ID: 1022397740

View in Genome Browser
Species Human (GRCh38)
Location 7:30005740-30005762
Sequence AAAAACAGTTGGAAGACTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022397740_1022397745 29 Left 1022397740 7:30005740-30005762 CCCGGAGTCTTCCAACTGTTTTT No data
Right 1022397745 7:30005792-30005814 CTACTTCATTCCCACGTTGAAGG No data
1022397740_1022397746 30 Left 1022397740 7:30005740-30005762 CCCGGAGTCTTCCAACTGTTTTT No data
Right 1022397746 7:30005793-30005815 TACTTCATTCCCACGTTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022397740 Original CRISPR AAAAACAGTTGGAAGACTCC GGG (reversed) Intergenic
No off target data available for this crispr