ID: 1022399791

View in Genome Browser
Species Human (GRCh38)
Location 7:30026384-30026406
Sequence GTCTTGCGATGGCAGATGAA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 89}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022399784_1022399791 0 Left 1022399784 7:30026361-30026383 CCAACATCAAATCCCCTCCTTTG 0: 1
1: 0
2: 1
3: 21
4: 191
Right 1022399791 7:30026384-30026406 GTCTTGCGATGGCAGATGAATGG 0: 1
1: 0
2: 0
3: 8
4: 89
1022399783_1022399791 13 Left 1022399783 7:30026348-30026370 CCTTCATAGTGGACCAACATCAA 0: 1
1: 0
2: 0
3: 9
4: 67
Right 1022399791 7:30026384-30026406 GTCTTGCGATGGCAGATGAATGG 0: 1
1: 0
2: 0
3: 8
4: 89
1022399781_1022399791 27 Left 1022399781 7:30026334-30026356 CCTTTTCTAAGTAGCCTTCATAG 0: 1
1: 0
2: 2
3: 10
4: 153
Right 1022399791 7:30026384-30026406 GTCTTGCGATGGCAGATGAATGG 0: 1
1: 0
2: 0
3: 8
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022399791 Original CRISPR GTCTTGCGATGGCAGATGAA TGG Exonic
902047537 1:13536960-13536982 GTCTTGCATTTGCAGGTGAAAGG - Intergenic
902880518 1:19369193-19369215 GCCTTGGGATGCCAGATGAAAGG + Intronic
905975600 1:42171585-42171607 GTCTAGCGATGGCTGCTGCATGG + Intergenic
906311505 1:44757767-44757789 GCCTTGCCATGTCAGATGCAGGG + Intronic
906625677 1:47323265-47323287 GTCTTGAAATGACACATGAATGG - Intergenic
911303572 1:96205713-96205735 GTATTCCAATGGCAGAGGAAGGG + Intergenic
912527173 1:110292022-110292044 GTCTTGGGCTGGCAAATGCAAGG - Intergenic
916060655 1:161096443-161096465 GTCTTGGGATGGCAAAGCAATGG + Intergenic
917057886 1:171003908-171003930 GTCTTGCCATGGCTGCTGTAGGG + Intronic
918697455 1:187561151-187561173 GTCTTGCTAAGGCTGAAGAAAGG - Intergenic
921670803 1:217921814-217921836 GTCTTGCTCTGGCTGATGTAGGG + Intergenic
924310205 1:242733048-242733070 GTGTGGCGTTGGCAGAGGAATGG + Intergenic
924802078 1:247335082-247335104 TTCTAGAGATGGCAGATGCAAGG + Intergenic
1065923063 10:30410204-30410226 TTTTTGTGATGGCAGAAGAATGG + Intergenic
1071597439 10:86938534-86938556 GTCATGAGATGGCACAGGAAAGG + Intronic
1083392449 11:62364290-62364312 GGCTGGTGATGGCAGATGAATGG - Intronic
1083394935 11:62384057-62384079 GGCTGGTGATGGCAGATGAATGG - Intronic
1086143281 11:83522344-83522366 GTCTTGGGATGGCAGAGGTGGGG + Intronic
1087334696 11:96828974-96828996 ATCTTGGGAAGGCAGAAGAAAGG + Intergenic
1089363141 11:117904168-117904190 GTCTTGGGGTGGCAGCTGGACGG - Intronic
1090275235 11:125414156-125414178 GACTTGGGAAGGCAGAGGAAGGG + Intronic
1091687234 12:2572264-2572286 GTTTTCCGATTGCATATGAAGGG - Intronic
1091907178 12:4198480-4198502 GTCCTGGGATGGAAGATGAAGGG - Intergenic
1094277941 12:28699967-28699989 ATCTTGCCATGGCACATTAAAGG - Intergenic
1097330395 12:58326905-58326927 GTCTTTCGATGGCTAAAGAATGG - Intergenic
1109306033 13:60642875-60642897 GTCTGGAGATGGCACATGACTGG + Intergenic
1116503821 14:45653142-45653164 GTCTTGGGATGACAGATGACTGG + Intergenic
1121607246 14:95250031-95250053 GTTTTGGGAAGGCAGATTAAAGG - Intronic
1125842752 15:42820055-42820077 GTCTTTCTATGGCAGAAGTAAGG - Intronic
1128567607 15:68711522-68711544 GACCTGCGAGGGCAGATGCATGG - Exonic
1130960310 15:88654578-88654600 GGCATGCGAAGGGAGATGAAAGG + Intronic
1135699491 16:24619649-24619671 CTCTTGCACTGGAAGATGAAGGG + Intergenic
1136402410 16:30025736-30025758 ATCTTGCCAAGGCAGACGAAGGG + Exonic
1138537335 16:57667017-57667039 GGGCTGCGAAGGCAGATGAATGG - Intergenic
1138671123 16:58615511-58615533 GTCATGAGATGACAGACGAAGGG + Intronic
1139906946 16:70372668-70372690 ATCTGGCGAGGGCCGATGAAGGG + Exonic
1140838168 16:78814823-78814845 GTTTTGCAAGGGCAGATGACAGG - Intronic
1148536025 17:48439884-48439906 GTGCTGGGATAGCAGATGAAGGG - Intergenic
1150117892 17:62570355-62570377 CTCTTGCTATGGGTGATGAAGGG + Intronic
1157579441 18:48764875-48764897 GCCTTCCCATGGCAGCTGAAAGG - Intronic
1157692231 18:49692822-49692844 GTCTTGCTATGATAGATGAAGGG - Intergenic
1160443681 18:78911829-78911851 GCCTTGGGATGGGAGTTGAAGGG - Intergenic
1162187124 19:8914373-8914395 GTCTTGCGATTGCTGAGGGAAGG + Intronic
1163634748 19:18432773-18432795 GTTGTGGGATGGCAGATGAGGGG + Intronic
1164890062 19:31815681-31815703 GTCTTCTGCAGGCAGATGAATGG - Intergenic
926293120 2:11546246-11546268 GTCTTGGTTTTGCAGATGAAGGG - Intronic
928468174 2:31543269-31543291 GTTTTGGCATGGCAGATGTAGGG - Intronic
930298154 2:49580770-49580792 GCCTTGAGAAGGCAGAAGAAAGG - Intergenic
935339766 2:102049272-102049294 GTATTGCAAAGGCAGATCAAGGG + Intergenic
940907669 2:159183642-159183664 GTCTTGGGATGGGAGGTGGAAGG + Intronic
945137531 2:206644324-206644346 GTCTGGCTATGGCAGAAGAAAGG - Intergenic
945593343 2:211762092-211762114 GTGTTGCGATGGAAGAAAAAGGG - Intronic
947685093 2:232076941-232076963 GCCTTGTGTTGGCAGAGGAATGG - Intronic
1169668843 20:8071958-8071980 GTCTTGCCATGTCAGAAGATTGG + Intergenic
1172055895 20:32154053-32154075 GTCTTGGGGTGGCAGATGCTGGG - Intronic
1174273680 20:49387869-49387891 GTCTTGCCAAGGCAGAGGAAGGG + Intronic
1175155297 20:56967306-56967328 GTCTTGTGCTGGCATCTGAACGG - Intergenic
1178036242 21:28586474-28586496 GTTTTGAGATGGCAGAGGATTGG - Intergenic
1183754412 22:39746861-39746883 TTCTGGAGAGGGCAGATGAAAGG - Intronic
951031273 3:17884756-17884778 GTCTTGCAATTACAGATGAGAGG - Intronic
953729490 3:45434724-45434746 ATATTGCTATGGCAGGTGAAAGG + Intronic
955350293 3:58188693-58188715 GTCTTCCGATGGCAGGTGGGAGG - Intergenic
958723516 3:97875741-97875763 CTCTTGCAATGTCAGATGTAGGG + Exonic
962929035 3:140020611-140020633 GTCCTGGGATGGCAAATGCAAGG + Intronic
973846087 4:54914528-54914550 GTTTGGCTATGGCAGATAAAGGG - Intergenic
975491010 4:74988854-74988876 GGCTGGAGATGGCAGATGTAAGG + Intronic
980279022 4:130693857-130693879 GTCTTGCAATGGCCTAAGAATGG - Intergenic
982491746 4:156038720-156038742 GTCTTGCTATGGCTGCTGTAGGG - Intergenic
982929636 4:161387701-161387723 GTTTTGCAATTGCAGAAGAAAGG + Intronic
985122849 4:186661262-186661284 GTCCTGCCTTGGCAGGTGAAAGG - Intronic
986574306 5:9196659-9196681 GTTTTGTGATAACAGATGAAGGG + Intronic
987308583 5:16661190-16661212 GACTTGGGATGGGAGAGGAAGGG - Intergenic
990915349 5:60897042-60897064 TTCTTGCGTTGGAATATGAAGGG - Intronic
995174153 5:109155028-109155050 CTCTTGCCATGGCAAATGTAGGG - Intronic
996876671 5:128248339-128248361 CTCTTTCGAGGGCTGATGAAGGG - Intergenic
1000877103 5:166654208-166654230 GTTTTGAGAGGGCAGAAGAAAGG - Intergenic
1006934493 6:37707969-37707991 TTCTTGGGATGGAAGATGGAAGG - Intergenic
1008712778 6:54248671-54248693 CTCTTGGGATGGAAGAGGAAAGG + Intronic
1010825046 6:80462940-80462962 TTCATGCGATGGCAGAAGACTGG - Intergenic
1011992355 6:93538774-93538796 GTCATGCGAAGGCAGAACAAAGG - Intergenic
1012825498 6:104141275-104141297 GTCTTACCATGGCAGAGGAGAGG + Intergenic
1016469803 6:144363478-144363500 GTCTTGAGAGGGAAGATGTAAGG - Intronic
1017889625 6:158627767-158627789 GTCTTGAGCTGGGAGGTGAAAGG + Intronic
1022399791 7:30026384-30026406 GTCTTGCGATGGCAGATGAATGG + Exonic
1025586673 7:62798470-62798492 GTTTTGCTCTGGGAGATGAATGG - Intergenic
1026180634 7:68036421-68036443 GTCTGGAGAGGGCAGGTGAAAGG + Intergenic
1035929924 8:3768939-3768961 GTGTTCCGATGGAAGGTGAATGG + Intronic
1037450658 8:19013576-19013598 GGCTGGCGATGGAAGATGGAAGG - Exonic
1040978808 8:53223905-53223927 GTCTGGCGAGGGGAGGTGAAAGG - Intergenic
1045553139 8:103190556-103190578 GTGTTGCAATGGAATATGAATGG + Intronic
1051295442 9:15590182-15590204 TTCTGGAGATGGCAGCTGAATGG + Intronic
1051372907 9:16373393-16373415 GTTCTGTGATGGCTGATGAATGG - Intergenic
1052673219 9:31584993-31585015 GTATTGAGATGGAACATGAAAGG - Intergenic
1058472952 9:105299780-105299802 ATCTTTCGATTGGAGATGAAGGG + Intronic
1060534978 9:124378543-124378565 ATCTTGCGAGGGCTGCTGAAGGG - Intronic
1060728247 9:126020436-126020458 TTTTTGGGATGACAGATGAAGGG + Intergenic
1186530922 X:10294858-10294880 GCCTTGCTAAGGCAGTTGAAGGG + Intergenic
1193253402 X:79319474-79319496 GTCTTGCTATGGCTGCTGTAGGG + Intergenic