGG - Intronic
993261121 5:85659216-85659238 AACACTCCATGCTCTTGGGTAGG - Intergenic
993404658 5:87496350-87496372 AACATTCTATACTCATGGGTTGG + Intergenic
998642410 5:144026278-144026300 AAAACAAGATAGTCTTGGCTTGG - Intergenic
1001809987 5:174620178-174620200 CTCACCCTGTAGTCTTGGGTGGG + Intergenic
1015695928 6:135979810-135979832 AACATTCTATACTCATGGGTAGG + Intronic
1020475965 7:8594825-8594847 AACAAATTATTGTCTTGTGTAGG + Intronic
1021769413 7:23983870-23983892 TTCACAGTATAGTCTTGAGTGGG + Intergenic
1022376566 7:29817915-29817937 AACACACTATAGTCTTGGGTAGG - Intronic
1023866586 7:44241294-44241316 CACACACACTGGTCTTGGGTGGG - Intronic
1027806501 7:82832062-82832084 AACACACTATATTCTCTTGTGGG + Intronic
1028521769 7:91740156-91740178 TACACACCATAGACTTTGGTGGG - Intronic
1041272389 8:56122007-56122029 AGCACCCTCTGGTCTTGGGTAGG - Intergenic
1042308920 8:67360311-67360333 AAGACACTAGAGTATTGGCTGGG + Intergenic
1042798644 8:72692454-72692476 AACAAACTATATTCTCAGGTGGG - Intronic
1044100981 8:88138405-88138427 AACACAAAATAGTCTTCAGTTGG - Intronic
1045378996 8:101604262-101604284 AACTCACTAGGGTCTTGCGTGGG - Intronic
1045656487 8:104392309-104392331 AACACCCTACAGTCTAGGGGAGG - Intronic
1045777826 8:105826611-105826633 AACCCACTGCAGTCATGGGTGGG - Intergenic
1050707322 9:8416666-8416688 AAGACAGTCTAGTCTTGTGTTGG - Intronic
1061592642 9:131607922-131607944 AACACACTATATGATTGGTTAGG - Intronic
1061911001 9:133724012-133724034 AAATCTTTATAGTCTTGGGTTGG + Intronic
1187090103 X:16087545-16087567 AGCTCATTATAGTCCTGGGTGGG + Intergenic
1187478474 X:19633131-19633153 GATACACTATGGTCTAGGGTTGG + Intronic
1188381253 X:29495571-29495593 AACACACTAGAATCTTGATTAGG - Intronic
1193827563 X:86244617-86244639 AAATAACTCTAGTCTTGGGTTGG + Intronic
1194654985 X:96561722-96561744 AATATATTATAGTCTGGGGTTGG - Intergenic
1202587674 Y:26449093-26449115 AATACACAAAATTCTTGGGTTGG - Intergenic