ID: 1022407839

View in Genome Browser
Species Human (GRCh38)
Location 7:30108787-30108809
Sequence GAACAAAGGAAGGGAGCTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 320}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022407839_1022407847 -2 Left 1022407839 7:30108787-30108809 CCAGTAGCTCCCTTCCTTTGTTC 0: 1
1: 0
2: 3
3: 19
4: 320
Right 1022407847 7:30108808-30108830 TCCTTTGGCAGGAGGGTCTGTGG No data
1022407839_1022407846 -9 Left 1022407839 7:30108787-30108809 CCAGTAGCTCCCTTCCTTTGTTC 0: 1
1: 0
2: 3
3: 19
4: 320
Right 1022407846 7:30108801-30108823 CCTTTGTTCCTTTGGCAGGAGGG 0: 1
1: 1
2: 1
3: 12
4: 231
1022407839_1022407844 -10 Left 1022407839 7:30108787-30108809 CCAGTAGCTCCCTTCCTTTGTTC 0: 1
1: 0
2: 3
3: 19
4: 320
Right 1022407844 7:30108800-30108822 TCCTTTGTTCCTTTGGCAGGAGG 0: 1
1: 0
2: 1
3: 24
4: 286
1022407839_1022407849 17 Left 1022407839 7:30108787-30108809 CCAGTAGCTCCCTTCCTTTGTTC 0: 1
1: 0
2: 3
3: 19
4: 320
Right 1022407849 7:30108827-30108849 GTGGCTTTCCACAGCACCCCAGG No data
1022407839_1022407850 22 Left 1022407839 7:30108787-30108809 CCAGTAGCTCCCTTCCTTTGTTC 0: 1
1: 0
2: 3
3: 19
4: 320
Right 1022407850 7:30108832-30108854 TTTCCACAGCACCCCAGGTGTGG No data
1022407839_1022407851 23 Left 1022407839 7:30108787-30108809 CCAGTAGCTCCCTTCCTTTGTTC 0: 1
1: 0
2: 3
3: 19
4: 320
Right 1022407851 7:30108833-30108855 TTCCACAGCACCCCAGGTGTGGG 0: 1
1: 0
2: 1
3: 17
4: 173
1022407839_1022407852 24 Left 1022407839 7:30108787-30108809 CCAGTAGCTCCCTTCCTTTGTTC 0: 1
1: 0
2: 3
3: 19
4: 320
Right 1022407852 7:30108834-30108856 TCCACAGCACCCCAGGTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022407839 Original CRISPR GAACAAAGGAAGGGAGCTAC TGG (reversed) Intronic
903466278 1:23554624-23554646 GAACGAAGGAAGGAAGGAACCGG + Intergenic
904127252 1:28249792-28249814 GAAAAAAGGAAGGAAGGAACTGG + Intergenic
904989897 1:34583892-34583914 GAAGAAATGAATGGAGCTAAGGG + Intergenic
905186392 1:36200056-36200078 GAAGAGAGGAAGAGAGCGACAGG - Intergenic
906414402 1:45608990-45609012 GAAAACAGGAAGAGAGCTAATGG - Intronic
908309659 1:62866874-62866896 GAATAATGGAAGGGAACTAGAGG - Intergenic
908651340 1:66336581-66336603 GAACAAAGGTTGGGTGCTGCTGG + Intronic
909305802 1:74075228-74075250 GAAGAAAGGAAGGGAGAAACGGG + Intronic
909348562 1:74621803-74621825 GAACAAAGGAAAGGAGGAAGAGG + Intronic
909755591 1:79221350-79221372 GGACAAAACAAAGGAGCTACAGG - Intergenic
910239267 1:85068903-85068925 GAAAAAAGCAAGAGAGCTAATGG - Intronic
910719841 1:90273934-90273956 GAAGACAGAAAGTGAGCTACAGG + Intergenic
913062370 1:115220244-115220266 CAACACAGGCAGGGAGCTTCGGG - Intergenic
913489027 1:119361073-119361095 GAATAAAAGAATGCAGCTACAGG + Intergenic
913559812 1:120006193-120006215 GAAAAAGGGAAAGGAGGTACAGG + Intronic
914280399 1:146165615-146165637 GAAAAAGGGAAAGGAGGTACAGG + Intronic
914541443 1:148616555-148616577 GAAAAAGGGAAAGGAGGTACAGG + Intronic
914625197 1:149454691-149454713 GAAAAAGGGAAAGGAGGTACAGG - Intergenic
915898441 1:159829106-159829128 GAATTGAGGAAGGGAGCAACCGG - Intronic
916029436 1:160863195-160863217 GAACATAGGAAGAGACCTAAGGG + Intergenic
916188598 1:162157206-162157228 GCACATAGGAAGGGAGCCACAGG - Intronic
918711463 1:187736502-187736524 GACCAAAGCAAAGGGGCTACAGG + Intergenic
918931212 1:190859048-190859070 GGCCAAAGGAAAGGGGCTACAGG - Intergenic
919534812 1:198774320-198774342 GAAGAAAGGAAGAAAGCTAGGGG - Intergenic
920099337 1:203507327-203507349 GTACAAAGGAAGGGAGTGAGAGG + Intronic
920619359 1:207528828-207528850 GAACAGATGAAGGGAGAGACTGG - Intronic
920621141 1:207547383-207547405 GAACAGATGAAGGGAGAGACTGG - Intronic
921839644 1:219815046-219815068 GAAACAAGGAAGTGAGATACGGG + Intronic
923215957 1:231847953-231847975 GAAGAAATGAAGAGAGCTGCTGG + Intronic
923625048 1:235606892-235606914 GAAGGAAGGAAGCTAGCTACTGG - Intronic
1063383540 10:5601812-5601834 GAACAAATGAAGGGGGCTCAGGG - Intergenic
1064969475 10:21049668-21049690 GAACAAAGAAAGTGAGGAACGGG - Intronic
1065044491 10:21734694-21734716 ACACCAAGGAAGAGAGCTACAGG - Intronic
1065373703 10:25015990-25016012 GAAGAAAGGGACGGAGATACTGG - Exonic
1068061088 10:52068370-52068392 AAAGAAAGGAAGGTGGCTACTGG - Intronic
1068365167 10:56038542-56038564 GAAGAAAGCAAGGGAGCTCTAGG + Intergenic
1068692637 10:59932634-59932656 AAAAAAAGGAAGGGAACTAGAGG + Intergenic
1069646772 10:70005322-70005344 GAACGAAGGAAGGGAGGGAGAGG + Intergenic
1070145402 10:73770254-73770276 GACAAAAGGAAGGGAGCAAAAGG - Intronic
1070436449 10:76398274-76398296 GAACAGAGGGAGGGAGCTGGGGG - Intronic
1071822327 10:89291188-89291210 GAACAAAGGAAGGAAGTAAGAGG - Intronic
1071859402 10:89656795-89656817 GGCCAAAACAAGGGAGCTACAGG - Intergenic
1073323554 10:102629776-102629798 GAACCAAGGAAGTGAGCAAGAGG + Intronic
1073979945 10:109143018-109143040 GAACAAAAAACAGGAGCTACAGG - Intergenic
1074262272 10:111865865-111865887 GAAAAAAGGAAGACAGCTAAAGG + Intergenic
1075146167 10:119884861-119884883 GAGGAAAGGAAGGGATCTCCAGG - Intronic
1075469450 10:122677201-122677223 GAGCAAAGGCAAGGAGCTGCTGG - Intergenic
1076543680 10:131230007-131230029 GAAGCAAGGAAGGGAGCAGCAGG + Intronic
1079586103 11:22128322-22128344 GAGCAAAGCAAAGGGGCTACAGG + Intergenic
1080717506 11:34818479-34818501 GACCAAAACAAAGGAGCTACAGG + Intergenic
1083954733 11:65977094-65977116 GAACAAAGGTAGGGAGCTCAGGG + Exonic
1086564630 11:88211799-88211821 GAACAAAAGAAAGGGGTTACAGG + Intergenic
1086821518 11:91442055-91442077 GACCAAAACAAAGGAGCTACAGG + Intergenic
1087675701 11:101158707-101158729 GACCAAAAGAAAGGAGCTACAGG - Intergenic
1089275759 11:117335030-117335052 GAAAAAAGGAAAGGATCCACGGG - Intronic
1089306551 11:117529995-117530017 AGACAAAGGAAGCGAGCGACGGG - Intronic
1090829210 11:130409214-130409236 GAATAAACGCAGGGAGCAACAGG + Intronic
1091262094 11:134242738-134242760 GATCAGAGGAAGGGAGAGACTGG + Intronic
1091601627 12:1921413-1921435 GAGCAGAGGGAGGGAGCCACAGG - Intergenic
1093363276 12:18259049-18259071 AAACAAATGAAGGCAGATACAGG - Intronic
1095728145 12:45474536-45474558 GACCAAAAGAAAGGAGCTACAGG - Intergenic
1095917726 12:47497325-47497347 GAACCCAGGAAGGGAGAAACTGG - Intergenic
1096686760 12:53293115-53293137 GAAGAACAGAAGGGAGCTAAGGG - Intronic
1097071597 12:56359165-56359187 GAACAAGGGAAGGGAGGGATTGG + Intronic
1098203626 12:68083412-68083434 GGCCAAAGCAAAGGAGCTACAGG + Intergenic
1098289043 12:68937379-68937401 TAACTAGGGATGGGAGCTACTGG + Intronic
1099509241 12:83512860-83512882 AAACAAAGGAATGGAGCTTAAGG + Intergenic
1099766853 12:86998269-86998291 GGACAAAACAAAGGAGCTACAGG + Intergenic
1099788897 12:87304640-87304662 GAAACAAGGAAGAGATCTACCGG - Intergenic
1099858717 12:88203485-88203507 GCCCAAAAGAAAGGAGCTACAGG + Intergenic
1099890776 12:88586231-88586253 GGCCAAAAGAAAGGAGCTACAGG + Intergenic
1100182983 12:92105898-92105920 TAACAAAGGCAGAGAGCTAAGGG + Intronic
1100447159 12:94671478-94671500 GAACAAAGGAAGGCAGTGAATGG + Intergenic
1101626736 12:106451156-106451178 GAACAAAGGGAGGGATCTTTTGG + Intronic
1102082995 12:110113419-110113441 GAAGGAAGGAAGGGAGGGACGGG + Intergenic
1102403585 12:112652492-112652514 GCACAAATGGAGGGAGCAACAGG - Intronic
1102898776 12:116619930-116619952 GAACAAAGGAAAGGAGGAAAGGG + Intergenic
1103615281 12:122147949-122147971 GAACAAAGGAACAGTTCTACTGG - Intergenic
1104012184 12:124939736-124939758 GGACATAAGAAGGGAGCTGCAGG - Intergenic
1104280823 12:127374746-127374768 GAACAGAGGAAGGGAGGGAAGGG - Intergenic
1104372940 12:128239176-128239198 GAACAGAAGTAGGGAGCGACTGG - Intergenic
1104732891 12:131118299-131118321 GAAGAAAGGAAGGGAGGGATGGG + Intronic
1105528827 13:21200101-21200123 AGACAAAAGAAAGGAGCTACAGG + Intergenic
1107608567 13:42088470-42088492 GAACAAAGGAGGGGAGTTTGAGG + Intronic
1108633255 13:52307739-52307761 GCAGAAAGGAATGGAGCTAATGG - Intergenic
1108653435 13:52504823-52504845 GCAGAAAGGAATGGAGCTAATGG + Intergenic
1108763215 13:53595170-53595192 GAAAAAGTGAAGGGAGTTACAGG + Intergenic
1109697420 13:65978341-65978363 GGCCAAAACAAGGGAGCTACAGG - Intergenic
1113566045 13:111320344-111320366 ACACAAAGGAAGGGAGGGACAGG + Intronic
1114431541 14:22665937-22665959 GGACAAAAGAAAGGGGCTACAGG + Intergenic
1115366882 14:32567977-32567999 GAACAAAGGAGGGGAGGGGCTGG + Intronic
1115659652 14:35480115-35480137 GAAAAAAGGAAAAGAGCTTCTGG - Intergenic
1115889725 14:38012889-38012911 GCCCAAAGGAAAGGGGCTACAGG - Intronic
1116865809 14:50030657-50030679 GTACAAAGAAAGAGAGCGACAGG - Intergenic
1117085566 14:52196861-52196883 GGTCAAAGCAAAGGAGCTACAGG - Intergenic
1117752168 14:58935628-58935650 GACCAAAACAAAGGAGCTACAGG + Intergenic
1118747990 14:68787489-68787511 GCATCAAGGAAGGGAGCTATAGG + Intergenic
1119654345 14:76406396-76406418 GAAGAGAGGAAGGGAGCTAATGG - Intronic
1120676944 14:87431583-87431605 GAAGAAAAGAAGGGAGCTGGAGG - Intergenic
1121520521 14:94583264-94583286 GGGCAAAGAAAGGAAGCTACTGG + Intronic
1122377853 14:101278499-101278521 GAAAAAATGAAGAGAGCTTCAGG + Intergenic
1124705567 15:31960941-31960963 GGCCAAAAGAAAGGAGCTACAGG - Intergenic
1126615794 15:50578085-50578107 AAACAAAGGAATGGAGATATAGG + Intronic
1127318432 15:57818817-57818839 GAACCAAGGAAGAGAAGTACAGG - Intergenic
1127545423 15:59990200-59990222 GAAGAAAGGAAGGGAGAGAGAGG + Intergenic
1130751726 15:86719631-86719653 GAACAAAGAAAGGGAGGGAGGGG - Intronic
1131855606 15:96590339-96590361 GGAGAAAGGAAGGGAGGTAGGGG + Intergenic
1132149640 15:99450551-99450573 GAATAAAGGAAGGTACCTCCAGG + Intergenic
1133976001 16:10600356-10600378 GAATAAAGGAAGGGAGTGAGTGG - Intergenic
1135152828 16:20024479-20024501 GAACAAAAGAAGGAAGGGACAGG - Intergenic
1135159461 16:20080845-20080867 GGACAGAGCAAGGGATCTACAGG - Intergenic
1135795851 16:25441861-25441883 GAAAAAAGGAAGGGACCGAGGGG + Intergenic
1135858555 16:26034172-26034194 GGACAGAGCAAGGGAGCGACTGG + Intronic
1138900775 16:61267179-61267201 GAACAAAAGAAGGGAGAAAAAGG - Intergenic
1139190191 16:64854591-64854613 AAACAAAGTAAGGGTGATACAGG + Intergenic
1139209961 16:65067759-65067781 GAAGAAAGGAAGGGAGGGAAGGG + Intronic
1139876529 16:70150418-70150440 GAACAAAGGAAGGAAATTATAGG - Intronic
1142435672 16:90055350-90055372 ACCCAAAAGAAGGGAGCTACAGG - Intergenic
1143845213 17:9768569-9768591 GAACAAAGGCAGTTAGCTCCTGG - Intergenic
1144172687 17:12674225-12674247 GAAAGAAGGAAAGGAGCTGCAGG - Intronic
1144261719 17:13528060-13528082 GAAAGAAGGAGGGGATCTACTGG + Intronic
1147762118 17:42805481-42805503 GAGGAAAGGAAGGGAGATCCAGG + Intronic
1151353543 17:73545488-73545510 GAACAAGGGAAGGGAGAGAAGGG + Intronic
1155600637 18:27542650-27542672 AAACAAAGGAAGAGATCAACAGG + Intergenic
1155612466 18:27682419-27682441 CAACAAAGGAATTGAGCTACAGG + Intergenic
1155842817 18:30667714-30667736 GACCAAAACAAAGGAGCTACAGG + Intergenic
1156134190 18:34016686-34016708 GAACAGAGGAAGGGTGCTGAGGG - Intronic
1156254174 18:35379133-35379155 GCACAAAGAAAGGGAGGTCCTGG + Intergenic
1156563428 18:38156162-38156184 AAAGTAAGGAAGGTAGCTACAGG - Intergenic
1156598148 18:38571854-38571876 GAACAGAAGAAGGGAGCAATAGG - Intergenic
1157034395 18:43953641-43953663 GGCCAAAGGAAAGGTGCTACAGG - Intergenic
1157275961 18:46311320-46311342 AAGCCAAGGAAGGGAGCAACTGG + Intergenic
1157371418 18:47115968-47115990 GGACAAAGGAAGGGACCTGATGG - Intronic
1158185745 18:54769219-54769241 GGCCAAAAGAAAGGAGCTACAGG + Intronic
1158416987 18:57257258-57257280 AAACAAAGGCAGGGAGGTGCAGG + Intergenic
1158611484 18:58944569-58944591 GCACAAAGGCAGGGGTCTACTGG - Intronic
1159449923 18:68587442-68587464 GAAGAAAGTAAGGGAATTACAGG + Intergenic
1160098581 18:75899469-75899491 GAAAAATGGAAAGAAGCTACTGG + Intergenic
1164844757 19:31422424-31422446 GATCAAAGGAAGGAGGCTGCTGG - Intergenic
1165780901 19:38433771-38433793 GAACAGAGGGAGGGGGCTGCGGG - Intronic
1166903404 19:46085089-46085111 GACCAAAAGAAAGGGGCTACAGG + Intergenic
925393208 2:3513069-3513091 GGTCAAAAGAAAGGAGCTACAGG - Intronic
925835239 2:7938782-7938804 TCACAAAGGAAGGGAGCTTGAGG - Intergenic
925846070 2:8034555-8034577 GAAAAAAGGAAGAGAGAAACTGG - Intergenic
926375592 2:12224188-12224210 GGACAAAACAAAGGAGCTACAGG - Intergenic
926570232 2:14521606-14521628 GAACAGTGGAAGGCAGCTAAGGG + Intergenic
926638295 2:15207262-15207284 GACCAAAACAAAGGAGCTACAGG - Intronic
926874781 2:17463662-17463684 GATGAAAGGAAGGGATCTAAAGG + Intergenic
926879465 2:17527274-17527296 GAACAAGGGAAGGGAGGGAATGG + Intergenic
930514794 2:52393289-52393311 GGACAAAGCAAAGGAGCTATAGG + Intergenic
931823022 2:65971587-65971609 GACCAAAGGCTGGGAGCAACTGG + Intergenic
932178538 2:69624061-69624083 GAAGGAAGGGAGGGAGCTAGAGG + Intronic
932409834 2:71539108-71539130 GAACACAGGAAAGGAACTGCAGG - Intronic
933083091 2:78018555-78018577 CAAGAAAGGACAGGAGCTACTGG + Intergenic
934866943 2:97822416-97822438 GAGCAAGGGAAGGGATCTCCAGG - Intronic
936679789 2:114757127-114757149 GAAAAAAGGAAGGGAGAGAGGGG + Intronic
936926062 2:117737894-117737916 GAACTAGAGAAGGGAGCTATAGG + Intergenic
936935468 2:117835275-117835297 GAACAAGGGCAGGTAGCTAAAGG - Intergenic
938008750 2:127811282-127811304 GAACAAAGGAAGCGCTCTGCAGG - Intergenic
938259128 2:129882766-129882788 GAACAGAGGGAGGGAGGAACAGG - Intergenic
938376493 2:130810569-130810591 GGACAAAGGTGGGGAGCTCCTGG - Intergenic
939270674 2:139935407-139935429 TAACAACGTAGGGGAGCTACTGG - Intergenic
939508427 2:143076561-143076583 GACCAAAGCAAAGGGGCTACAGG - Intergenic
940325569 2:152421711-152421733 GTACAAAGGAAATGAGCTCCCGG - Intronic
942940371 2:181608401-181608423 GCACAAAGGAAGGAAGCTGGGGG + Intronic
942964242 2:181871091-181871113 TAAGAAAGAAAGGGAGCTATTGG - Intergenic
943574337 2:189613513-189613535 GAACGAAGGAAGGAAGAAACAGG + Intergenic
944648978 2:201809843-201809865 GAACAGTGGAAGGCAGCTCCAGG - Intronic
946056029 2:216902504-216902526 GACCAAAAGAAAGGAGCTACAGG - Intergenic
948064067 2:235063554-235063576 GAACACAGGGAGGGAGAAACGGG + Intergenic
948243457 2:236457797-236457819 GAGGCAAGGAAGGGAGCTTCTGG + Intronic
1170237659 20:14125375-14125397 GAAAAAATGAAGGGAGCAAGTGG - Intronic
1172029732 20:31973507-31973529 GAAACAGGGCAGGGAGCTACTGG + Intronic
1173360114 20:42336245-42336267 GAAAGAAGGAAGGGAGGTATTGG + Intronic
1173438057 20:43050337-43050359 GAAGACGGGAAGGGAGCTCCAGG + Intronic
1174167480 20:48595409-48595431 GAAAAAAGGAAGGAAGCTGCAGG + Intergenic
1174342564 20:49907056-49907078 AAACAAAAGAAAGGAGCTGCTGG - Intronic
1176735654 21:10543872-10543894 GAAAAAAAGAATGGAGCTAATGG + Intronic
1181426319 22:22843306-22843328 GATCAATGTCAGGGAGCTACTGG + Intronic
1182060275 22:27392434-27392456 GCAGACAGGAAGGCAGCTACTGG - Intergenic
1182090891 22:27594126-27594148 GAACAGATGAAGGGAGGGACTGG + Intergenic
1182227184 22:28808044-28808066 GAAAAAAGGAAAAGAGCAACAGG - Intergenic
1182462167 22:30490793-30490815 GAGCAAGGGAGGGGAGGTACTGG + Intronic
1182698117 22:32209897-32209919 GAACAATGGGAGGGAGGGACAGG - Intergenic
1182768181 22:32773970-32773992 AAGCAAAGGAAGGGAGATCCGGG + Intronic
1182967812 22:34538765-34538787 GAAAAAAGGAAGGAGGCTAGGGG - Intergenic
1184772758 22:46607559-46607581 GAGCAAAGGCAGGGAGCATCGGG - Intronic
1185017552 22:48353535-48353557 GAAGAAAGGAAGGGAGGGAGGGG + Intergenic
1185027910 22:48426044-48426066 GAACACAGGAAGGGGGACACAGG + Intergenic
950866711 3:16195677-16195699 GAGCAAAGGAAGCGAGTTAGAGG + Intronic
951702433 3:25509840-25509862 GAGCAAAGAAAGGCAGCTGCTGG - Intronic
951896014 3:27610343-27610365 TAACAAAGGAAGTGAGCAACTGG + Intergenic
951983218 3:28588380-28588402 GAACCCAGGAAGGGAGCTGGTGG - Intergenic
952879997 3:37978679-37978701 TAAGAAAGTAAGGAAGCTACAGG - Intronic
954987627 3:54809657-54809679 GAACAAAGGAAGGGAGGGAGGGG - Intronic
955031069 3:55219200-55219222 GGACAAACAAAGGTAGCTACAGG - Intergenic
955663451 3:61325968-61325990 CAAGAGAGGAAGGGAGCTAGTGG - Intergenic
956754209 3:72369220-72369242 GAACAGAGCAAGGGAGTTGCAGG - Intergenic
957179639 3:76859810-76859832 GAACAAAGGAAGTGGCCTAGAGG - Intronic
957515494 3:81245438-81245460 CAAAAAAGGAAGGGAAATACTGG + Intergenic
959189555 3:103093339-103093361 GAACAAAGGAAGGAAAATAAAGG - Intergenic
960048313 3:113218121-113218143 GCACACAGGATGGGAGCTACAGG + Intronic
960056027 3:113277024-113277046 GGAAAAAGTAAGGGAGCTCCAGG - Intronic
960423697 3:117480462-117480484 GATTAAAGGAAGGGAGTTTCAGG + Intergenic
960597242 3:119417410-119417432 GGAGAAAGGAAGGGACCCACTGG - Exonic
962668239 3:137678339-137678361 AAAGAAAGAAAGGGAACTACAGG + Intergenic
963299846 3:143585876-143585898 GAGCAAGGGAAGGGAGTTATTGG - Intronic
964040207 3:152252278-152252300 GAACAAAGGGAGGGAGGGAGGGG - Intronic
964267858 3:154920839-154920861 AACCAAAGGAAAGGAGCAACAGG + Intergenic
965957533 3:174389181-174389203 GACCAAAAGAAAGGGGCTACAGG + Intergenic
966635520 3:182128990-182129012 GAACAGAAGAAGGGAGCTCTAGG + Intergenic
969164998 4:5299980-5300002 TAACAAAAAAAGGAAGCTACAGG + Intronic
970127566 4:12831874-12831896 GGACAAAGCAAAGGGGCTACAGG + Intergenic
971578295 4:28304333-28304355 GAAGAAGGGAAGGGATCTCCAGG - Intergenic
972031335 4:34462672-34462694 GCACAAAGGAAGGTAGAAACTGG - Intergenic
972084826 4:35203765-35203787 GAACAAAGGAGTGGTTCTACAGG + Intergenic
972475772 4:39447532-39447554 GAACAAAGAATGGGAGCAGCAGG + Intronic
973019648 4:45186701-45186723 GAAGAAAGGAAGGGAGGGAAGGG - Intergenic
974433841 4:61832269-61832291 GGACAAAGGATGGGACCTACAGG + Intronic
976274475 4:83261987-83262009 GGAGATAGGATGGGAGCTACAGG - Intronic
976615270 4:87069621-87069643 GAAAAAAGGAAGGGAGGAAGTGG - Intronic
977009326 4:91616279-91616301 AAACAAAGAAAGAGAGCTACAGG + Intergenic
977627209 4:99200403-99200425 GGCCAAAAGAAAGGAGCTACAGG + Intergenic
978000197 4:103547953-103547975 GAAAAAAGGAAGAAAGCTTCAGG - Intergenic
978111831 4:104974021-104974043 GAACGAAAGAAGTGAGGTACAGG - Intergenic
978277369 4:106968030-106968052 GAAAAAAGGAAGGGAGAAAACGG + Intronic
978322759 4:107516115-107516137 AACCAAAAGAAAGGAGCTACAGG - Intergenic
980448522 4:132942677-132942699 GGCCAAAAGAAAGGAGCTACAGG + Intergenic
980509813 4:133771338-133771360 GGCCAAAATAAGGGAGCTACAGG + Intergenic
981800583 4:148650788-148650810 GAACAAAAGAAAGGAGCTGAAGG + Intergenic
983460625 4:168022462-168022484 GACCAAAACAAAGGAGCTACAGG + Intergenic
984818385 4:183858614-183858636 GAAGGAAGGAAGGGAGGGACGGG + Intronic
987363164 5:17124904-17124926 GAACAAAGGAAGGAAGGAAGAGG - Intronic
987435381 5:17886533-17886555 GACCAAAACAAAGGAGCTACAGG - Intergenic
987462461 5:18229005-18229027 GAATAAAGGAAGGGAGAGAGGGG + Intergenic
987845474 5:23277608-23277630 TACCAAAAGAAAGGAGCTACAGG - Intergenic
987870883 5:23615153-23615175 GGACAAAAGAAAGGGGCTACAGG - Intergenic
989416055 5:41177729-41177751 GAATAAAGGAAGAGAGGGACAGG - Intronic
990604471 5:57395093-57395115 GGACAAATGAAGGAAGCAACTGG + Intergenic
992547719 5:77831283-77831305 GGATAAAGGAAGGGAGCTACAGG - Intronic
993268848 5:85766651-85766673 GAACAAATTAAGTGAGTTACAGG - Intergenic
995525479 5:113047298-113047320 GAACCAAGGCAGGGTGCTAGAGG - Intronic
995786037 5:115829162-115829184 GCACTAAGGAAGCCAGCTACAGG - Exonic
996297912 5:121945147-121945169 GAACAAAGGTAGTGAGATAGAGG + Intergenic
996620697 5:125498866-125498888 GAAGAGAGGAAGGGAGGAACTGG + Intergenic
997884622 5:137618957-137618979 AACAAAAGGAAGAGAGCTACAGG + Exonic
998065059 5:139151236-139151258 GGACAGAGGAAGGGGGCAACAGG + Intronic
998354512 5:141523866-141523888 GAACAAAGGAACTGAGCTGCAGG - Intronic
998521309 5:142803451-142803473 CAACAAAGGACAGGAGCTATGGG - Intronic
998903474 5:146879026-146879048 GGAGAAAGGCAGGGAGCTAGGGG - Intronic
998957383 5:147452379-147452401 GAACAAAGGAAGTGATCAGCTGG - Intronic
1000026566 5:157363820-157363842 GAACAAAGGTAGAGAGATAATGG + Intronic
1000413706 5:160961133-160961155 GAACAAAGCAAGGGAGGAATGGG + Intergenic
1001546780 5:172575235-172575257 AAATAAAGGAAGGGAGGTAAAGG + Intergenic
1002088889 5:176793049-176793071 CAACAAAGGAAGGGAGCAAGGGG - Intergenic
1002543624 5:179923671-179923693 GAAAAAGGGAAGTGAGGTACAGG - Intronic
1003403136 6:5807269-5807291 AGACAAAAGAAAGGAGCTACAGG - Intergenic
1004942800 6:20578908-20578930 GGACAATGGAAGAGAGTTACTGG + Intronic
1005274987 6:24207653-24207675 TAAGATAGGAAAGGAGCTACAGG - Intronic
1006795898 6:36732141-36732163 GAACAAAGGACAGGAGCTGAGGG - Exonic
1007038268 6:38698239-38698261 GAACTGAGGCAGGGACCTACGGG - Intronic
1008894985 6:56542691-56542713 GAACTCCGGAAGGGAGCTCCGGG + Intronic
1009741377 6:67751195-67751217 GAAGAAAGAAAGACAGCTACTGG + Intergenic
1009757394 6:67956933-67956955 GACCAAAAGAAAGGGGCTACAGG - Intergenic
1009761265 6:68009811-68009833 CAAAAAAGGAAAAGAGCTACTGG + Intergenic
1010539072 6:77069236-77069258 GACCAAAACAAAGGAGCTACAGG + Intergenic
1010630417 6:78191509-78191531 AAACAAAAAAAGGGGGCTACAGG + Intergenic
1010765783 6:79776306-79776328 GAACAGAGGAAGGGAGCTCCAGG - Intergenic
1012802954 6:103857017-103857039 GAAGAAAGGAAGAGAGACACTGG - Intergenic
1012830867 6:104202039-104202061 GGCCAAAGCAAAGGAGCTACTGG - Intergenic
1013293225 6:108736464-108736486 GGACAAAAAAAGAGAGCTACTGG + Intergenic
1013480113 6:110545612-110545634 GAACAAAGGTAGGGGGCAGCTGG + Intergenic
1015895592 6:138013515-138013537 GAAGAAAGGAAGGGAGGGAGGGG - Intergenic
1016445927 6:144132251-144132273 GAAGAAAGGAAGGGAGAGAGGGG - Intergenic
1016445939 6:144132294-144132316 GAAGAAAGGAAGGGAGAGAGGGG - Intergenic
1016445951 6:144132337-144132359 GAAGAAAGGAAGGGAGAGAGGGG - Intergenic
1016445963 6:144132380-144132402 GAAGAAAGGAAGGGAGAGAGGGG - Intergenic
1016445975 6:144132423-144132445 GAAGAAAGGAAGGGAGAGAGGGG - Intergenic
1016445987 6:144132466-144132488 GAAGAAAGGAAGGGAGAGAGGGG - Intergenic
1016729864 6:147417669-147417691 ATAGAAAGGAAGGGAGCCACTGG - Intergenic
1017035670 6:150264839-150264861 GGACAAAGGAAGACAGATACAGG - Intergenic
1017220796 6:151963093-151963115 GAGCAAAGGAAGGGAGGGAGGGG - Intronic
1017879290 6:158548592-158548614 GAACAAAGGAAGGGAGCTGGAGG - Intronic
1018394216 6:163364980-163365002 GAACAGTGGACGGGAGCGACTGG + Intergenic
1019146457 6:169978362-169978384 GAATAATGCAAGGGAGCTCCTGG - Intergenic
1019941859 7:4298216-4298238 GAATAAAGGAAGGGAGAAAAGGG - Intergenic
1022327176 7:29343087-29343109 GTAAAGAGGCAGGGAGCTACTGG + Intronic
1022407839 7:30108787-30108809 GAACAAAGGAAGGGAGCTACTGG - Intronic
1023170367 7:37385429-37385451 GAAGAAAGGGAGTGAGCCACAGG - Intronic
1023565731 7:41522123-41522145 GAAAAAAGGAAGGGAGGAAGAGG + Intergenic
1026638790 7:72106628-72106650 GAAGAAAGGAAGGGAGGGAGGGG + Intronic
1028194926 7:87895033-87895055 GAAAAAAGGAAAAGAGCCACAGG - Intronic
1028606592 7:92662393-92662415 GACCAAAGGAGGGGAGCTGGAGG + Intronic
1029377470 7:100188244-100188266 ACCCAAAGGAAGGGAGCCACAGG - Intronic
1031617931 7:123903287-123903309 GGCCAAAAGAAAGGAGCTACAGG + Intergenic
1032617608 7:133491847-133491869 GAACAAAGGAAGGGAACTCGCGG + Intronic
1033755461 7:144395566-144395588 GAACAAAGGAAAGAGGCTAGGGG - Intergenic
1033803746 7:144930629-144930651 GAAGCAAGGGAGGGAGATACGGG - Intergenic
1034345222 7:150381777-150381799 GAACAGAGGAGGGGAGCCAAGGG - Intronic
1036192206 8:6680665-6680687 GAAGGAAGGAAGGGAGGGACGGG - Intergenic
1038445118 8:27598312-27598334 GAACAAAGCCAGGAAGTTACGGG - Intronic
1038586914 8:28798213-28798235 GAAGAGAGGAAGGGAAGTACAGG + Intronic
1038692497 8:29775833-29775855 GGACAAAGGAAGGGAGCAGAGGG - Intergenic
1039332585 8:36554819-36554841 GAACAGAGGAAGGGAATTTCAGG + Intergenic
1041629425 8:60069074-60069096 GGACAAAGGAAGGGAGGGACAGG - Intergenic
1042065064 8:64865370-64865392 GAATAAATGAAGGGAGAAACAGG + Intergenic
1044532044 8:93318222-93318244 GATCGATGGAAGGGAGCTAAAGG + Intergenic
1044562795 8:93629729-93629751 GACCCTAGGAAGGGAGCTGCAGG - Intergenic
1044890228 8:96827280-96827302 GAACCAAGGAAGGGAGTTTTTGG - Intronic
1046090436 8:109497380-109497402 GAACAAAGGCAGGGAGGTGTGGG - Intronic
1046645727 8:116783590-116783612 AAACAAAGGAAAGGCTCTACTGG + Intronic
1046751708 8:117933723-117933745 GAACAAATGAAGGAAGAAACAGG + Intronic
1047806103 8:128361642-128361664 GAAGAAAGGAAGAAAGGTACTGG - Intergenic
1048177281 8:132164152-132164174 GAAAAGAGGAAGGGAGTTCCAGG - Intronic
1048451703 8:134539176-134539198 GCACCAAGGAAGGGACCTAGAGG + Intronic
1049084151 8:140464730-140464752 GAAAAAAAGAGGGGAGCGACCGG + Intergenic
1050260791 9:3838785-3838807 GAAGAAATGAAGGGAGCCAAGGG - Intronic
1054161707 9:61676305-61676327 GAACAAAGGAAGGGACATTTTGG + Intergenic
1055780185 9:79812545-79812567 GAAAAAAGGAAGAGAGCCAGAGG + Intergenic
1056262722 9:84864658-84864680 GAACCAAGGAAGGGAGTCAGTGG + Intronic
1057242457 9:93423499-93423521 GAGGAAGGGAAGGGAGCTCCTGG + Intergenic
1058838839 9:108885871-108885893 GTGCAAAGGAAGGGGGCTAAGGG + Intronic
1060365703 9:123011084-123011106 GCATGAAGGAAGGGAGCCACAGG + Intronic
1061950293 9:133932260-133932282 GAAAACAGGAAAGGATCTACAGG + Intronic
1062170667 9:135133089-135133111 CAACAGAGGAAGGGAGCGAGGGG + Intergenic
1185712410 X:2314478-2314500 GAAGGAAGGAAGGGAGGTAAAGG + Intronic
1186826593 X:13346510-13346532 GAGCAAAGGAAGGGAGAAAGAGG + Intergenic
1187180445 X:16938976-16938998 GGACAAAAGAAAGGGGCTACAGG + Intergenic
1187189252 X:17017474-17017496 GAACAAAGGGAGGGGATTACTGG + Intronic
1187690290 X:21859689-21859711 GAAAAAGGGGAGGGTGCTACTGG + Intronic
1188130953 X:26432158-26432180 GAAGAAAGGAATGAAGTTACAGG + Intergenic
1188175052 X:26978730-26978752 TAACAAAGGAATTGAGGTACGGG + Intergenic
1189155016 X:38748247-38748269 GAACTGAGGAGGGGAGCTCCTGG + Intergenic
1190299900 X:49051064-49051086 GACCAAAGGAAGGTAGTTAGTGG + Intergenic
1191760268 X:64639674-64639696 TCACAAAGAAAGGAAGCTACAGG - Intergenic
1192131358 X:68554352-68554374 GACCAAAGCTAGGGAGATACAGG - Intergenic
1193938424 X:87651544-87651566 GACCAAAGCAAAGGGGCTACAGG + Intronic
1194107707 X:89792468-89792490 AAACAAAGCAAAGGGGCTACAGG + Intergenic
1195762105 X:108257671-108257693 AAAAAAAGGAAGGGAGCCAGAGG - Intronic
1198526613 X:137507873-137507895 GACCAGAGGAAGAGAGCTACTGG + Intergenic
1199764884 X:150934377-150934399 GAACAAAAGAAGGTTGTTACAGG + Intergenic
1200459664 Y:3440253-3440275 AAACAAAGCAAAGGGGCTACAGG + Intergenic
1202593896 Y:26516195-26516217 GAAAAAAAGAATGGAGCTAATGG + Intergenic