ID: 1022393737

View in Genome Browser
Species Human (GRCh38)
Location 7:29966331-29966353
Sequence GGGCACTCCTTCCACGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 80}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022393737_1022393740 -6 Left 1022393737 7:29966331-29966353 CCCTCTTCGTGGAAGGAGTGCCC 0: 1
1: 0
2: 0
3: 9
4: 80
Right 1022393740 7:29966348-29966370 GTGCCCTTCACACTGGAAGAAGG 0: 1
1: 0
2: 1
3: 11
4: 155
1022393737_1022393748 14 Left 1022393737 7:29966331-29966353 CCCTCTTCGTGGAAGGAGTGCCC 0: 1
1: 0
2: 0
3: 9
4: 80
Right 1022393748 7:29966368-29966390 AGGGCACTTGGGATGGGATTTGG No data
1022393737_1022393747 8 Left 1022393737 7:29966331-29966353 CCCTCTTCGTGGAAGGAGTGCCC 0: 1
1: 0
2: 0
3: 9
4: 80
Right 1022393747 7:29966362-29966384 GGAAGAAGGGCACTTGGGATGGG No data
1022393737_1022393741 -5 Left 1022393737 7:29966331-29966353 CCCTCTTCGTGGAAGGAGTGCCC 0: 1
1: 0
2: 0
3: 9
4: 80
Right 1022393741 7:29966349-29966371 TGCCCTTCACACTGGAAGAAGGG No data
1022393737_1022393745 3 Left 1022393737 7:29966331-29966353 CCCTCTTCGTGGAAGGAGTGCCC 0: 1
1: 0
2: 0
3: 9
4: 80
Right 1022393745 7:29966357-29966379 ACACTGGAAGAAGGGCACTTGGG 0: 1
1: 0
2: 2
3: 15
4: 206
1022393737_1022393746 7 Left 1022393737 7:29966331-29966353 CCCTCTTCGTGGAAGGAGTGCCC 0: 1
1: 0
2: 0
3: 9
4: 80
Right 1022393746 7:29966361-29966383 TGGAAGAAGGGCACTTGGGATGG 0: 1
1: 0
2: 3
3: 33
4: 366
1022393737_1022393744 2 Left 1022393737 7:29966331-29966353 CCCTCTTCGTGGAAGGAGTGCCC 0: 1
1: 0
2: 0
3: 9
4: 80
Right 1022393744 7:29966356-29966378 CACACTGGAAGAAGGGCACTTGG 0: 1
1: 0
2: 1
3: 21
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022393737 Original CRISPR GGGCACTCCTTCCACGAAGA GGG (reversed) Intronic
902164960 1:14562727-14562749 GGGCACTCCTTGCACTTAGTAGG - Intergenic
904478847 1:30781979-30782001 GGACATTCCTCCCAAGAAGAAGG + Intergenic
911182699 1:94875331-94875353 GGGCACTCCTTCCACAGGGTAGG + Intronic
914193455 1:145431083-145431105 AGGCACCCCTTCCAGGAACAAGG - Intergenic
914474784 1:148013973-148013995 AGGCACCCCTTCCAGGAACAAGG - Intergenic
915514132 1:156402786-156402808 GGGCACTATTTCCAGGAGGAGGG - Intergenic
916003294 1:160636637-160636659 AGGCACTTCTTCCACCAAGTAGG + Intronic
916285263 1:163099199-163099221 GGCCACTCCTACAACCAAGAAGG + Intergenic
916760125 1:167808275-167808297 TGTCACTCCTTCCACCATGAAGG + Intergenic
921887661 1:220322665-220322687 GAGCAGTCCTTCCAGGAAGAGGG - Intergenic
923226390 1:231942197-231942219 GGGATCTACTTCCAGGAAGAAGG + Intronic
1069347992 10:67492719-67492741 GGAAAATCATTCCACGAAGAGGG + Intronic
1069949350 10:72008493-72008515 GGGCAGGCCTTTCACGAGGAGGG - Exonic
1071415553 10:85437669-85437691 GGGCAGGTCTTCCAGGAAGAAGG - Intergenic
1073684244 10:105735201-105735223 GGGCACTACTCCCACCATGAGGG + Intergenic
1077183750 11:1227529-1227551 GGGCACTCCTCCCACCATGTAGG - Intronic
1078546774 11:12252675-12252697 GGGCACTGCTACCAGGAATAGGG + Intronic
1083443562 11:62692311-62692333 GGGCTAACCTTCCACCAAGAGGG - Intronic
1084454199 11:69258046-69258068 GGGCAAGCCTTCCAGGTAGAGGG - Intergenic
1088154269 11:106784320-106784342 GGGCACTCCTTCCTGAAAGCAGG + Intronic
1092773167 12:11917036-11917058 GGGCACTCCAGCCATAAAGAGGG + Intergenic
1097698892 12:62800841-62800863 GTGCACTCCTGCCAGGCAGAGGG + Intronic
1100380258 12:94055073-94055095 GGGCTATCCTTCCATGAGGAGGG + Intergenic
1102899225 12:116623404-116623426 GGGCACTACTCCCATCAAGAGGG - Intergenic
1102907487 12:116688008-116688030 GGGCGCTCCTTCCCTGCAGAAGG - Intergenic
1105886600 13:24648075-24648097 GGTCAATCCTTCCACCCAGAAGG + Intergenic
1108464428 13:50700543-50700565 GGGCAATACCTCCTCGAAGAGGG - Intronic
1108525667 13:51284039-51284061 TGGCAGTCCCTCCACGGAGAGGG + Intronic
1113903344 13:113808117-113808139 GGGCCCTGCTTCCACAGAGATGG + Intronic
1114636393 14:24189268-24189290 GGGCATTCCTTCCCCAGAGAGGG - Exonic
1126866257 15:52940548-52940570 GGGCTGTCATTCCACGAATAGGG + Intergenic
1129458299 15:75687408-75687430 TGGCCCTGCTTCCACGGAGAAGG + Exonic
1133261685 16:4554951-4554973 GGGCTCTCCTTCCCAGAAAATGG + Intergenic
1134243789 16:12524832-12524854 GAGCAGTACTTACACGAAGAAGG - Exonic
1139296698 16:65907525-65907547 GGGCGCTCCTCCCACAAAGATGG - Intergenic
1139352007 16:66342805-66342827 GGGCACTCCTTCCACCAGAAAGG - Intergenic
1142020492 16:87779253-87779275 GGTCACTCCTCCCGCGCAGAAGG + Intergenic
1143265722 17:5635670-5635692 AGGCATTCCTTCCAGGAAGGAGG - Intergenic
1146826456 17:36027705-36027727 GGGCAGTTCCTCCAAGAAGAGGG - Intergenic
1147229109 17:39004240-39004262 GGGCACTCCAAACACGAAGGTGG - Intergenic
1147501738 17:40972133-40972155 AGGCACTTCTTCCATGAAGGTGG + Intergenic
1149467013 17:56888014-56888036 GTGCCCTAATTCCACGAAGAGGG - Exonic
1152409207 17:80113354-80113376 GGTCACTCACTCCAGGAAGAGGG - Intergenic
1154218222 18:12431354-12431376 GAGCCCTCCATCCACGCAGACGG - Exonic
1164668897 19:30062126-30062148 GGGCACTGCCTCCCTGAAGATGG + Intergenic
1167348519 19:48961578-48961600 GAGCACTCCCGCCACAAAGATGG - Exonic
929038210 2:37717325-37717347 GCCCACTCCTTCCAGGAAGGTGG + Intronic
933797200 2:85929148-85929170 GGGCACTCCAGCCACCCAGAGGG + Intergenic
934640381 2:96024127-96024149 GGCCATTCCTACCACCAAGAGGG + Intronic
934793270 2:97081289-97081311 GGCCATTCCTACCACCAAGAGGG - Intergenic
937840597 2:126520462-126520484 GGGCACTCCTTCCCAGGACAGGG - Intergenic
946500926 2:220246260-220246282 GGGCACTAATTCCACCATGAGGG - Intergenic
947309983 2:228791063-228791085 GGGTACTCATTCCATGCAGAAGG - Intergenic
1169572608 20:6923096-6923118 TGGCACTCTTTCCACGAATATGG + Intergenic
1175315331 20:58043323-58043345 GGGCAGTCCTTCCTTGAAGGGGG - Intergenic
1176287935 21:5028674-5028696 GGGCACCCCTTCCACAGGGAGGG - Intronic
1179869246 21:44234801-44234823 GGGCACCCCTTCCACAGGGAGGG + Intronic
1181725686 22:24809419-24809441 AGGCACTCCTTCTAGAAAGAAGG - Intronic
1181989618 22:26827499-26827521 GGGCACTCCTGGAACTAAGAGGG - Intergenic
1183649695 22:39146787-39146809 GGCCACTCCTTCCAAAACGATGG + Intronic
1184747361 22:46464194-46464216 GGCCACCCCCTCCACGAAGAGGG + Exonic
949890647 3:8731413-8731435 TGACACTCCTTCCACCAAGAGGG - Intronic
950297803 3:11846977-11846999 GGGCACTCCTCCGACCACGAGGG - Intergenic
960742627 3:120851638-120851660 GATCAGTCCTTGCACGAAGAGGG + Intergenic
962649814 3:137477210-137477232 GGGCACTCCTTTCTCTCAGATGG + Intergenic
962850577 3:139305752-139305774 GGACACTCCTTCCACCTAGGGGG + Intronic
963045151 3:141096887-141096909 GGGCACTCATTCCAGGCACAGGG - Intronic
969592280 4:8128774-8128796 GGGCACTCATCCCATGATGAGGG - Intronic
971934993 4:33136475-33136497 GGTCACACCTTTCACCAAGAAGG - Intergenic
976634576 4:87275052-87275074 GGGCACACCCTACACAAAGATGG + Intergenic
984225200 4:177026528-177026550 TGCTACTCCTTCCACTAAGAGGG - Intergenic
984709130 4:182870227-182870249 GGATAGTCCTTCCAAGAAGAGGG - Intergenic
1001548304 5:172584314-172584336 TGGCTCTCCTTCCAGGAAGAGGG - Intergenic
1004889385 6:20084877-20084899 GGGCACACATTCCGGGAAGAAGG - Intergenic
1008209379 6:48702235-48702257 GGCCACTTCTTCCACCAAGGAGG - Intergenic
1012983087 6:105850354-105850376 GGGCACTGCTTGCAGGATGACGG + Intergenic
1013192465 6:107815256-107815278 GGGCATTCCTGCCACTTAGAGGG + Intronic
1016767927 6:147815757-147815779 GGGGGCTCATTCCACCAAGAGGG - Intergenic
1019814814 7:3191746-3191768 TGGCACTCACTCCACGAAGAAGG + Intergenic
1021367624 7:19800323-19800345 AGACACTCCTCCCACAAAGAGGG - Intergenic
1022176885 7:27880033-27880055 AGGCACAGCTACCACGAAGATGG + Intronic
1022324719 7:29320746-29320768 TGGCACTCCTTCCAGGATGAGGG + Intronic
1022393737 7:29966331-29966353 GGGCACTCCTTCCACGAAGAGGG - Intronic
1036428923 8:8671534-8671556 TGGCGCTCCTTCCACTATGAAGG + Intergenic
1037382897 8:18306980-18307002 GGACACTTCTTCCCGGAAGAAGG - Intergenic
1046787049 8:118278929-118278951 GGGCAAACCTTACACAAAGAAGG - Intronic
1056101114 9:83301385-83301407 GAGCAACCCTTCCAAGAAGATGG - Intronic
1058781371 9:108339479-108339501 GAGCACTCCTGCCAGGAAAATGG + Intergenic
1187312224 X:18156160-18156182 GGGCACTACTCCCACTAATAAGG - Intergenic
1201683314 Y:16672756-16672778 GGCCTCTCCTTCTACAAAGAAGG - Intergenic