ID: 1022384313

View in Genome Browser
Species Human (GRCh38)
Location 7:29887565-29887587
Sequence CTGGAGAACCAGTGTGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022384310_1022384313 5 Left 1022384310 7:29887537-29887559 CCGGAAAGAGAAACAAGCATTTG 0: 1
1: 0
2: 3
3: 34
4: 389
Right 1022384313 7:29887565-29887587 CTGGAGAACCAGTGTGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022384313 Original CRISPR CTGGAGAACCAGTGTGAGCA GGG Intronic
No off target data available for this crispr