ID: 1022407289

View in Genome Browser
Species Human (GRCh38)
Location 7:30102617-30102639
Sequence ATGCTGATATGGATGAATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 156}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022407287_1022407289 5 Left 1022407287 7:30102589-30102611 CCATAGGAAAGGAATCAGGATCT 0: 1
1: 0
2: 1
3: 68
4: 271
Right 1022407289 7:30102617-30102639 ATGCTGATATGGATGAATCTTGG 0: 1
1: 0
2: 0
3: 20
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022407289 Original CRISPR ATGCTGATATGGATGAATCT TGG Intronic
902233954 1:15045944-15045966 ATACTGATATGGTTGGCTCTGGG - Intronic
902729167 1:18357355-18357377 ATGGGGATATGGATGAATTGGGG + Intronic
909027081 1:70494484-70494506 ATGCTGAGATGGGTGTTTCTGGG + Intergenic
909080552 1:71106311-71106333 ATGCTGAATTGGATGATTTTGGG + Intergenic
910071123 1:83214465-83214487 ATGCTGCTATGGATGGAAATAGG + Intergenic
910313086 1:85849779-85849801 ATGCTGAGATGGATGCCTTTGGG - Intronic
912262859 1:108126546-108126568 ATCCTGAAATGGATGATTCAAGG + Intergenic
913508954 1:119545271-119545293 ATGCTGGTGTGGATGAAGCCTGG - Intergenic
920084594 1:203406057-203406079 AGGCTGAAAATGATGAATCTGGG + Intergenic
920414834 1:205791953-205791975 ATGCTGATGTGGGTGACCCTGGG - Intronic
920730511 1:208479352-208479374 ATTCTGATGTGGATGACTTTAGG - Intergenic
920750121 1:208666339-208666361 AGACTGATATTGATGAATCTTGG - Intergenic
921482980 1:215684780-215684802 ATCCTGAAATGGATGAGTTTTGG + Intronic
1065191955 10:23220550-23220572 ATGTTGTCATGCATGAATCTTGG + Intronic
1068269032 10:54695652-54695674 ATCTTGTTATGGATGAATGTAGG + Intronic
1070913580 10:80138401-80138423 ATGGTGTTATTGCTGAATCTGGG - Intronic
1072046155 10:91657158-91657180 ATGAAGATATGGATGAATCCTGG - Intergenic
1072501386 10:96021552-96021574 ATGTAGATATGCATGACTCTTGG - Intronic
1072766680 10:98100108-98100130 ATGCTGATGTGCAGGACTCTTGG - Intergenic
1074106638 10:110394005-110394027 ATGCAGGGATGGAAGAATCTAGG - Intergenic
1074359683 10:112815285-112815307 ATGCGGTTCTGGATGATTCTAGG - Exonic
1074496843 10:113986958-113986980 ATGGTGACATGGATGAAACCTGG - Intergenic
1074625555 10:115180374-115180396 ATAATGACATGGATGAATCTTGG - Intronic
1074870135 10:117569793-117569815 CTGCTGAAATGGAAGCATCTTGG - Intergenic
1078267158 11:9764009-9764031 AAGCTGGAATGGAGGAATCTGGG + Intergenic
1079537743 11:21535309-21535331 ATGCTGATTTGGACCAACCTAGG + Intronic
1080071879 11:28099182-28099204 ATGACGACATGAATGAATCTAGG + Intronic
1080401248 11:31938006-31938028 AGGCTGAGATGGGAGAATCTGGG - Intronic
1082052689 11:47785229-47785251 AAGCTGAAATGGGAGAATCTGGG - Intronic
1084553162 11:69861035-69861057 CTGCTTATCTGGATGAAGCTCGG - Intergenic
1085634861 11:78150772-78150794 ATGCTGATAAAGAGGAATTTGGG - Intergenic
1085862883 11:80255340-80255362 TGGCTGATATGGCTGAATGTGGG - Intergenic
1087748850 11:101982986-101983008 ATGCTTACATGGGGGAATCTGGG - Intronic
1088129677 11:106472333-106472355 TTGCTGGTATTGATGAATGTAGG + Intergenic
1088744715 11:112795908-112795930 GTGCTGGAATGGATGAGTCTGGG - Intergenic
1091127782 11:133117257-133117279 TTGCTGAAATGGATGGATCTAGG - Intronic
1092619006 12:10242975-10242997 GTGACAATATGGATGAATCTGGG + Intergenic
1093392217 12:18636699-18636721 TTGGCCATATGGATGAATCTTGG - Intronic
1093536889 12:20232823-20232845 ATGCTTAGATGGGGGAATCTGGG - Intergenic
1095052528 12:37567236-37567258 ATGTTGATAAGGATGTTTCTTGG + Intergenic
1100067076 12:90662099-90662121 ATGCTGATGTGGAAAGATCTAGG + Intergenic
1101655944 12:106720220-106720242 ATGCTGACCTGGTTGAATCAGGG - Intronic
1102376886 12:112429420-112429442 TTGCTGATCTGGATGGATGTAGG + Intronic
1104378614 12:128287387-128287409 ATGTTAATTTGGAGGAATCTAGG - Intronic
1106569828 13:30916679-30916701 ATGCTGACAGGGATGTAGCTAGG + Intronic
1107977987 13:45708182-45708204 ATGTTGACATGAATGAATCAGGG - Intronic
1109215875 13:59589276-59589298 TTCCTGATAAGGATGAAGCTGGG + Intergenic
1110368473 13:74714632-74714654 ATGCTGTTATTCATGACTCTAGG - Intergenic
1110930059 13:81204732-81204754 ATGCTGATATGAATGAGTTAGGG + Intergenic
1112661445 13:101513307-101513329 AAGGTGATATTGATGAGTCTGGG + Intronic
1113886030 13:113658738-113658760 TTGCTGCTCTGGGTGAATCTGGG - Intergenic
1114295282 14:21323467-21323489 ACGCTGACATGGATAAATCACGG - Intronic
1117796335 14:59397872-59397894 ATTCTGAAATGGATAAATATAGG + Intergenic
1118043144 14:61938753-61938775 ATGCTAAGAAGGATGAATTTAGG + Intergenic
1119098343 14:71855327-71855349 ATGTTGATAATGATGAATCTGGG + Intergenic
1119351120 14:73966545-73966567 ATACTGATATTGATGGGTCTTGG + Exonic
1127496328 15:59515952-59515974 ATGAAGATATGGATCACTCTAGG - Intronic
1127616636 15:60692648-60692670 ATGTTGGTAAGGCTGAATCTGGG + Intronic
1130614755 15:85394427-85394449 ATGCTCAAAGGGATGAATCAAGG - Intronic
1130833348 15:87625616-87625638 ATGCCAATATGGCTGAATGTAGG - Intergenic
1140266026 16:73421926-73421948 TTGCTCAGATGGAGGAATCTAGG - Intergenic
1142618085 17:1148281-1148303 ATTCTGACATCGATGAACCTTGG + Intronic
1145373030 17:22323091-22323113 ATGTTGATAAGGATGTTTCTTGG + Intergenic
1146918024 17:36690558-36690580 AGGCTGCTAGGGATGTATCTGGG + Intergenic
1147284331 17:39389409-39389431 AAGCTGATAAGGACGAATGTCGG + Intronic
1147695750 17:42351461-42351483 AGGCTGAGATGCATGAGTCTAGG - Intronic
1152356674 17:79810902-79810924 ATGCTAATTTGGAGGTATCTAGG - Intergenic
1153720515 18:7896791-7896813 AGACTGATAAGGGTGAATCTTGG - Intronic
1153859695 18:9189150-9189172 TTGCTGATATGGAGGAAGTTTGG + Intronic
1156676564 18:39533592-39533614 ATGCTGATATCAATGACTTTGGG + Intergenic
1162725083 19:12685409-12685431 ATGCTGAGAAGGATGGATGTGGG - Intergenic
1163510933 19:17734472-17734494 TTTCTGATGTGGCTGAATCTAGG - Exonic
926619563 2:15034986-15035008 ATACTGATATGGAAATATCTTGG - Intergenic
927432574 2:23039584-23039606 ATGTTATTATGGATGAATGTAGG + Intergenic
933292423 2:80452781-80452803 ATGCTGAAATTAATGAACCTTGG + Intronic
935269847 2:101424713-101424735 ATAGTGACATGGATGAAGCTGGG + Intronic
935441451 2:103102437-103102459 ATGCTGATATTGATGCTTTTAGG - Intergenic
938265985 2:129928640-129928662 ATGGTGTTATTGCTGAATCTGGG + Intergenic
938741864 2:134239699-134239721 ATGAGGATGTGGATGGATCTAGG + Intronic
939550751 2:143612437-143612459 ATGCTGATATAGCTGGTTCTGGG + Intronic
944322037 2:198357586-198357608 ATGCAGATGTGGATGTAGCTGGG - Intronic
945000276 2:205343036-205343058 ATGCTGATAGAAATGAATTTTGG - Intronic
946388707 2:219402264-219402286 ATTCTGATATAGATGCAGCTGGG + Intergenic
946510241 2:220348259-220348281 ATGCAGATATGAAGGAAGCTTGG + Intergenic
946604786 2:221391729-221391751 ATACTGATTTGGAGGAGTCTAGG - Intergenic
1169479086 20:5961321-5961343 ATGGTGATAACGATGACTCTGGG - Intronic
1170929981 20:20760712-20760734 ATGCTGATGTGGCTGCCTCTGGG - Intergenic
1172029611 20:31972631-31972653 ATGCTTATCTGGGTGAAGCTGGG - Intronic
1175335315 20:58192377-58192399 ATCCAGATATGGCTGAATCGTGG - Intergenic
1175634752 20:60571196-60571218 ATCCTGAGATGGATGTGTCTGGG - Intergenic
1176702767 21:10077053-10077075 ATGCTAATATTGATGAATTTTGG + Intergenic
1177438324 21:21084804-21084826 TTGTTTATATGGATGAATATAGG + Intronic
1177689965 21:24493252-24493274 ATGCAGATATGGCTGATTCTTGG + Intergenic
1178042039 21:28650042-28650064 ATGTTGAAATGGATGAATGCAGG + Intergenic
1182229664 22:28827970-28827992 AAGTGGATAGGGATGAATCTGGG - Intergenic
1183827335 22:40398639-40398661 AGGCTGTAATGGATGAATATCGG + Intronic
950358162 3:12429190-12429212 ATGATGTGATGGATGAAGCTTGG - Intronic
950641752 3:14353003-14353025 ATGCTGAGATGGGAGAATCAGGG - Intergenic
951303865 3:21033668-21033690 ATGATAACATGGATGAATCTAGG - Intergenic
951650165 3:24942552-24942574 ATGATGATAAGCATGAACCTAGG + Intergenic
956406958 3:68937959-68937981 ATGCAAAAATGGATGAACCTTGG + Intergenic
959812103 3:110631618-110631640 CTGCAGATGTGGATGAATCTGGG - Intergenic
965737711 3:171839224-171839246 CTCATGATATTGATGAATCTGGG - Intergenic
966071497 3:175884730-175884752 AGGCTGAGATGGATGAATTGAGG - Intergenic
977431817 4:96939606-96939628 ATGCTTATATGCATTAATCTGGG + Intergenic
978881610 4:113710082-113710104 ATCCTGAAATGTAAGAATCTCGG - Intronic
979638201 4:122980285-122980307 ATAATAACATGGATGAATCTGGG - Intronic
980374955 4:131933431-131933453 ATGCTAATATTGATGAATTTTGG + Intergenic
980838523 4:138228259-138228281 ATGGTGTTAGGGATGGATCTGGG + Intronic
980936480 4:139230576-139230598 ATGCTGCTGTGGAGGAAACTGGG + Intergenic
981667733 4:147248553-147248575 ATGCTGATATTAATTAATTTTGG + Intergenic
985146445 4:186898859-186898881 ATGGTGATATGGAAGCAGCTAGG - Intergenic
988728416 5:33946383-33946405 ATGCTGAGCTGGATTAAACTTGG + Intronic
992061712 5:73056697-73056719 ATACAGATATGTATGAATTTAGG - Intronic
993779860 5:92053249-92053271 GTGCTCATGTGGAGGAATCTGGG + Intergenic
994204370 5:97017612-97017634 ATACTGAAAAGAATGAATCTTGG - Intronic
994954823 5:106514564-106514586 ATTCTGATACTGAAGAATCTAGG - Intergenic
995285171 5:110380016-110380038 ATGTTGATATGGATAAAGCTTGG - Intronic
996914568 5:128696882-128696904 ATGCTGATATTGTTGAATTTGGG + Intronic
997140093 5:131369998-131370020 AGGCTGACATGGATGTATGTTGG - Intronic
997543733 5:134687116-134687138 ATGCTGAAGATGATGAATCTGGG - Intronic
998554792 5:143112754-143112776 ACTATGACATGGATGAATCTTGG - Intronic
1000630633 5:163586898-163586920 ATCCTGAGATGCAGGAATCTAGG - Intergenic
1005089726 6:22043684-22043706 CTGCTGATGTGGAAGAAGCTTGG + Intergenic
1006527800 6:34622797-34622819 ATGCTGCTATGAATGAACATGGG - Intronic
1010272945 6:73935234-73935256 ATGCTGGTATGGGTGAACATAGG + Intergenic
1010529967 6:76956183-76956205 ATGCTTATATGGAAAATTCTGGG + Intergenic
1011388608 6:86825213-86825235 ATGCAGATATGGAGGAAATTGGG - Intergenic
1011900869 6:92295829-92295851 ATGATTATAATGATGAATCTAGG + Intergenic
1012945137 6:105457730-105457752 ATGATGATATTCATGAATCTTGG - Intergenic
1014633020 6:123810770-123810792 ATGGTGGTCTGGATGAATTTAGG - Intronic
1015698955 6:136013516-136013538 ATGCTGTTAGGAATGAATGTGGG + Intronic
1016319333 6:142825174-142825196 ATACTGATATGGATTACTGTGGG - Intronic
1020488576 7:8749853-8749875 ATCCTGACATGGAAGAATCAAGG - Intronic
1021538513 7:21731480-21731502 ATGCTGATATTGGTGTATCTAGG - Intronic
1021568783 7:22043318-22043340 TTGCTGAAATGGTTGATTCTAGG + Intergenic
1021659092 7:22900749-22900771 TTATTGATATGGCTGAATCTAGG - Intergenic
1022407289 7:30102617-30102639 ATGCTGATATGGATGAATCTTGG + Intronic
1024001892 7:45195195-45195217 AGGCTGAAGTGGGTGAATCTGGG + Intergenic
1024252226 7:47514852-47514874 GTGCTGTTATGGGTGAGTCTCGG - Intronic
1027288837 7:76679324-76679346 ATGCTGCTATGGATGGAAATAGG + Intergenic
1027612947 7:80385062-80385084 ATGCTAATAAGGGTGAATTTTGG - Intronic
1028269923 7:88775895-88775917 ATGCAGAAATGCATGAATCAAGG - Intronic
1031595321 7:123643317-123643339 ATGATGATATGGAAGGAGCTTGG - Intergenic
1035984180 8:4407723-4407745 ATGCTTACATGCATGAATCATGG - Intronic
1036915999 8:12804506-12804528 ACACTGATATGGATTAATCCCGG + Intergenic
1039076773 8:33697492-33697514 TTGCTGATATGGAAGAAAGTTGG - Intergenic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1042561526 8:70075537-70075559 ATGATGAAATGCATGTATCTTGG + Intergenic
1042565635 8:70106952-70106974 AGCCTGATATGGAAGAAACTGGG - Intergenic
1042993927 8:74672414-74672436 ATGGTGATCTGCAGGAATCTTGG + Intronic
1043391519 8:79796687-79796709 GGGCTGACATGGATGAATCAAGG + Intergenic
1044905255 8:96994086-96994108 ATAAAAATATGGATGAATCTTGG + Intronic
1044977622 8:97681297-97681319 ATGCTCATATGTATGAATAAAGG + Intronic
1045614070 8:103885723-103885745 ATGCTGATCTGGAAGATTCCAGG + Exonic
1046168626 8:110474281-110474303 ATCCTAATTTGGATGAAGCTTGG - Intergenic
1047891637 8:129318308-129318330 ATGCTGATAGGAAGGAAACTGGG - Intergenic
1050249247 9:3726946-3726968 ATGTTGAGTTGGATGGATCTTGG - Intergenic
1050770215 9:9189356-9189378 CTGCAGATATAGAAGAATCTAGG + Intronic
1051045857 9:12872751-12872773 ATGCTGATATTGATGTGCCTTGG + Intergenic
1052213373 9:25934389-25934411 ATACAGATATGGATGAGGCTTGG - Intergenic
1053639968 9:40063775-40063797 ATGCTAATATTGATGAATTTTGG + Intergenic
1053766165 9:41401708-41401730 ATGCTAATATTGATGAATTTTGG - Intergenic
1053797727 9:41741445-41741467 ATGTTGATAAGGATGTTTCTTGG - Intergenic
1054147461 9:61573512-61573534 ATGTTGATAAGGATGTTTCTTGG + Intergenic
1054186140 9:61953498-61953520 ATGTTGATAAGGATGTTTCTTGG - Intergenic
1054320719 9:63660090-63660112 ATGCTAATATTGATGAATTTTGG + Intergenic
1054467208 9:65504550-65504572 ATGTTGATAAGGATGTTTCTTGG + Intergenic
1054544781 9:66312863-66312885 ATGCTAATATTGATGAATTTTGG - Intergenic
1054652363 9:67635025-67635047 ATGTTGATAAGGATGTTTCTTGG + Intergenic
1057938970 9:99263984-99264006 ATGCTACCATGGATGAACCTTGG - Intergenic
1058535301 9:105952988-105953010 TTACTGATATGGTTGAATTTAGG + Intergenic
1202787788 9_KI270719v1_random:47161-47183 ATGCTAATATTGATGAATTTTGG + Intergenic
1186359711 X:8827859-8827881 AGGCTGATAAGAATGAAACTGGG + Intergenic
1196190811 X:112792324-112792346 ATTCTCATATGGATTATTCTTGG + Intronic
1198866149 X:141125238-141125260 ATTCTTATATGGATGGCTCTAGG - Intergenic
1199505527 X:148557017-148557039 AGGCTGATAAGGTTGAATATAGG + Intronic