ID: 1022399918

View in Genome Browser
Species Human (GRCh38)
Location 7:30027250-30027272
Sequence GGGGCCAAACAACCTTAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022399918_1022399922 7 Left 1022399918 7:30027250-30027272 CCTGCTTAAGGTTGTTTGGCCCC No data
Right 1022399922 7:30027280-30027302 ATGAGCTCTGCCTTCAAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022399918 Original CRISPR GGGGCCAAACAACCTTAAGC AGG (reversed) Intergenic
No off target data available for this crispr