ID: 1022403763

View in Genome Browser
Species Human (GRCh38)
Location 7:30066811-30066833
Sequence TTTCTATTCTGTGCCAGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 385
Summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 343}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022403763_1022403765 19 Left 1022403763 7:30066811-30066833 CCTTTTCTGGCACAGAATAGAAA 0: 1
1: 0
2: 3
3: 38
4: 343
Right 1022403765 7:30066853-30066875 AGTCATGTATTTAATATGAAAGG No data
1022403763_1022403764 -10 Left 1022403763 7:30066811-30066833 CCTTTTCTGGCACAGAATAGAAA 0: 1
1: 0
2: 3
3: 38
4: 343
Right 1022403764 7:30066824-30066846 AGAATAGAAAAAATTTTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022403763 Original CRISPR TTTCTATTCTGTGCCAGAAA AGG (reversed) Intronic
902649592 1:17827957-17827979 TTTCTGTTAAGTGCCAGAACTGG + Intergenic
903040732 1:20528216-20528238 TGCCTATTCAGTGCCAGGAATGG + Intergenic
903844883 1:26273201-26273223 TTTCTATTTTGGGCCAGAGTGGG + Intronic
904215972 1:28919623-28919645 TTTGTATTCTTTGGTAGAAACGG + Intronic
905068850 1:35207538-35207560 TTTCTTTTCTTTGCCAGACGTGG - Intergenic
905941559 1:41867287-41867309 TTTCTATAAAGGGCCAGAAAGGG + Intronic
906075758 1:43050792-43050814 TTTATATTCTTTATCAGAAAAGG + Intergenic
906938885 1:50238362-50238384 TTTCCATCCTGTGCTAGATATGG + Intergenic
907741066 1:57166316-57166338 TTTCAATTCTTTGCAAGACATGG - Intronic
908562327 1:65319167-65319189 TTTCTAGTCTCAGCCAGAAGTGG + Intronic
910557897 1:88556964-88556986 TTTCTATTCTCTGCTACTAAAGG + Intergenic
911979430 1:104548135-104548157 TTTATATTCTGTGGTATAAATGG - Intergenic
914917339 1:151826763-151826785 TTACTATTATGTGTCAGAAATGG + Intronic
915472426 1:156133975-156133997 TTGCTATGTTGTGCCAGAGAAGG + Intronic
916442309 1:164839732-164839754 TTTCTATTCTCCACCAGGAATGG + Intronic
916746122 1:167686196-167686218 GTCATAGTCTGTGCCAGAAATGG + Intronic
916946195 1:169730225-169730247 TTTTTATTCTATGCTTGAAATGG - Intronic
917402551 1:174666714-174666736 TTTCTCTTTTGTCCCAGGAATGG - Intronic
917783238 1:178423227-178423249 TCTCTATTTTGTACCAAAAAAGG - Intronic
918014058 1:180615734-180615756 TTGATATTGTGTTCCAGAAATGG - Intergenic
918440092 1:184558262-184558284 TTTATATTCTGTGACATACATGG - Intronic
919090342 1:192971325-192971347 TTTCTGTCCTGAGCCAGCAAGGG + Intergenic
923134854 1:231108821-231108843 TCTCCATTCAGTGCCAGAAGAGG + Intergenic
924319333 1:242831679-242831701 TTCCTTTTCTGTTTCAGAAATGG - Intergenic
924872684 1:248065959-248065981 TTTCTATTCTGATACAGAGAGGG - Intronic
1063295947 10:4806518-4806540 TTTCTATACAGTGCAAGATATGG + Intronic
1065240928 10:23703306-23703328 TTTCTTTTCTTTGCAAGAACGGG + Intronic
1065646767 10:27843144-27843166 TTTCTAATTTGTTCCAGATATGG - Intronic
1067815157 10:49468795-49468817 TTTGTATTCTGTGCCAGCCCTGG - Intronic
1068523152 10:58099745-58099767 TTTGTATCCTGTGCCATATATGG - Intergenic
1069085857 10:64138819-64138841 TCTATATTCTGCGTCAGAAAAGG - Intergenic
1070040484 10:72773185-72773207 TTGCTATTTTGTGCCAGGTATGG - Intronic
1070996581 10:80788875-80788897 TTATTATTTTGTGCCAGAAGAGG + Intergenic
1071114045 10:82195844-82195866 TTTGTCTTCAGAGCCAGAAATGG - Intronic
1072050343 10:91698021-91698043 TTTCCCATCTGTGCCAGAAAAGG - Intergenic
1072593056 10:96845035-96845057 TTTAAATTGTGTGACAGAAAAGG + Intronic
1072800584 10:98389868-98389890 TCTCTATTCTGTGCCAGGCTTGG - Intronic
1073775524 10:106781361-106781383 TGTCTATTCTTTGTCATAAATGG + Intronic
1073850639 10:107613386-107613408 TTTCTTTTCTGAGACACAAATGG + Intergenic
1077878088 11:6324583-6324605 TTTCTATTCTTAGCCAGATGCGG + Intergenic
1077998341 11:7473294-7473316 TTTCTTTTCAAAGCCAGAAAAGG - Intergenic
1078328579 11:10400436-10400458 CTTCTACTCTGTTCCAGGAAAGG + Intronic
1079152301 11:17911044-17911066 CACCTATTCTGTGCCAGACATGG + Intronic
1079420876 11:20286676-20286698 TTTGTATATTGTGACAGAAACGG + Intergenic
1081652457 11:44833555-44833577 TTTATCTTCTGTGCTCGAAAAGG + Intronic
1081850957 11:46274885-46274907 GCTCTATTCTGTGCCAGGACTGG - Intergenic
1083095350 11:60244809-60244831 TTTCTATTCTCTAGCAAAAAGGG - Intergenic
1085191779 11:74632289-74632311 TTTTTATTCTGTCCCAACAAAGG + Intronic
1085977645 11:81679045-81679067 TTTCTATACTGTGAGAGATAGGG + Intergenic
1086347511 11:85912307-85912329 TTTCTATTGTTTTCCAGGAAAGG + Intronic
1087382684 11:97426936-97426958 TTTCTATTCTGTGGCAGGGATGG + Intergenic
1088417872 11:109609282-109609304 TTACATTTCTTTGCCAGAAATGG + Intergenic
1089293626 11:117454656-117454678 TTTTTATTGTATGCCAGACACGG + Intronic
1089904561 11:122025037-122025059 TTGCTCTTCTGTGGCAAAAATGG + Intergenic
1090477385 11:127035915-127035937 TGGCTATTCTGTGCCAGACAGGG + Intergenic
1091143517 11:133257254-133257276 TTTCAAAACTGTGCAAGAAAAGG + Intronic
1091733815 12:2902495-2902517 TTCCTACACTGTGCCAGATAAGG - Intronic
1092762989 12:11826392-11826414 TTTTCATTCTGTGCTGGAAAAGG - Intronic
1092904365 12:13088634-13088656 TTTCTCTTCTGAGCCCCAAAGGG - Intronic
1093250189 12:16793394-16793416 TTTCTCTTCTGTGACAAAATGGG - Intergenic
1093473501 12:19530033-19530055 TTTTTTTTTTTTGCCAGAAAAGG + Intronic
1094240485 12:28217526-28217548 TTATTTTTCTGTGCCACAAAGGG + Intronic
1095797821 12:46239635-46239657 TTTCTATCCAGTGAAAGAAATGG - Intronic
1098529435 12:71523898-71523920 TTTCTAAACTCTACCAGAAAAGG - Intronic
1098541238 12:71660663-71660685 TTTTTATTCTGTATTAGAAAAGG - Intronic
1098796996 12:74901930-74901952 TTTCTATTATGTATGAGAAATGG + Intergenic
1098981829 12:76964494-76964516 TTTCTATTCTGAACTATAAAGGG + Intergenic
1099606138 12:84803852-84803874 TTTTGAGACTGTGCCAGAAAAGG + Intergenic
1100649787 12:96572771-96572793 TTTCTATTTTGGGGTAGAAATGG + Intronic
1101306887 12:103537193-103537215 TTTCTCTTCTGTGCTAGAACTGG - Intergenic
1101350058 12:103921418-103921440 TTTCTATTCTTTGGTAGACACGG - Intergenic
1102119289 12:110428603-110428625 TTTCTTTTTTTTTCCAGAAAAGG + Intergenic
1102745643 12:115246629-115246651 CTTCTACTGTGTGCCAAAAATGG - Intergenic
1104023092 12:125006717-125006739 TTTCTCTGCTGTGGGAGAAATGG - Intronic
1104228594 12:126861381-126861403 TTTATATTTTGTGCCAAAAATGG - Intergenic
1104728139 12:131090167-131090189 CATCTATTCATTGCCAGAAAAGG + Intronic
1106679347 13:31994135-31994157 TATTTATTCTGTGAAAGAAATGG - Intergenic
1106691768 13:32125001-32125023 TTTCTATTCAGTTTCAGAGATGG - Intronic
1106891638 13:34252489-34252511 TTTCTATTCTTTGGCATAACAGG + Intergenic
1106928773 13:34641052-34641074 GTTCTGTCCTGTGCAAGAAAGGG - Intergenic
1107457758 13:40570597-40570619 TTTCTGTTCTGTCCCTGAAGGGG - Intronic
1108644761 13:52416081-52416103 TTTCTATTAGGTTTCAGAAAAGG - Exonic
1108992493 13:56678837-56678859 TTTCTATTATGTTCCAGAGGTGG + Intergenic
1110202929 13:72874500-72874522 TTTCTATTATGTCACATAAATGG - Intronic
1110815207 13:79853338-79853360 TTCCTATACTCTGCAAGAAAGGG + Intergenic
1110931894 13:81229976-81229998 TTTTTATTGTTTGGCAGAAACGG - Intergenic
1111047969 13:82840641-82840663 TCTGTCTTCTTTGCCAGAAAAGG + Intergenic
1111149424 13:84229735-84229757 TTTCCATTCTGTGGTAGGAAAGG - Intergenic
1111253127 13:85631191-85631213 TTTGTTTTCTATACCAGAAAGGG + Intergenic
1112829267 13:103428637-103428659 TGTCTTCTCTGTGCCAGATATGG + Intergenic
1112864568 13:103877518-103877540 TTTCTTTTCTGTTCCACAACTGG + Intergenic
1114338805 14:21721416-21721438 TTTTAATTTTGTGCTAGAAATGG - Intergenic
1114475814 14:22993989-22994011 TCTCTATTCTGTGCTTGAGAAGG - Intronic
1114737097 14:25053015-25053037 TTGCTATTCTGGGAAAGAAAAGG + Intergenic
1115342712 14:32309132-32309154 GTTCTTTACTGTGCCACAAAAGG + Intergenic
1116463998 14:45211559-45211581 TTTATTATCTGTGCCAGCAAAGG - Intronic
1117385316 14:55206318-55206340 TTTGTCTTATGTGTCAGAAAAGG + Intergenic
1117719285 14:58612732-58612754 TTCATATTCTGTACCAGAATGGG - Intergenic
1117862523 14:60107433-60107455 TGTCAAGTATGTGCCAGAAAGGG + Intronic
1118509301 14:66453207-66453229 TTTCTTTTCAGTAGCAGAAATGG + Intergenic
1118607375 14:67514291-67514313 TTTCTATGCTCAGTCAGAAACGG - Intronic
1118896603 14:69950389-69950411 TTTCTCTGCTGTTCTAGAAAAGG + Intronic
1122396890 14:101439971-101439993 TTTCTATAGAATGCCAGAAATGG + Intergenic
1124856694 15:33396188-33396210 ATACTATTCTGGGCCAGAATAGG - Intronic
1126118011 15:45226520-45226542 TATTTATTCTGAGCCAAAAATGG + Intergenic
1127114592 15:55712363-55712385 CTTGTTTTCTGTGCCAGCAAAGG + Intronic
1131279931 15:91012935-91012957 TTCCTTTCCTGTGCAAGAAAAGG + Intronic
1132091541 15:98951403-98951425 TTTCTATACTGGGCAAGAAAAGG - Intronic
1133307699 16:4821261-4821283 TTTCCATTCAATGCCAGCAATGG + Intronic
1133454831 16:5932902-5932924 TTTTTTTTCTTTGCCAGGAAGGG - Intergenic
1134162169 16:11900379-11900401 TATCTATTATGGGCCAGACAAGG + Intronic
1134507339 16:14818925-14818947 TTTCTATGCTGTGTCCCAAAAGG + Intronic
1134776036 16:16854556-16854578 TTTAGATTCTGTAGCAGAAAGGG - Intergenic
1135242161 16:20817550-20817572 TTTATATTCTGTACCAGCCACGG + Intronic
1135467858 16:22702539-22702561 TGTTTATTATGTGCCAGACATGG + Intergenic
1137488019 16:48907810-48907832 CTGCTTTTCTGTGCCAGAAATGG + Intergenic
1140855748 16:78976141-78976163 TGCCTACTCTGTGCCAGGAACGG - Intronic
1140942052 16:79731142-79731164 TTTTTGTTCTGTTCCATAAACGG - Intergenic
1141442611 16:84039390-84039412 TTTCTATTTTGCCCCAGAGAAGG + Intronic
1141725046 16:85782432-85782454 CTTCTATCCTATGCCAGGAAGGG + Intronic
1141910522 16:87055507-87055529 TTCCCTTTCTCTGCCAGAAAAGG - Intergenic
1143254606 17:5546393-5546415 TTTCTCTTCTGTTCCAGAGGAGG + Intronic
1143488248 17:7267542-7267564 TGTCTATAATGTGCCAGACATGG + Intergenic
1146661988 17:34671001-34671023 GTTCTCTTCTTTCCCAGAAATGG + Intergenic
1146809522 17:35892100-35892122 TATCTACTTTGTGCCAGAAATGG - Intergenic
1149987813 17:61361123-61361145 TTTATTTTCTGTGTCATAAATGG + Intronic
1150749665 17:67848720-67848742 TTTGTATTCTGTAACACAAAAGG - Intronic
1151092157 17:71453852-71453874 TTTCAGTTTTGTGCTAGAAATGG + Intergenic
1153070043 18:1095079-1095101 GTTTTATTCTCTGACAGAAAGGG + Intergenic
1153547510 18:6223784-6223806 TTTCTATTCTCCGGCTGAAATGG + Intronic
1155370188 18:25091041-25091063 TTTCTATTCTGTGATAAAGAGGG - Intronic
1156536322 18:37868076-37868098 TTTCTACTCTGTCTCTGAAAAGG + Intergenic
1156675212 18:39519871-39519893 TATCCAGTATGTGCCAGAAATGG - Intergenic
1157425748 18:47582863-47582885 TGTTTATGCTGTCCCAGAAATGG - Intergenic
1157520971 18:48345270-48345292 TTTCTATTTCCTGCAAGAAAGGG - Intronic
1159974477 18:74692990-74693012 TTTCTCATCTGTGCCAGTAGAGG + Intronic
1163853537 19:19681251-19681273 GTTCTATTCAGAGCCATAAAAGG + Exonic
1164528765 19:29031238-29031260 TTTCAATTTTGTGTCAGAAATGG + Intergenic
1166189798 19:41168753-41168775 TTTTTTTTTTTTGCCAGAAAGGG + Intergenic
1166900189 19:46055262-46055284 TTTCTGTTCTTTTCCAGATAGGG + Intronic
1168189808 19:54729772-54729794 TTTCTCACCTGTGACAGAAACGG - Exonic
925192654 2:1898156-1898178 TATCTATTCTCTGCAAGAAAAGG - Intronic
925484757 2:4316015-4316037 GTTCTATTCTGTCCCAGGATAGG + Intergenic
925608906 2:5686842-5686864 TTCTTCTTCTGTGCCTGAAAGGG - Intergenic
926404642 2:12538836-12538858 TATCTATTCAGTGGCAGAACTGG + Intergenic
926495657 2:13583698-13583720 TTCCTCTTCTGTGAGAGAAAGGG - Intergenic
928204486 2:29274230-29274252 TTTGTACTTTGTGCCAAAAAAGG + Intronic
928521862 2:32096947-32096969 TTTGTGTTTTGTGCCAAAAAGGG + Intronic
929213117 2:39381648-39381670 TTTTTATACTGTGTCAGATAGGG + Intronic
929416779 2:41750989-41751011 TATCTACTATGTGCCAGATAAGG + Intergenic
932870329 2:75392051-75392073 TTTCTAGTCTGTGCATGTAAAGG - Intergenic
933194333 2:79371524-79371546 TTTCTTTTGTCTGCCAGAGAAGG - Intronic
933527306 2:83458009-83458031 CTTTTATTCTCTGGCAGAAAGGG + Intergenic
933982570 2:87564888-87564910 TTTATATTATGTTCTAGAAAAGG + Intergenic
935469630 2:103442688-103442710 TTTCTATTGTGTTCCAGGAATGG - Intergenic
936275214 2:111090345-111090367 TTTCTTTTGTGTTCCAGAGATGG - Intronic
936311271 2:111385904-111385926 TTTATATTATGTTCTAGAAAAGG - Intergenic
936661784 2:114551014-114551036 TATCTATTATGTGCCAGACCAGG - Intronic
938749024 2:134311025-134311047 ATTCTATTTTGTGTCAGACAAGG - Intronic
938976928 2:136487685-136487707 TTTCTCTACTGTGGCAGCAAGGG + Intergenic
939106400 2:137953411-137953433 TTGCAATTCTGTGCTAAAAATGG - Intergenic
939183264 2:138828556-138828578 TATCTCTTCTCTGCCAGACATGG - Intergenic
939198442 2:139002963-139002985 TTTCTCTTCAGTGACAGAAAAGG - Intergenic
939919397 2:148090057-148090079 TTTCTATTTTGTGCGTGTAAAGG - Intronic
940122342 2:150280949-150280971 TTCTTATTCTGTTACAGAAATGG + Intergenic
940881535 2:158951936-158951958 CTTCTACCATGTGCCAGAAACGG - Intergenic
941429801 2:165400201-165400223 TTCCTATTCTTTGAAAGAAAAGG + Intergenic
942142450 2:172991090-172991112 GCTCAATGCTGTGCCAGAAATGG - Intronic
943000624 2:182323931-182323953 AATCTATGCTGTGCCTGAAAAGG - Intronic
944161258 2:196662756-196662778 TTTCTTTTTTTTTCCAGAAATGG - Intronic
944664783 2:201950876-201950898 TTTCCCTTTTGTGCCAGAAGAGG - Intergenic
945468297 2:210197036-210197058 ATTCTACTCTTTTCCAGAAATGG - Intronic
946147187 2:217739871-217739893 TTCCAATTATGTCCCAGAAATGG + Intronic
947704167 2:232261025-232261047 TGTATTTTCTGTGCAAGAAAAGG - Intronic
1168864952 20:1078370-1078392 TTTCTGTCCTGTGCCAAGAAGGG - Intergenic
1169701159 20:8448179-8448201 TTTTCATTCTGTTCAAGAAAAGG - Intronic
1170074822 20:12408154-12408176 GTTCTATGCTTAGCCAGAAAAGG - Intergenic
1170650308 20:18233774-18233796 TTTCTTTCCTGAGACAGAAAGGG + Intergenic
1170951715 20:20942662-20942684 TTTCTATTCTGTGAGAGTACAGG - Intergenic
1171033015 20:21693606-21693628 TTTCTATTCTGTCCTTCAAATGG + Intergenic
1171093632 20:22310438-22310460 TTGCTATTCTTTGCCAGAACTGG + Intergenic
1171102426 20:22397870-22397892 GTTCTATTATGTGCCAGTATAGG + Intergenic
1172287876 20:33753715-33753737 TTTCTTTTTTTTGCCTGAAAAGG - Intronic
1174752490 20:53125375-53125397 TTACTATTCTTTACAAGAAAAGG - Intronic
1175082783 20:56435219-56435241 TCTCTATTCTGTTACAAAAATGG - Intronic
1176192532 20:63818999-63819021 TTTGTATTCTGTAGTAGAAACGG - Intronic
1176319019 21:5289248-5289270 TTTGTGGTCTGTGGCAGAAAAGG - Intergenic
1176320519 21:5315793-5315815 TTTGCAGTCTGTGGCAGAAAAGG - Intergenic
1176477905 21:7245813-7245835 TTTGCAGTCTGTGGCAGAAAAGG - Intergenic
1178819470 21:35962206-35962228 TTTCCATTCTGACCCAGAACAGG + Intronic
1179266996 21:39812598-39812620 CTTCTACTCTGGGACAGAAAAGG + Intergenic
1181991002 22:26836695-26836717 TTTCTACTCTGAGCCAGGCATGG - Intergenic
1182114288 22:27746400-27746422 CTCCTATTATGTGGCAGAAACGG - Intergenic
1182290628 22:29276468-29276490 ATTATATTCTGTGCTACAAATGG + Intronic
1182668472 22:31975997-31976019 TTTTTATACTGGGCCAGGAATGG + Intergenic
1183954778 22:41372898-41372920 TTTCTTTCCTGTCCCAGGAAGGG - Intronic
1184531664 22:45060024-45060046 TTCCTATGCTGTGCCTAAAATGG + Intergenic
949784028 3:7720766-7720788 TGTCTACTATGTGCCAGACATGG - Intronic
951083211 3:18477139-18477161 TTTCTTTCCTGTCCCAGCAATGG - Intergenic
951153173 3:19316884-19316906 TATTTATCCTGTGCCAGAAATGG - Intronic
952236828 3:31488560-31488582 TCTCTCTTCTGTGGCAGAAGGGG - Intergenic
952434968 3:33264121-33264143 TTTCTAGTCTGTGCATGTAAAGG + Intergenic
953094659 3:39763253-39763275 TTTCTATGTTGTGCAAGATATGG - Intergenic
953184245 3:40623620-40623642 TTTCTCTTGTGAGCCAGAAGAGG - Intergenic
953322754 3:41986914-41986936 TTTCTCTTCTGTGCTTGCAATGG - Intergenic
954559455 3:51544148-51544170 TAGCTACACTGTGCCAGAAATGG - Intronic
955058535 3:55476645-55476667 TTTGTATTCTGCGGCATAAAAGG - Intronic
958273334 3:91537967-91537989 TTTTTATCCTGTGGTAGAAAAGG - Intergenic
958702220 3:97607421-97607443 TTTCTTTTCTATAACAGAAAAGG + Intronic
959505671 3:107153829-107153851 GTACAATTCTGTGCCAGAGAAGG - Intergenic
959728511 3:109573470-109573492 TTGCTTTTCTGTGCCACCAATGG + Intergenic
959754480 3:109881665-109881687 TTTCTAATTTGTGACAGAAGTGG + Intergenic
959816533 3:110680431-110680453 CATTTATTCTGTGCCAGACATGG + Intergenic
959927528 3:111940461-111940483 TTGCTAGTCTGTCCTAGAAAAGG - Intronic
960934463 3:122889099-122889121 TCTCTATTCTGAGATAGAAAAGG - Intergenic
962617050 3:137136856-137136878 ACTCTTTTCTGTGCCACAAAAGG + Intergenic
963256795 3:143152966-143152988 TTTCTTTGGTGTGCCAGAAAAGG - Intergenic
964090097 3:152865621-152865643 TTTTTATTCTGTTACATAAAAGG + Intergenic
964311384 3:155397115-155397137 TTACTATTTTATGCCAGACATGG + Intronic
964689422 3:159433369-159433391 TTTGTATGCTCTGCAAGAAAGGG + Intronic
964693337 3:159478596-159478618 TTTCTATTCTGTGAAAAAAATGG + Intronic
964839654 3:160980018-160980040 TTTCTACCCTGGGCCAGAACTGG + Intronic
965387793 3:168065530-168065552 TATTTATTCAGTGTCAGAAAAGG - Intronic
965427478 3:168545659-168545681 TTGCTATTTTATGCCAGTAAGGG - Intergenic
966030191 3:175336870-175336892 TTTCTATTCTGTCACTGAAATGG - Intronic
966624778 3:182004186-182004208 TTTCTACTGTGTGCCAGGTATGG + Intergenic
967000862 3:185333085-185333107 TTCATATTCTTTGCCAGTAATGG + Intronic
967582369 3:191174249-191174271 TTTGTATTTTCTGGCAGAAAGGG - Intergenic
967699140 3:192571232-192571254 TTTCTGTGCTGTAGCAGAAAGGG + Intronic
969703049 4:8778160-8778182 TCCCTATTGTGTGCCAGCAAAGG + Intergenic
971217458 4:24674329-24674351 TGTCTCCTCTGTGCCAAAAAGGG - Intergenic
971370327 4:26013988-26014010 TATGTATTCTGTGCCAGGCATGG - Intergenic
971370795 4:26017151-26017173 TTTCTAGCCGGGGCCAGAAAAGG - Intergenic
971815471 4:31482110-31482132 GTTATATTATATGCCAGAAAGGG - Intergenic
972704555 4:41529300-41529322 ATTCAAATCTGTGCAAGAAAAGG - Intronic
973225932 4:47785014-47785036 TTTTTATTTTGAGCCAGGAAAGG - Intronic
973942354 4:55923853-55923875 TTCCTCTTCTGTCCCAGAATTGG + Intergenic
974572061 4:63665651-63665673 TTTCTATACGGTGTAAGAAAGGG + Intergenic
975561733 4:75714790-75714812 TTCTTATTCTGGGCAAGAAAAGG - Intronic
975581936 4:75915021-75915043 TTTCTCTAATATGCCAGAAAGGG + Intronic
976076167 4:81301340-81301362 TTTGTATTCTTTTCCATAAATGG - Intergenic
976329253 4:83810203-83810225 GCTTTCTTCTGTGCCAGAAATGG + Intergenic
976526001 4:86089461-86089483 TTTCTGTTATATGACAGAAAAGG - Intronic
976858906 4:89639496-89639518 TTTCTTTTCAGTGTAAGAAAGGG + Intergenic
976864078 4:89703289-89703311 TTTCCTTTCTGTGACAAAAACGG + Intergenic
979768916 4:124498197-124498219 TGTCTATTCTGTGCCAGATTTGG - Intergenic
979888331 4:126060319-126060341 TTTATATTCTGAGCCTGAATTGG + Intergenic
980176596 4:129353668-129353690 TGTCTATTCTGTGCCAGGTGTGG + Intergenic
980608121 4:135120687-135120709 TCTCCTTTCTGTTCCAGAAATGG + Intergenic
981447117 4:144852655-144852677 CTCCTATTGTGTGCCAGAAATGG + Intergenic
982240322 4:153293593-153293615 TTTCATTTCTGTGCCAAAGAAGG - Intronic
984182794 4:176506038-176506060 TTTTTATTGTGTGCCAAATATGG + Intergenic
984395639 4:179195199-179195221 TTTCTATTCAGTCCAAGGAATGG + Intergenic
984733025 4:183086061-183086083 TTTCTATTTTTTGGTAGAAATGG - Intergenic
985024742 4:185729603-185729625 TTTCTACTCTGTGAAAGACAAGG + Intronic
986773288 5:10992774-10992796 TTTCTATGGTGTGTCAGAAGAGG + Intronic
987114469 5:14715037-14715059 TTTCTGGGCTGTGACAGAAATGG - Intronic
987575971 5:19729184-19729206 TTTATATTCTGTTCCATAAATGG + Intronic
989359131 5:40579293-40579315 TTTCTATTTTGGGGCAGAAGGGG + Intergenic
990327848 5:54695838-54695860 CTTCTACTCTGTGCCAGGCAGGG + Intergenic
991934501 5:71788759-71788781 TATCTACTATGTGCCAGATATGG + Intergenic
992830229 5:80586840-80586862 TTTTTTTTCTTTCCCAGAAAAGG - Intergenic
992934588 5:81688242-81688264 ATTCTATTCTGTGCCTGAGCTGG - Intronic
993356497 5:86915435-86915457 TCCCTATTCTGTTCCACAAATGG - Intergenic
993646715 5:90472159-90472181 TTTTGATTCTGTGTCAGCAATGG - Intronic
994406976 5:99357500-99357522 TTTCTAATCTGTGACATAAAAGG - Intergenic
994773122 5:104008931-104008953 TTTCAAATCCCTGCCAGAAAGGG - Intergenic
995808006 5:116075770-116075792 TTTCTCATCAGTGCCAGAGAAGG + Intergenic
996043455 5:118843243-118843265 TTTCTATTCTGGGCCGGATGCGG - Intronic
996618109 5:125466329-125466351 TGCCTACTCTGTGCCAGACATGG + Intergenic
997091783 5:130866673-130866695 TTCCTATGCTCTCCCAGAAAGGG + Intergenic
997821133 5:137067188-137067210 TTTCTCTTCTGTGGCTGAGAGGG - Intronic
997925735 5:138029839-138029861 TTTCTATTCTGTTCCTGAAAAGG + Intronic
997952441 5:138253050-138253072 TTTTCATTCTGTGGAAGAAATGG + Exonic
998939625 5:147267137-147267159 TTCCTATTCTCTGCCAAAAATGG + Intronic
999188250 5:149728871-149728893 TGCCTACTATGTGCCAGAAACGG + Intergenic
1001467445 5:171980839-171980861 TTTCGCTTTTGTGCCAGTAATGG - Intronic
1001636640 5:173214783-173214805 TTTCTATGATGTGGCAGAAATGG + Intergenic
1002005351 5:176228580-176228602 TCTCTATTTTGTTCCAGACATGG + Intergenic
1002221025 5:177682049-177682071 TCTCTATTTTGTTCCAGACATGG - Intergenic
1003050242 6:2774048-2774070 TTTCTATTCAATGGCACAAAAGG - Intronic
1003050869 6:2780248-2780270 TTTCAAAGCTCTGCCAGAAAAGG + Intronic
1003682238 6:8267590-8267612 TTTCTGTTTTCTACCAGAAATGG + Intergenic
1004465592 6:15882101-15882123 TTTCTAATTTTTGGCAGAAATGG + Intergenic
1004761616 6:18672985-18673007 TTTCTAGGCAGTGACAGAAATGG + Intergenic
1005314200 6:24588463-24588485 CATCTATCATGTGCCAGAAACGG - Intronic
1005661798 6:28005616-28005638 TTTATTATCTGTGCCAGCAAGGG - Intergenic
1006660315 6:35636536-35636558 TTGATATTCTGTGACAGAAAGGG - Intronic
1007028196 6:38599734-38599756 TTTCTCTTCTGTGACTGCAATGG + Intronic
1007511696 6:42379201-42379223 TGTCTTTTCCTTGCCAGAAAAGG + Intronic
1008247860 6:49201278-49201300 TTTTATTTCTGTGGCAGAAATGG + Intergenic
1008668050 6:53736731-53736753 TTTCCCTTCTTTACCAGAAAAGG + Intergenic
1008743298 6:54636656-54636678 TTTCTATTCTGTGACAGAATTGG - Intergenic
1008993603 6:57632970-57632992 AATCTATTCTGTGCCAGACTGGG - Intronic
1009065321 6:58453662-58453684 TTTGAAGTCTCTGCCAGAAAAGG + Intergenic
1009182209 6:60532056-60532078 AATCTATTCTGTGCCAGACTGGG - Intergenic
1009502757 6:64436906-64436928 TGTCTATTCTTTCCCAGAGAGGG + Intronic
1009754076 6:67912242-67912264 TTTATATTATGTTCTAGAAAAGG - Intergenic
1010155777 6:72790931-72790953 TTTTTAGTATGTGCCAGAAATGG + Intronic
1010693465 6:78940069-78940091 TTTCTCTTGTTTGGCAGAAATGG + Exonic
1011217092 6:85016390-85016412 TTTCTCTGCTGTGACGGAAAAGG - Intergenic
1012014794 6:93836355-93836377 TTTTTAATCTTTGCCATAAAAGG + Intergenic
1012203153 6:96431060-96431082 TTTCTATTTTGTGCATGTAAAGG + Intergenic
1013083107 6:106830077-106830099 TTTGTATTTTGTGCCAGGCATGG + Intergenic
1014487859 6:122022624-122022646 TTTGTATTGTGTGCCAGAAAAGG - Intergenic
1014767551 6:125424125-125424147 TTTCTATTCTGAGACAGAACAGG + Intergenic
1015111365 6:129595636-129595658 TTTCTATTCTGTGCATGACAGGG - Intronic
1015485226 6:133762342-133762364 TTTTTATTTTCTGCCAAAAATGG - Intergenic
1015976085 6:138792362-138792384 TTTCTATTCTTTGTTAGAGATGG - Intronic
1017950967 6:159134645-159134667 TGCCTATTGTGTGCAAGAAAAGG - Intergenic
1018020695 6:159760439-159760461 TTTCTATTTTATGGTAGAAACGG + Exonic
1018447276 6:163869377-163869399 TTTCTATTCTCTGACCTAAAGGG - Intergenic
1021138421 7:16993668-16993690 TTGCTACACTGTGGCAGAAAAGG - Intergenic
1021445798 7:20732183-20732205 TTGCTATTCTCTGCCTGGAATGG + Intronic
1021540152 7:21748541-21748563 TTTCGATTTTGTGCCATAATGGG + Intronic
1021922803 7:25503693-25503715 TTCCTGGTCTGTGCCAGACAGGG + Intergenic
1022403763 7:30066811-30066833 TTTCTATTCTGTGCCAGAAAAGG - Intronic
1023487794 7:40705523-40705545 TTTCTAGTCAGTGTCAAAAATGG - Intronic
1023698003 7:42866997-42867019 GTTCTATGCTTAGCCAGAAATGG - Intergenic
1024092806 7:45960561-45960583 TTTGTATTTTGTAGCAGAAACGG + Intergenic
1024168491 7:46759425-46759447 TTTGTAGTCTGTGCCCAAAAGGG + Intronic
1024468254 7:49737631-49737653 TTTTTATTTTTTGGCAGAAATGG + Intergenic
1027681486 7:81227774-81227796 TTTTTATTCTGTCCCACAAAAGG - Intergenic
1028361979 7:89979015-89979037 TTCCTATTGTGTGGCAGAATTGG - Intergenic
1029012856 7:97281106-97281128 TATCTATTCTGTGCCTGGAATGG + Intergenic
1030087658 7:105830723-105830745 TTCCACTTCTGTGCCAGGAAAGG + Intronic
1030580127 7:111344526-111344548 TTTCTACTGTATGCCAGACATGG - Intronic
1031082395 7:117271408-117271430 TGTCTAATGTGTGCCAGTAAAGG - Intergenic
1031468119 7:122138776-122138798 TTTTTATTATTTTCCAGAAAAGG + Intronic
1034536937 7:151731289-151731311 CTTCCCTTCTGTGCCAGACATGG + Intronic
1034625479 7:152488924-152488946 CTTCTATGCTGTGCTGGAAATGG + Intergenic
1037462543 8:19127209-19127231 TTACTATTCTGTGGGACAAAGGG - Intergenic
1037578261 8:20228364-20228386 ATTCTATCCTGTTCTAGAAAGGG - Intergenic
1038551327 8:28471891-28471913 TTTCTCATCTGTGCCTCAAAAGG - Intronic
1038810154 8:30832864-30832886 TTACAATTCTATGCCAGATATGG - Exonic
1040402923 8:47070844-47070866 TTTGAATTCTGGGCCAGACACGG - Intergenic
1040586304 8:48745617-48745639 TTTCTCTTCTGTCCCAGATAAGG - Intergenic
1040848373 8:51871064-51871086 TTTCATTTCTGTGACAGAAAGGG + Intronic
1041883753 8:62783933-62783955 TGTGTATTCTGGGCCAGACACGG - Intronic
1042740330 8:72036452-72036474 ATTCTTTTCTATCCCAGAAAAGG - Exonic
1042756051 8:72212174-72212196 ATTCTTTTCTATCCCAGAAAAGG - Intergenic
1042966089 8:74353967-74353989 TGTCTATTATGTGCCAGGCATGG + Intronic
1043478150 8:80625483-80625505 TTTTTATCCTGTACTAGAAATGG + Intergenic
1044025893 8:87171807-87171829 TTTCTTTTTTTTGCTAGAAATGG + Intronic
1044476107 8:92628247-92628269 TTTCTATGAACTGCCAGAAAGGG + Intergenic
1045314260 8:101029548-101029570 TTTCTATTTAGTGCCACAAATGG + Intergenic
1045722415 8:105129231-105129253 TTTCTACCCAGTGCCAGCAAAGG + Intronic
1045889122 8:107133704-107133726 TTCCTACTGTGTGCCAGGAATGG + Intergenic
1045963417 8:107996086-107996108 TAACTTCTCTGTGCCAGAAAGGG + Intronic
1048760146 8:137785288-137785310 CATCTAGACTGTGCCAGAAAAGG - Intergenic
1051617095 9:19016671-19016693 TTTCTAATCTGTGGCACCAATGG - Intronic
1052207214 9:25856797-25856819 TTTCTTTTCTAGACCAGAAATGG - Intergenic
1053523046 9:38801239-38801261 TTTCTAGTCTGTGCATGTAAAGG - Intergenic
1054195271 9:62025659-62025681 TTTCTAGTCTGTGCATGTAAAGG - Intergenic
1054643137 9:67563030-67563052 TTTCTAGTCTGTGCATGTAAAGG + Intergenic
1055262529 9:74454746-74454768 TTTCTATTCTCTGGCAGACTGGG - Intergenic
1056088017 9:83173808-83173830 TAACTTTTCTATGCCAGAAATGG - Intergenic
1056371884 9:85964006-85964028 TTTCTAATCTTTGCCAACAATGG - Intronic
1057228262 9:93303893-93303915 TTTTTCTCCTGTGCCAGAAAAGG + Intronic
1058189948 9:101901276-101901298 TTTCTATTCTCTGTCTAAAATGG - Intergenic
1059852798 9:118363208-118363230 TGTGTTTTCAGTGCCAGAAATGG - Intergenic
1059992348 9:119877155-119877177 TTCCTTTTCTCTGCCAGAAGAGG + Intergenic
1060902812 9:127275804-127275826 GTTCTTTTATGTGCAAGAAAAGG + Intronic
1060903672 9:127285146-127285168 TTCCTTTTCTGGGCCAGACATGG + Intronic
1061029110 9:128068833-128068855 CTTCTACTCTGGGCAAGAAAGGG - Intronic
1185673264 X:1828167-1828189 TTTTTCTTCCTTGCCAGAAAAGG + Intergenic
1186550316 X:10497886-10497908 TGCCTATTTTGTGCCAGACATGG - Intronic
1186933835 X:14424970-14424992 CATCTATTATGTGCCAGAAATGG - Intergenic
1189364674 X:40379410-40379432 TGTCTTTTCTGTTCCATAAAGGG + Intergenic
1190164327 X:48059769-48059791 TTCCTGTTCTGTGCCTGAGAAGG - Exonic
1190514060 X:51204994-51205016 TTTCTATACTTTACCAGAAGTGG + Intergenic
1194018837 X:88660819-88660841 TATGGATTCTGTGCCAGAAACGG - Intergenic
1194036381 X:88878176-88878198 TTTATATTCTGTGCTAGCAATGG - Intergenic
1194157502 X:90410344-90410366 TTTGTATGCTGTGACAGATAGGG + Intergenic
1194757477 X:97754304-97754326 TTTCAAATCAATGCCAGAAAGGG + Intergenic
1195116614 X:101705592-101705614 GTTCTATTCTCTGGAAGAAAAGG + Intergenic
1196062742 X:111428814-111428836 TGTCCAGTCTGTGCAAGAAAGGG + Intergenic
1196395262 X:115254452-115254474 TTTCTATTCTGTGCCATTGATGG - Intergenic
1197686713 X:129447220-129447242 TTTCTTTTCTGTGACTAAAATGG + Exonic
1197958834 X:131981801-131981823 TTGCTATTCTGTGGCTGATATGG - Intergenic
1198326924 X:135583464-135583486 TTTCTCTCCTGTGGCAGAGAAGG - Intergenic
1198770800 X:140127747-140127769 TCTCTATTCTGGGCTAGAGAAGG + Intergenic
1198851120 X:140966345-140966367 TTTATTATCTGTGCCAGCAAGGG - Intergenic
1200166267 X:154037667-154037689 TTTCAATTCTGTGCAATGAAAGG + Intronic
1200503836 Y:3987325-3987347 TTTGTATGCTGTGACAGATAGGG + Intergenic