ID: 1022407838

View in Genome Browser
Species Human (GRCh38)
Location 7:30108779-30108801
Sequence GAAGGGAGCTACTGGTTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 185}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022407838_1022407847 6 Left 1022407838 7:30108779-30108801 CCACAGAACCAGTAGCTCCCTTC 0: 1
1: 0
2: 2
3: 16
4: 185
Right 1022407847 7:30108808-30108830 TCCTTTGGCAGGAGGGTCTGTGG No data
1022407838_1022407849 25 Left 1022407838 7:30108779-30108801 CCACAGAACCAGTAGCTCCCTTC 0: 1
1: 0
2: 2
3: 16
4: 185
Right 1022407849 7:30108827-30108849 GTGGCTTTCCACAGCACCCCAGG No data
1022407838_1022407844 -2 Left 1022407838 7:30108779-30108801 CCACAGAACCAGTAGCTCCCTTC 0: 1
1: 0
2: 2
3: 16
4: 185
Right 1022407844 7:30108800-30108822 TCCTTTGTTCCTTTGGCAGGAGG 0: 1
1: 0
2: 1
3: 24
4: 286
1022407838_1022407843 -5 Left 1022407838 7:30108779-30108801 CCACAGAACCAGTAGCTCCCTTC 0: 1
1: 0
2: 2
3: 16
4: 185
Right 1022407843 7:30108797-30108819 CCTTCCTTTGTTCCTTTGGCAGG No data
1022407838_1022407846 -1 Left 1022407838 7:30108779-30108801 CCACAGAACCAGTAGCTCCCTTC 0: 1
1: 0
2: 2
3: 16
4: 185
Right 1022407846 7:30108801-30108823 CCTTTGTTCCTTTGGCAGGAGGG 0: 1
1: 1
2: 1
3: 12
4: 231
1022407838_1022407850 30 Left 1022407838 7:30108779-30108801 CCACAGAACCAGTAGCTCCCTTC 0: 1
1: 0
2: 2
3: 16
4: 185
Right 1022407850 7:30108832-30108854 TTTCCACAGCACCCCAGGTGTGG No data
1022407838_1022407840 -9 Left 1022407838 7:30108779-30108801 CCACAGAACCAGTAGCTCCCTTC 0: 1
1: 0
2: 2
3: 16
4: 185
Right 1022407840 7:30108793-30108815 GCTCCCTTCCTTTGTTCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022407838 Original CRISPR GAAGGGAGCTACTGGTTCTG TGG (reversed) Intronic
900855356 1:5177265-5177287 GACGGAAGCTACTGATTCTTTGG - Intergenic
902070546 1:13731416-13731438 GAAGGGAACAACACGTTCTGTGG - Intronic
902672993 1:17987959-17987981 GGGGGGAGCTGCTGGTCCTGAGG - Intergenic
903123639 1:21233206-21233228 GATGGGAGGAGCTGGTTCTGGGG - Intronic
905366753 1:37455858-37455880 GGAGGGAGCTTTTTGTTCTGCGG - Intergenic
907592218 1:55686148-55686170 GAAGGAAGATACAGATTCTGGGG + Intergenic
908262780 1:62351889-62351911 GAAGGGACCTCCTCATTCTGAGG - Intergenic
915347118 1:155203184-155203206 GAAGGGTGGCACTGATTCTGGGG - Intronic
916688843 1:167171950-167171972 AAAGGGAGCAACTAATTCTGGGG - Intergenic
917237438 1:172909523-172909545 GAAGGGAGGTACTGTATTTGAGG - Intergenic
918151677 1:181802394-181802416 GAAGGGAGATACTGGCTGAGAGG - Intronic
919068774 1:192727320-192727342 GAAAGGAAGCACTGGTTCTGAGG - Intergenic
919800261 1:201349829-201349851 AAAGGGAGCTACTGTGGCTGGGG + Intergenic
921586874 1:216957646-216957668 GGAGGGAGATGCTGGTGCTGTGG - Intronic
923700471 1:236295318-236295340 GAAGGGAGCTAGTTATTGTGGGG + Intergenic
923885172 1:238146515-238146537 CAACGGAGCTCCTGGTTCTCAGG - Intergenic
1063195889 10:3742365-3742387 GTTGGGAGCTTCTGGTTCTTAGG + Intergenic
1063671941 10:8105974-8105996 GAAGGGAGCAACAGACTCTGGGG - Intergenic
1063947829 10:11194489-11194511 GAAAGGACTTACTGGTTCTAGGG - Intronic
1065310970 10:24415758-24415780 TGAGGGAGCTACTGCTTTTGAGG - Intronic
1067414053 10:46090657-46090679 GGAGGGAGCAACTGGGCCTGTGG + Intergenic
1067434102 10:46265167-46265189 GGAGGGAGCAACTGGGCCTGTGG + Intergenic
1067439594 10:46301158-46301180 GGAGGGAGCAACTGGGCCTGTGG - Intronic
1070155906 10:73835201-73835223 CAAGGCAGCTACTGTTTCTATGG - Intronic
1071477013 10:86033744-86033766 CTAGTGAGCCACTGGTTCTGTGG - Intronic
1078102638 11:8338743-8338765 GAAGGGGTCTTCTGGTTCTCTGG - Intergenic
1078603601 11:12755634-12755656 GAAAGAAGCTTCTGTTTCTGGGG + Intronic
1078709771 11:13779649-13779671 AAAGGCAGATTCTGGTTCTGGGG + Intergenic
1078935159 11:15943177-15943199 TAAGGGAGCTCCTGGTGGTGTGG + Intergenic
1083408552 11:62475483-62475505 GAAGGGAGCAACTGACACTGAGG + Intronic
1083673202 11:64311378-64311400 AAGGGGAGGTGCTGGTTCTGAGG + Intronic
1084218342 11:67663593-67663615 GAAGGGACTTCCTGGGTCTGGGG + Intronic
1084323360 11:68385666-68385688 GAAGGGAAACCCTGGTTCTGAGG - Intronic
1085745243 11:79109498-79109520 GAAGTGAGAGGCTGGTTCTGCGG + Intronic
1086107974 11:83168054-83168076 GAAGGGAGCTAATATTTCTAAGG + Intronic
1088931108 11:114351579-114351601 AAAGGTAGCTCCTGGTTCTCAGG - Intergenic
1091231035 11:133988240-133988262 TAAGGGAGCTTCAGGGTCTGGGG + Intergenic
1091524943 12:1290317-1290339 GAAGAGGGCTGTTGGTTCTGAGG + Intronic
1092193318 12:6535091-6535113 GTAGGGACCTCCTGTTTCTGGGG - Intronic
1092655142 12:10676228-10676250 GAAGGAATCTACTGGTTTAGTGG + Intergenic
1093872753 12:24311774-24311796 GAAGGAAGCCACTGATTCTGGGG - Intergenic
1095607346 12:44085436-44085458 CAAGGTGGCTAGTGGTTCTGGGG + Intronic
1096743377 12:53710414-53710436 GAAGGGAGCTATTGGGTTGGAGG + Intronic
1098681083 12:73355533-73355555 CAAGGCAGATACTGGTTCTGTGG + Intergenic
1098824105 12:75271321-75271343 GAAGAGTGTTTCTGGTTCTGAGG - Intergenic
1098898873 12:76092400-76092422 GAAAGGAGCTACTGATTCTGAGG + Intergenic
1099283643 12:80686867-80686889 GAAGAGAGATACCTGTTCTGGGG + Intergenic
1099602910 12:84764071-84764093 GAAGGTAGCTACTAGTCCTGTGG - Intergenic
1099829925 12:87828393-87828415 GAAGAGAGCTACTCTTTCTCAGG - Intergenic
1102729431 12:115095254-115095276 GCAGGGAGCTAGGGGTTTTGTGG - Intergenic
1103326801 12:120126973-120126995 GTAGGGAGCTTCTGGTACTCAGG - Intergenic
1105438864 13:20399678-20399700 GGAGGGAGCGTGTGGTTCTGTGG - Intergenic
1105536880 13:21274109-21274131 GAAGGGAGCAACAGGCACTGGGG - Intergenic
1105974891 13:25464743-25464765 GAAGGGAGCAGCTGGTTCAGCGG + Intronic
1106944169 13:34807530-34807552 GACTGGAGCTTCCGGTTCTGTGG - Intergenic
1107710325 13:43144902-43144924 GAAGGTAGATTTTGGTTCTGGGG - Intergenic
1112354073 13:98660067-98660089 CAAGGGTGCTACTAATTCTGTGG + Intergenic
1113142506 13:107169901-107169923 GAAGGGTGTTGTTGGTTCTGTGG + Exonic
1113227458 13:108175068-108175090 GAAGGGAGCAACTGACACTGGGG + Intergenic
1114916143 14:27268050-27268072 GGATGGAGTTACTGGTTCAGAGG - Intergenic
1118920289 14:70143800-70143822 GAATAGAGCTGCTGGTTCTCTGG - Intronic
1119654343 14:76406388-76406410 GAAGGGAGCTAATGGGTATCTGG - Intronic
1119915466 14:78397322-78397344 GAATGGAGCCACAGGGTCTGTGG - Intronic
1120498821 14:85268603-85268625 AAAGGGAGATACTGGATGTGAGG + Intergenic
1122429264 14:101629676-101629698 CAAGGGTGCTATTGGTTGTGAGG - Intergenic
1122693064 14:103540477-103540499 GCAGGGAGCGACAGGGTCTGGGG - Intergenic
1122725504 14:103748366-103748388 GAAGGGAGCTTCCAGTTCTGTGG - Intronic
1124594473 15:31081664-31081686 GAAGGGGGCTGCTGCCTCTGTGG - Intronic
1126065131 15:44820606-44820628 GACTGGGGCTGCTGGTTCTGGGG - Intergenic
1126094698 15:45079977-45079999 GACTGGGGCTGCTGGTTCTGGGG + Intergenic
1126227955 15:46293482-46293504 GAAGGGAGCAGCAGGTTCTAGGG - Intergenic
1127561162 15:60137783-60137805 GAAAGGAGCTGATGGCTCTGAGG + Intergenic
1129338519 15:74869212-74869234 GAAAGGTGCTCATGGTTCTGTGG - Intronic
1129443566 15:75600203-75600225 GAAGGTAGCTGCAGGTTCTGAGG + Intronic
1132329457 15:101001773-101001795 GAAGGGATCTACGGTTTCTAGGG + Intronic
1133444743 16:5850378-5850400 GAATGGAGTTACTGGTTCGAAGG - Intergenic
1134775211 16:16846999-16847021 GACTGGAGCTCCTGGTTCTCAGG + Intergenic
1135640925 16:24119266-24119288 GAAGGGAGTTTCTAGTGCTGAGG + Intronic
1137599015 16:49743697-49743719 GAAGGGAGCTGCTGGCTTTTGGG - Intronic
1137897159 16:52226432-52226454 GGATGGAGCTCCTGGTTCTCTGG - Intergenic
1138539180 16:57678141-57678163 GATGGGAGCTGCTGTGTCTGTGG + Intronic
1141236669 16:82224680-82224702 CAATGGAGCTCCTGGTTCTTGGG - Intergenic
1142399051 16:89849710-89849732 GAAGGGCACCAGTGGTTCTGTGG - Intronic
1144577944 17:16441392-16441414 GATGGCAGCTACTGGTCCTTGGG - Intergenic
1144772338 17:17766806-17766828 GAAAGGAGCCACTGTCTCTGAGG + Intronic
1144783881 17:17821382-17821404 GACTGGAGCTGCTGGATCTGTGG - Intronic
1146511078 17:33449257-33449279 GAAGGAAGCAGCTGGTTCTGGGG - Intronic
1148051060 17:44770084-44770106 GAAGGGAGGTGCTGTTTCTGTGG + Intronic
1151719689 17:75848005-75848027 GATGGGAGCTACTGGGTCTCAGG + Intronic
1151813299 17:76458080-76458102 GAATGGAGGTACAGGTTCTCAGG - Intronic
1153229105 18:2920073-2920095 GAAGGGAGGAACTGGGCCTGGGG - Exonic
1155672927 18:28394070-28394092 GAAGGGAACAACAGATTCTGGGG + Intergenic
1157537976 18:48474700-48474722 GCAGGTAGCTACTGTTTCTCTGG - Intergenic
1158389986 18:57037013-57037035 GAAGGGAACTAATATTTCTGAGG + Intergenic
1160518944 18:79493632-79493654 GAAGGGAGCTTCTCGTCCTCCGG - Intronic
1160520141 18:79503214-79503236 CAAGGGAGCCACTGAGTCTGTGG - Intronic
1161436891 19:4268852-4268874 GAAGGGACCTCCTGGGGCTGAGG - Exonic
1161594291 19:5143453-5143475 GATGGGAGCGACTGGTAATGGGG - Intronic
1164598834 19:29547797-29547819 GTAGGGGGCTAGTCGTTCTGCGG + Intronic
1166567779 19:43775683-43775705 GAATGGAGCAACAGGATCTGGGG + Intronic
1166772334 19:45291305-45291327 CAAGGGAGCTGCTCCTTCTGAGG + Intronic
1167249637 19:48393206-48393228 GAAGGGGACTCCTGGGTCTGAGG + Intergenic
1168548436 19:57273107-57273129 GAAGGGAGCTCCTGCCTCTGGGG + Intergenic
928324613 2:30309660-30309682 GAAGGGAGCTGCTGATTCTGAGG - Intronic
929809467 2:45177285-45177307 GAATGGAGTTACTGGGTCTTGGG - Intergenic
932095901 2:68848119-68848141 GAAGTGAGCTGCTGATACTGTGG + Intergenic
932449621 2:71801329-71801351 GAAGAGACTTACTGCTTCTGGGG - Intergenic
935105882 2:100043233-100043255 GAAGGAAGCATCTGGTTCTTTGG - Intronic
936676170 2:114717700-114717722 GAAGGGAGGTACTGGTGGGGAGG - Intronic
937018179 2:118625580-118625602 GAAGTGACTGACTGGTTCTGGGG - Intergenic
937874014 2:126807074-126807096 GAAGGGAACAACGGCTTCTGGGG + Intergenic
938981171 2:136528682-136528704 GAGGGAAGTTGCTGGTTCTGAGG - Intergenic
939210416 2:139167869-139167891 TAAGAAAGCTACTGGTTCTAGGG + Intergenic
944768668 2:202890369-202890391 TTAGGGAGCTACTGGTTGAGAGG + Intronic
945186320 2:207143680-207143702 CTATGGAGCTACTGCTTCTGTGG + Intronic
946601092 2:221361210-221361232 GCAGGGGGCTATTGATTCTGTGG - Intergenic
948037207 2:234867478-234867500 AAATGGAGCCACTGCTTCTGAGG + Intergenic
948913889 2:241020447-241020469 GACGTGAGCCACTGGCTCTGCGG - Intronic
1169332982 20:4730943-4730965 GAGGGGAGGTACTGGTTGCGGGG + Intergenic
1170350693 20:15437672-15437694 GAAGGGAACTACAGATTCTGGGG - Intronic
1170578105 20:17680054-17680076 GAAAGAAGCTTCCGGTTCTGAGG - Exonic
1171406365 20:24914819-24914841 GCAGGGAGCTGCTGGCACTGGGG - Intergenic
1172621098 20:36319206-36319228 GGAGGGAGCTGCTGATTTTGAGG + Intronic
1172705685 20:36880602-36880624 GAAGGGAGCTAGGGGTCCTCTGG - Intronic
1173536818 20:43821113-43821135 GGAGGGAGCTCCTGTGTCTGTGG + Intergenic
1174200885 20:48805625-48805647 GAAGGGAGCCCCCGGTGCTGAGG - Intronic
1174952059 20:55052929-55052951 GAAGGAAGCTACTTGTTTTTTGG - Intergenic
1175704679 20:61167990-61168012 AGAGGGAGCTACAGGTGCTGAGG + Intergenic
1177963175 21:27694774-27694796 TAAAGGAGCTAGTGGTTGTGTGG - Intergenic
1178665640 21:34544082-34544104 TAAGGCAGCTACTGCTGCTGTGG - Intronic
1180049696 21:45325513-45325535 GGAGGGAGCCACTGGTTCCCGGG + Intergenic
1183093381 22:35538712-35538734 GCAGGGAGCAATTGGTTCTTGGG + Intergenic
1184815074 22:46862817-46862839 GGAGGGGGCTTCTGATTCTGGGG + Intronic
1184929630 22:47671555-47671577 GAAGGGAGCTTATGGTCCTTGGG + Intergenic
951481621 3:23167903-23167925 GGATGGAGCTGCTGCTTCTGTGG - Intergenic
953369552 3:42375932-42375954 TAAAGGAGCTAATGATTCTGAGG + Intergenic
953519445 3:43627368-43627390 CAAGGAAGCTGCTGGGTCTGAGG + Intronic
954811287 3:53249884-53249906 GAAGGGAGTTCCTGATTTTGTGG + Intronic
957201572 3:77142768-77142790 GAAGGCAGCTACCTCTTCTGAGG + Intronic
957202711 3:77157700-77157722 GAAGGGAGCTATTGCTTATGAGG + Intronic
964338596 3:155684397-155684419 GAAGTGACCTGGTGGTTCTGAGG - Intronic
965164563 3:165179744-165179766 GCATGGAGATATTGGTTCTGTGG - Intergenic
966835460 3:184046163-184046185 GAAGTTAGCTGCTGTTTCTGTGG - Intergenic
969878518 4:10154115-10154137 TAAGGGAGGTACTGGATCTTTGG + Intergenic
970026451 4:11629279-11629301 GCTGGGAGCTACTGGTTCTTAGG + Intergenic
971534927 4:27736635-27736657 CACGGGAGCTACTGGGTCTGTGG + Intergenic
974390067 4:61254920-61254942 GAAGGAAGCCATTGGTGCTGTGG - Intronic
978367630 4:107998654-107998676 GTAGGGAGCTACTGGCCTTGTGG + Intronic
981592092 4:146375513-146375535 AAAGGGAGCTAGATGTTCTGTGG - Intronic
984066531 4:175055045-175055067 GATTGCTGCTACTGGTTCTGTGG + Intergenic
986054354 5:4121192-4121214 GCGAGGTGCTACTGGTTCTGTGG + Intergenic
986545872 5:8896265-8896287 CAAGAGATCTACTGGTTTTGAGG + Intergenic
987138584 5:14922319-14922341 GAGGGGTGCTACTGGAGCTGAGG + Intergenic
995488481 5:112663857-112663879 GAAGGGAACAACAGATTCTGGGG + Intergenic
999178099 5:149646371-149646393 GAAGTGAGCAAATGGTGCTGGGG - Intergenic
1001290067 5:170450700-170450722 GAAGGGGGAAACTGTTTCTGGGG - Intronic
1001532006 5:172469882-172469904 GAAGGAAGCTGGTGGTCCTGAGG - Intergenic
1007169405 6:39852110-39852132 GCAGGGAGCTGCTGGCGCTGGGG + Intronic
1007404447 6:41625917-41625939 GATGGGAGCTCCTGGTTGGGGGG + Intergenic
1008807627 6:55451089-55451111 GGATGGAGCTAATGGTTATGGGG + Intronic
1010765781 6:79776298-79776320 GAAGGGAGCTCCAGGGTCTCTGG - Intergenic
1011592344 6:88982308-88982330 GAAGAGAGCTTCTGGACCTGAGG - Intergenic
1011793624 6:90927951-90927973 CAAGGGAGCTACTGTTTTTCCGG + Intergenic
1012665367 6:101961843-101961865 TAAGGGATCTACTGGTGTTGAGG + Intronic
1014109278 6:117602344-117602366 GAAGGGAACTGCTGGGACTGAGG + Exonic
1014555497 6:122840043-122840065 GAGGGCATCTGCTGGTTCTGAGG + Intergenic
1015041939 6:128731655-128731677 GAAGGCAGGGCCTGGTTCTGTGG + Intergenic
1015584193 6:134758832-134758854 GAAGGGAGCTACGGGGGCAGAGG - Intergenic
1017577658 6:155822786-155822808 CATGGGAGCTCCTGGTTCTCAGG + Intergenic
1018253808 6:161898324-161898346 GAAATGAGCTACAGGTTCTAGGG + Intronic
1019300483 7:300675-300697 GAGGGGACCTGCTGGTCCTGGGG - Intergenic
1019577229 7:1743419-1743441 GAAGGGAACTGCTTGCTCTGCGG - Intronic
1019648732 7:2144791-2144813 GAATGGACCTCCTGGTTGTGGGG - Intronic
1022407838 7:30108779-30108801 GAAGGGAGCTACTGGTTCTGTGG - Intronic
1022615018 7:31920389-31920411 GCAGGGAGCAGCTGGTTCTGAGG - Intronic
1022877856 7:34553214-34553236 GCAGGGTGCTACAGGTGCTGGGG - Intergenic
1024819767 7:53314493-53314515 GAAGGGACATATTGTTTCTGTGG - Intergenic
1025848311 7:65219893-65219915 GGAGTGAGCTTCTGCTTCTGGGG + Intergenic
1028453765 7:91016145-91016167 GAAGGTAGATACTGGTTGTAGGG - Intronic
1031002493 7:116433053-116433075 GAAGGGAGCCCCTGCTGCTGAGG - Intronic
1032545045 7:132734710-132734732 GAAGCGAGCTACTCCCTCTGTGG + Intergenic
1034923813 7:155104513-155104535 GAAGGCAGCTTCTCTTTCTGGGG + Intergenic
1036706482 8:11050796-11050818 GAATGGGGCCAATGGTTCTGGGG - Intronic
1038409319 8:27345817-27345839 CATGGCAGCTACTGGATCTGGGG - Intronic
1040440121 8:47432743-47432765 GAAGGAAGCTACGGGATTTGAGG + Intronic
1040570237 8:48602110-48602132 GAAGGGGGCTGCTGGCTGTGGGG + Intergenic
1041640867 8:60200112-60200134 GAAGGGGCCTACTGGTTTTCTGG - Intronic
1044523858 8:93229869-93229891 TGAGGGAGCTCCTGGTTCAGCGG - Intergenic
1046239507 8:111472298-111472320 GAAGGGAGCAACAGATACTGGGG + Intergenic
1048173999 8:132135092-132135114 GAAGGAAACAACAGGTTCTGGGG - Intronic
1048175491 8:132148776-132148798 GATTGGAGCTCCTGGTTCTCAGG + Intronic
1052556830 9:30029399-30029421 CATTGGAGCTCCTGGTTCTGAGG - Intergenic
1059540389 9:115124715-115124737 CGAGGGAGCTTCTGGCTCTGAGG - Intergenic
1060477477 9:123997334-123997356 GGAGGGAGCTGATGCTTCTGGGG - Intergenic
1062040930 9:134403988-134404010 GGAAGGAGCTATGGGTTCTGGGG - Intronic
1062047544 9:134431452-134431474 GAAGGGAGCGGCTGGGGCTGTGG + Intronic
1062460998 9:136662546-136662568 GAAGGGAGCTGCTGCATCTTTGG - Intronic
1186956735 X:14690474-14690496 GAATAAAGCTACTGGTTCAGGGG + Intronic
1189280044 X:39814668-39814690 GAAGGGTTCTACTGGCTCTGTGG - Intergenic
1191672921 X:63765595-63765617 GAAGGGAAAGACTGTTTCTGAGG + Intronic
1198268117 X:135029966-135029988 GAAGGGAGCTCCTAAATCTGAGG - Intergenic
1199642883 X:149881209-149881231 GAAGCGAGGGCCTGGTTCTGAGG + Exonic
1199897568 X:152138529-152138551 GAAGCGAGGTTCTCGTTCTGAGG - Exonic
1201143103 Y:11044754-11044776 GGAGGGAGCCATTGGCTCTGTGG - Intergenic