ID: 1022407841

View in Genome Browser
Species Human (GRCh38)
Location 7:30108796-30108818
Sequence CTGCCAAAGGAACAAAGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 476
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 437}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022407841_1022407849 8 Left 1022407841 7:30108796-30108818 CCCTTCCTTTGTTCCTTTGGCAG 0: 1
1: 0
2: 2
3: 36
4: 437
Right 1022407849 7:30108827-30108849 GTGGCTTTCCACAGCACCCCAGG No data
1022407841_1022407851 14 Left 1022407841 7:30108796-30108818 CCCTTCCTTTGTTCCTTTGGCAG 0: 1
1: 0
2: 2
3: 36
4: 437
Right 1022407851 7:30108833-30108855 TTCCACAGCACCCCAGGTGTGGG 0: 1
1: 0
2: 1
3: 17
4: 173
1022407841_1022407852 15 Left 1022407841 7:30108796-30108818 CCCTTCCTTTGTTCCTTTGGCAG 0: 1
1: 0
2: 2
3: 36
4: 437
Right 1022407852 7:30108834-30108856 TCCACAGCACCCCAGGTGTGGGG No data
1022407841_1022407850 13 Left 1022407841 7:30108796-30108818 CCCTTCCTTTGTTCCTTTGGCAG 0: 1
1: 0
2: 2
3: 36
4: 437
Right 1022407850 7:30108832-30108854 TTTCCACAGCACCCCAGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022407841 Original CRISPR CTGCCAAAGGAACAAAGGAA GGG (reversed) Intronic
901213053 1:7537252-7537274 CGGGCAAAGGATCACAGGAAAGG - Intronic
901938673 1:12645354-12645376 ATGCTAAAGGAAGAAAGGAAGGG - Intronic
902119135 1:14146773-14146795 GTTCCAAAGGAAAAAATGAAAGG - Intergenic
904028621 1:27520329-27520351 TGGCGAAAGAAACAAAGGAAGGG + Intergenic
904657632 1:32061106-32061128 CTAACAAAGGAACAAGGGGAAGG + Intergenic
905907371 1:41627894-41627916 ATGACAAAGGAAGGAAGGAAGGG - Intronic
906121569 1:43395835-43395857 CTCCAAAAAGAACAAAGGCAAGG - Intronic
907305781 1:53512519-53512541 CTGCCAAAGTCAACAAGGAACGG - Intronic
907709321 1:56863934-56863956 TTACAAAAGGAAAAAAGGAAGGG - Intronic
907803539 1:57795455-57795477 CAGACAAAGGAACATAGAAATGG + Intronic
907989421 1:59565032-59565054 CTCCCAAGGGTACAAGGGAATGG + Intronic
908352000 1:63295194-63295216 GTTACAAAGTAACAAAGGAAGGG - Intergenic
909751970 1:79172615-79172637 GTGCCAAAGGAACAAAAGCAGGG - Intergenic
909891618 1:81014653-81014675 CTGCTCAAGGAACAAACAAATGG + Intergenic
910991037 1:93056702-93056724 CTGGCAAAGGAAAATTGGAATGG - Intergenic
911015304 1:93325946-93325968 GGGCCAAAGGAAAAAAGTAATGG - Intergenic
911452660 1:98084675-98084697 ATGCCAAAGGAAAGGAGGAAAGG - Intergenic
911557085 1:99357407-99357429 CTGCCAAGGGAGCATAGAAAAGG + Intergenic
911705705 1:101009861-101009883 TTGTTAAAGGAACCAAGGAAGGG - Intronic
911734540 1:101322483-101322505 CTGGAAAAGGAACAAATGCAAGG + Intergenic
912173224 1:107126010-107126032 CTTCCAGAGAAACAAAGGAAGGG - Intergenic
912236298 1:107854955-107854977 ATGGCAAAGGCACAAAGGGATGG - Intronic
912712766 1:111961433-111961455 ATGCCAAAGAGACAAAAGAATGG - Intronic
913264714 1:117033259-117033281 CAGCCAGAGCAACACAGGAAAGG + Intronic
913533762 1:119751972-119751994 CTCCAAAAGCAACAAATGAAAGG - Intronic
914839680 1:151238159-151238181 CTGGAAAAGGCAAAAAGGAAAGG - Intronic
915138205 1:153748923-153748945 ATGCCCAAGGAATGAAGGAATGG + Intronic
915209911 1:154300815-154300837 CTGGTAAAGGAATAAAAGAATGG - Intergenic
915597560 1:156904262-156904284 CTCCCACAGGAACTAAGGGACGG - Intronic
916725362 1:167517949-167517971 TTGGCAAAGGAAGAAAGAAAGGG + Intronic
916814823 1:168341629-168341651 CTGCCACAGCAGAAAAGGAAAGG - Intergenic
916942903 1:169694904-169694926 ATGCCAAGGAAACAAAGAAAGGG - Intronic
917832429 1:178906846-178906868 CTGCCAAAGTAACAAACAACAGG + Exonic
918588911 1:186219454-186219476 CTTCAAAGGGAGCAAAGGAAAGG + Intergenic
918947855 1:191093002-191093024 CTGCCAAGGCTACAAAGAAAGGG - Intergenic
918959430 1:191253920-191253942 CACACAAAGGAACACAGGAAGGG - Intergenic
919823697 1:201489099-201489121 CTGCCAAAGTCACAAAGGCTAGG + Intronic
920195365 1:204222907-204222929 CTGAGAGGGGAACAAAGGAAAGG + Intronic
920516773 1:206590694-206590716 CTTGAAAAGGAAAAAAGGAATGG - Intronic
920727295 1:208448107-208448129 CTCCCAAAAAAACAAGGGAAGGG + Intergenic
920735406 1:208528911-208528933 CAGCCAAAAGGAGAAAGGAAGGG - Intergenic
921660933 1:217802066-217802088 CTGCCCTAGGATCAAAGGCATGG + Intronic
921771872 1:219050362-219050384 CAGAGAAAGGAAGAAAGGAAAGG + Intergenic
922067521 1:222158514-222158536 CTCCCAAGGGACCAAGGGAAGGG + Intergenic
922898851 1:229121058-229121080 CTTCCAAAGTACCCAAGGAAAGG - Intergenic
923742122 1:236664464-236664486 CTATGAAAGGAAGAAAGGAATGG - Intergenic
924324551 1:242882762-242882784 CTCCCAAAGGAATAAAGGTTGGG + Intergenic
924929144 1:248712026-248712048 CTGCCCAAGGGCTAAAGGAATGG + Intergenic
1063969446 10:11371325-11371347 TTTCCCAAGGAACAAAGGGAGGG + Intergenic
1064099566 10:12451722-12451744 CTCCCAATGCAACAAAGGATTGG - Intronic
1064735854 10:18381153-18381175 CTGACAACAGAACCAAGGAATGG - Intronic
1069684016 10:70305639-70305661 TTTCCAAAGGAAAAAAGGAGGGG - Intronic
1069752969 10:70756559-70756581 ATGTCCAAAGAACAAAGGAAAGG + Intronic
1071218739 10:83437498-83437520 CCCCCAGAGGAACACAGGAAAGG + Intergenic
1071569731 10:86690378-86690400 CTGCCCAGGGAGCAAAGGAGAGG - Intronic
1071739750 10:88343809-88343831 CTGCCAAAAGGAAAAACGAAAGG + Intronic
1071920633 10:90346000-90346022 AAGCCCAAAGAACAAAGGAAAGG + Intergenic
1072284383 10:93899034-93899056 ATGCCAAAGGAAAGAAGGGAGGG - Intronic
1072934683 10:99700844-99700866 CTGACAAAGGAAAACAGAAATGG - Intronic
1072987567 10:100154940-100154962 CTAGCAAATAAACAAAGGAAAGG + Intronic
1073108216 10:101045362-101045384 CTGCCAAAGGAACTAGGCATTGG - Intergenic
1075143659 10:119864533-119864555 CTGGCAAAGGAAAAAAAAAAAGG - Intronic
1075524894 10:123175755-123175777 CTGCAAAAGGATCTGAGGAAAGG - Intergenic
1075585603 10:123655878-123655900 CTGCCAAGAGAGGAAAGGAAGGG + Intergenic
1075635453 10:124027337-124027359 CTCCCCAAGGGACAAAGGAGAGG + Intronic
1076176817 10:128374571-128374593 GTGCCAGAGGGACAAAGGCAAGG - Intergenic
1076189609 10:128473794-128473816 CAGCAAAAAGAACAATGGAAGGG - Intergenic
1076232754 10:128835359-128835381 CTGCCCCAAGAACAGAGGAAGGG - Intergenic
1076443423 10:130495819-130495841 CTTCCAAACGAATAATGGAAAGG + Intergenic
1077016071 11:399627-399649 CGGCAAAAGGTACAAAGGGACGG - Intronic
1077882851 11:6364471-6364493 TTGCCAAAGGGTCAAAGGATAGG + Intergenic
1078148315 11:8737590-8737612 CTAAAAAAGGAACAAAGAAATGG + Intronic
1078938687 11:15976466-15976488 TTCCCAAAGGAGGAAAGGAAAGG - Intronic
1079424728 11:20329456-20329478 GACCCAAAGGTACAAAGGAATGG + Intergenic
1079489354 11:20970290-20970312 CTACGAAAGGCATAAAGGAAAGG + Intronic
1080659822 11:34286622-34286644 CTGGCGAAGGAACCTAGGAATGG - Intronic
1081028249 11:38043223-38043245 CTTCCAAATTAAAAAAGGAAAGG - Intergenic
1082059496 11:47848338-47848360 CGCCCAACGGAACAAAGGCAGGG + Exonic
1083237774 11:61362562-61362584 CTGCCCTAGGTACAAAGGGAAGG + Intronic
1083601838 11:63953580-63953602 CAGACAAAGGCAGAAAGGAAAGG + Intronic
1083948680 11:65941460-65941482 CTGCAAAGGGAACACAGAAATGG + Intergenic
1084309692 11:68309749-68309771 CAGCCACAGGAACAAAGGGAAGG - Intergenic
1085155248 11:74287292-74287314 CTGGCAAAGGAGGAAAGGAAGGG + Intronic
1086493977 11:87383975-87383997 CTGTCATAAGAACAAAAGAAGGG + Intergenic
1087433088 11:98078298-98078320 CTCTCTAAGGAACTAAGGAAGGG - Intergenic
1088065875 11:105718781-105718803 CTGCCAAGGGAGCAGTGGAATGG - Intronic
1088278747 11:108116184-108116206 CTAACAAAGCAACAAAAGAACGG - Intergenic
1088304182 11:108390533-108390555 CGGCCAATGGTACAAGGGAAAGG + Intronic
1088760022 11:112920708-112920730 CTGCCAGAGGAACAGATGAAGGG - Intergenic
1088874836 11:113926527-113926549 CTGAAAAAGAAAAAAAGGAAAGG - Intronic
1089126327 11:116179041-116179063 CACCCAAAGGAACAAAGAGAAGG + Intergenic
1089667815 11:120031530-120031552 CTGCCTAGGGAACACAGGAAAGG - Intergenic
1090245688 11:125214501-125214523 CTGAAAAGGGAAAAAAGGAAAGG + Intronic
1091851449 12:3701111-3701133 GGGCCAAAGAAAAAAAGGAAAGG + Intronic
1093184531 12:16004542-16004564 CTGACAGAGGAAGAAAGAAAAGG + Intronic
1093452256 12:19329461-19329483 CTGCCAAACAAAAAAAGGCACGG - Intronic
1094352701 12:29544501-29544523 GTTCCAAAGAAACAAAGGAGAGG - Intronic
1094672966 12:32588767-32588789 GTGCCAAGAGAACAAAGGATGGG + Intronic
1095507453 12:42912335-42912357 CAGCCAAAGAAACACAGGAAGGG - Intergenic
1095523347 12:43094905-43094927 ATAGCACAGGAACAAAGGAAGGG - Intergenic
1096172438 12:49483087-49483109 CTGCAAGAAAAACAAAGGAAAGG - Intronic
1096576453 12:52555945-52555967 CCACCAAAGGAAGAAAGGAAGGG - Intergenic
1096783712 12:54005327-54005349 CTGACAAAGGAGCAGAGGAGAGG - Intronic
1096864821 12:54556314-54556336 TTCCCAAAGGAACGGAGGAATGG - Intronic
1097297404 12:57981708-57981730 CTGCCACAGAAACGAAGGATGGG - Intergenic
1097788253 12:63784834-63784856 CTGCCAACGGCCCAAAGGAGAGG + Intronic
1099115521 12:78619640-78619662 CTGCCCAGGGCCCAAAGGAAGGG - Intergenic
1099791209 12:87336371-87336393 CTGCAAAAGGATTAAAGCAAAGG + Intergenic
1099819651 12:87693783-87693805 CTCCCAAGGGAATCAAGGAATGG + Intergenic
1100466778 12:94853166-94853188 CAGCCACAGGAGCAAATGAATGG - Intergenic
1100704393 12:97184530-97184552 TTTACAAATGAACAAAGGAAAGG - Intergenic
1100727306 12:97422367-97422389 CTGCAAAAGAAACAAATAAAGGG + Intergenic
1101204790 12:102475800-102475822 CTGCCCAAGAAACAGAGGGAGGG + Intronic
1103873282 12:124106677-124106699 CAGGCAAAGCAACAAAGGACTGG + Intronic
1105341025 13:19526043-19526065 CTGGCAAAGTTACAGAGGAAAGG + Intronic
1106394441 13:29366809-29366831 ACGCCAAAGGAACCAAGGAGAGG - Intronic
1106621868 13:31377993-31378015 CTGCCAAGGAAATATAGGAAGGG + Intergenic
1107688494 13:42928151-42928173 CTGCCAGAGGAATACAGGTAGGG + Intronic
1110669789 13:78164106-78164128 CTGAGGAAGGAAGAAAGGAAAGG - Intergenic
1111552567 13:89833920-89833942 TTGGCAAAGGAGCAGAGGAAAGG - Intergenic
1111738361 13:92171147-92171169 CAGCAAAAGGAAAAGAGGAAGGG - Intronic
1111889272 13:94061491-94061513 CTGCCCAAGGAGCAAAGGGAGGG + Intronic
1113066178 13:106375846-106375868 CTGAAAAAGCAAAAAAGGAAAGG - Intergenic
1113239574 13:108321638-108321660 ATGCAAAAGAAAGAAAGGAAGGG + Intergenic
1113671890 13:112181251-112181273 GTGGCAAAGGCAGAAAGGAAAGG + Intergenic
1114864528 14:26572619-26572641 GTGTCACAAGAACAAAGGAAGGG + Intronic
1116052969 14:39827143-39827165 CTGGCAAGAGAACCAAGGAAAGG - Intergenic
1116221983 14:42098474-42098496 ATGTGAAAGGAACAAGGGAAGGG - Intergenic
1116728964 14:48598034-48598056 CTGCCAAAGAAATAAAAGGATGG + Intergenic
1117561851 14:56948482-56948504 CTGCTGAATGAACAAATGAATGG + Intergenic
1118285439 14:64466116-64466138 CTGCTCAAGGGAAAAAGGAAAGG + Intronic
1118427033 14:65676629-65676651 TTACAAAAGGAAGAAAGGAAGGG - Intronic
1119010650 14:70983872-70983894 CTGACAAAGAAACTAAGAAAGGG + Intronic
1120726377 14:87946223-87946245 CTGCCAAAAGAGCATAAGAAAGG + Intronic
1121529954 14:94645254-94645276 ATCCCAAAGGAAATAAGGAAAGG + Intergenic
1125412138 15:39416645-39416667 CTGCCTTAGGTAGAAAGGAATGG - Intergenic
1127223549 15:56906101-56906123 CTGGCAAAGGAAACCAGGAAGGG + Intronic
1127284028 15:57517131-57517153 CTCCCAGGGGAACAAAGAAATGG - Intronic
1127737340 15:61855264-61855286 CAGCCAAAGAAATGAAGGAAGGG - Intronic
1128612048 15:69081822-69081844 CTGGCTAAGGAACACAGGGAGGG + Intergenic
1129898089 15:79123285-79123307 TTGCCCAAGCAACAGAGGAAAGG + Intergenic
1129909904 15:79218443-79218465 GTGCCAAAGAAAGAAAAGAAAGG - Intergenic
1130049621 15:80472991-80473013 CTGAGAGAGGAACAAAGGTAGGG - Intronic
1131932992 15:97466722-97466744 CTGTCAAAGAAAGAAAGGAAAGG + Intergenic
1132642893 16:985714-985736 CAGCCCAAGGACCAAAGGAGGGG + Exonic
1136480397 16:30538105-30538127 TTGGCAAAGGAGCAGAGGAAAGG - Intronic
1139274392 16:65714081-65714103 GTTACAAAGGAATAAAGGAAAGG + Intergenic
1139328682 16:66171079-66171101 CTGCCCTGGGAACAAAGGGAGGG + Intergenic
1139523565 16:67499304-67499326 CTGCCAAGGGAATAAGGGGAGGG - Intergenic
1139908729 16:70383543-70383565 CTGTCAAAAAAAAAAAGGAAAGG + Intronic
1140992922 16:80231745-80231767 CGACCAGAGGAAAAAAGGAAGGG + Intergenic
1141534209 16:84668039-84668061 CTGCCGAAGGGACAAGGAAAGGG - Intergenic
1141860153 16:86710906-86710928 TGTCCAAAGGAACAAAGGGATGG + Intergenic
1142163600 16:88572494-88572516 CTGCCAAATGCAGAAAGCAACGG + Intronic
1144297273 17:13888021-13888043 GTACAAAAGGAACAAAAGAAGGG - Intergenic
1146100777 17:29979580-29979602 CAGCTAAAGAAACAAAGGGAGGG - Intronic
1146308092 17:31746071-31746093 ATACCAAAGGCACAGAGGAATGG - Intergenic
1147776304 17:42904130-42904152 ATGACAAAAGTACAAAGGAATGG - Intronic
1149805822 17:59616925-59616947 CTGCAAAAGTCACAAAGAAAAGG - Intergenic
1149960661 17:61106013-61106035 CTGCCAAGTGACCAAAGGATAGG - Intronic
1151241193 17:72759307-72759329 CAGACAAATGAGCAAAGGAACGG + Intronic
1152386600 17:79978424-79978446 CTGGCAAAGGAACAGAAGAAAGG - Intronic
1155034012 18:22008876-22008898 CTGCAAAAGGATCCAAGGGAAGG - Intergenic
1155565842 18:27133141-27133163 CTGCCAACAGAACTAATGAAGGG + Intronic
1155614664 18:27707611-27707633 CTACCAAAGGTACAAAGAAGAGG - Intergenic
1156718123 18:40037113-40037135 CTGGCAAAGGAAGAAATAAAGGG + Intergenic
1157601418 18:48895298-48895320 CCCCCAAAGACACAAAGGAAGGG - Intergenic
1157884290 18:51351452-51351474 GTTCCAAAAGAAGAAAGGAAGGG + Intergenic
1157992049 18:52509352-52509374 CTGCCACATGAAAAAAGTAAAGG - Intronic
1158943703 18:62430269-62430291 TTGCTAAAAGAACAAAGGAAGGG + Intergenic
1159050611 18:63418080-63418102 CTGCTGAGGGAAAAAAGGAAAGG - Intronic
1159211448 18:65327387-65327409 CTGCCAATCGAATAAAGGAAAGG + Intergenic
1159514039 18:69434914-69434936 CTGTCAAAAGAAAAAAGGGAGGG + Intronic
1159978381 18:74744647-74744669 CTGCAAAAGAAACAAAGCATTGG + Intronic
1161580439 19:5077803-5077825 CTGCCAAAGAAACAGAGGGCAGG + Intronic
1163784554 19:19268065-19268087 GTGCAAGAGGAACAAAGAAAGGG - Exonic
1164914218 19:32037531-32037553 CTGGCAAAAGAGCAAAGCAAAGG - Intergenic
1167556922 19:50202629-50202651 GAGCCAAGGGCACAAAGGAATGG - Intronic
1167735663 19:51293226-51293248 CTGCCAGAGCAAGAAAGGAAAGG + Intergenic
925106943 2:1299765-1299787 TTGCCAAAGGCACAGAGGACGGG - Intronic
925404057 2:3594677-3594699 ATCCCATATGAACAAAGGAAAGG + Intergenic
925493439 2:4421219-4421241 CTGACAAGGGCAGAAAGGAAGGG - Intergenic
925669006 2:6291701-6291723 CTGAACAAGGAAGAAAGGAAAGG - Intergenic
926054040 2:9763365-9763387 CTTCCAAAGCACCAAAGGCAAGG - Intergenic
926578424 2:14608275-14608297 GGGAGAAAGGAACAAAGGAAGGG + Intergenic
926902562 2:17770063-17770085 GTGCCCAAGCAAGAAAGGAAAGG + Intronic
928493400 2:31806667-31806689 ATGGCATAGGAACAAAGGATTGG - Intergenic
929428744 2:41869698-41869720 CTGCCAGAAGAAAAAGGGAATGG + Intergenic
929481239 2:42310347-42310369 CTGCAAAAGGGAAAAGGGAAGGG - Intronic
932139894 2:69266192-69266214 CTGGCAAAGAAAAAAAGAAAGGG + Intergenic
932885234 2:75543353-75543375 CTGACCAAGGAACACACGAATGG + Intronic
932913247 2:75827649-75827671 CTAAAAAATGAACAAAGGAAAGG + Intergenic
933282122 2:80343937-80343959 TTACCAAAGGGATAAAGGAATGG - Intronic
933398895 2:81766046-81766068 CTGCCAAAGGGATAATGAAATGG - Intergenic
933684207 2:85130611-85130633 TTGGCAAAGGAAGAAAAGAATGG - Intergenic
933807522 2:86011187-86011209 CTGCCAAGGGAAGAAGGGGATGG + Intergenic
934883527 2:98004809-98004831 CTACGAAAGGAAGGAAGGAAAGG - Intergenic
935196116 2:100818051-100818073 CTTCCAAAGCAAAAAAGGAAGGG + Intergenic
935271115 2:101435191-101435213 CTGGCAAAAGAACAAAGGCGTGG + Intronic
936073260 2:109385087-109385109 CTGTCAGAGGGACAGAGGAAGGG - Intronic
936882007 2:117265028-117265050 CTGCCCAAGGGAAAAAGGACAGG - Intergenic
938239721 2:129734070-129734092 CTGCAGAAGGAACAAAGAAGAGG + Intergenic
938313704 2:130312118-130312140 ATGACAGAGTAACAAAGGAAGGG + Intergenic
938707851 2:133949025-133949047 CTGCCAAAGGCTGAGAGGAATGG - Intergenic
938934327 2:136115913-136115935 CTGCAAAAGAGGCAAAGGAATGG + Exonic
938972207 2:136442960-136442982 CTGAAAAGGGCACAAAGGAAAGG - Intergenic
939450075 2:142362629-142362651 CTGCCAAAGGAAGAAAAACACGG + Intergenic
940023163 2:149177462-149177484 CTGCCAAAGAAACAAAGTGAAGG - Intronic
940555775 2:155226690-155226712 CTGAGAAATGAACAATGGAAAGG - Intergenic
941151526 2:161920112-161920134 CTGCCAAAGGCACAGAGGTGAGG - Intronic
941441057 2:165537232-165537254 ATGGCACAGGGACAAAGGAAGGG + Intronic
942936074 2:181557835-181557857 CTGCAAAAGTAATAAAGCAAAGG - Intronic
943704797 2:191023077-191023099 CAGCCCAAGGAGCAAAGGAAAGG + Intergenic
944189092 2:196982232-196982254 GTGTCCAAAGAACAAAGGAAAGG + Intronic
944339593 2:198580437-198580459 ATGCCAAAGGAGCTGAGGAAAGG + Intergenic
946865811 2:224039802-224039824 CTGCCTAGGGGACAGAGGAACGG + Intergenic
948776020 2:240289390-240289412 CTCCCAGAGGAACAGAAGAATGG - Intergenic
1169668862 20:8072192-8072214 TTGGTAAAGGAACAAAAGAAAGG + Intergenic
1169970704 20:11266755-11266777 CTGTCATAGAAACAAAGGCAAGG - Intergenic
1170607962 20:17887872-17887894 CTGCCACAGGAACAGTGGGAGGG - Intergenic
1170673931 20:18461465-18461487 TTGCAAAAGAAACAAAGAAAAGG - Intronic
1170910337 20:20560163-20560185 ATGCCATGGGAACCAAGGAAGGG + Intronic
1171210731 20:23314958-23314980 CTGCTAAAGGTTGAAAGGAAGGG + Intergenic
1172955845 20:38758164-38758186 CAGACAAATGAACAAAGAAAAGG - Intronic
1173783416 20:45775031-45775053 CTGGCAAAGGAACACAGGGTGGG - Intronic
1174006604 20:47415983-47416005 CTGTGAAAGGAAGGAAGGAAGGG + Intergenic
1175355896 20:58367798-58367820 CTGCCCCTGGAAGAAAGGAACGG + Intergenic
1175744901 20:61449296-61449318 CTGCCATTGGACCCAAGGAAAGG + Intronic
1176187771 20:63790742-63790764 CTTCCAAATGAACAACCGAAAGG - Exonic
1176839139 21:13824409-13824431 ATGCCAGATGACCAAAGGAAAGG - Intergenic
1177621085 21:23594119-23594141 CTACCAAAGAAAAAAAGAAAGGG + Intergenic
1177912328 21:27048578-27048600 CTGCTAAAGATACAAAAGAAGGG + Intergenic
1178708373 21:34891612-34891634 TTGCCTAAGGGAGAAAGGAAAGG + Intronic
1178862867 21:36303988-36304010 CTACTAAAGATACAAAGGAAAGG - Intergenic
1179343195 21:40531767-40531789 CTGCAAAAGAAGGAAAGGAATGG - Intronic
1179356488 21:40665148-40665170 CAAGCAAAGGAATAAAGGAACGG + Intronic
1179531737 21:42024255-42024277 TTGCTAAATGAACAAATGAAAGG - Intergenic
1180632208 22:17237428-17237450 CCTCCAAAGGGCCAAAGGAAAGG + Intergenic
1181871333 22:25901697-25901719 CTGACCAATGAACAAACGAATGG - Intronic
1182017469 22:27052699-27052721 CTGCAAAAGGTACAGAGAAAGGG + Intergenic
1182719763 22:32387558-32387580 CTGACAAAGCAACAGACGAAAGG + Intergenic
1184854779 22:47140685-47140707 CTGCAGAAGGAGCAAAGGCAGGG - Intronic
1184890857 22:47378297-47378319 CTGCCACGGAAACAAAGGAAAGG - Intergenic
1185131852 22:49043785-49043807 CTCCTAAAGGAAGACAGGAAGGG - Intergenic
951099912 3:18675463-18675485 CTTCAAAAGGAAAAAAGGAGTGG + Intergenic
951296865 3:20947877-20947899 CTGCCAAAAAAAAAAAGCAATGG - Intergenic
952418899 3:33114049-33114071 CGGCGAAAGGAAGGAAGGAAGGG - Exonic
953578586 3:44133308-44133330 CTGCCAAAGGAAACAAAGACAGG - Intergenic
955001477 3:54931392-54931414 CAGCCAAGAGAACAAAGGGAGGG + Intronic
955592285 3:60550973-60550995 CTGCCTAAGTGTCAAAGGAAAGG + Intronic
955870845 3:63436875-63436897 CTCAAAAAGAAACAAAGGAAAGG - Intronic
956847051 3:73193245-73193267 CTGCCCAAGGCAGAAAGGTAGGG - Intergenic
957322294 3:78647582-78647604 ATGCCAAACTAACAATGGAAAGG + Intronic
957458767 3:80489668-80489690 ATTTGAAAGGAACAAAGGAATGG - Intergenic
957476592 3:80733584-80733606 CTGAGAAAGGAACAAAGACAAGG + Intergenic
957515382 3:81244113-81244135 CTACTAAAGGAATAAAGGGAGGG - Intergenic
957769502 3:84671856-84671878 CAGACAGAGGAACAAAGGAAAGG + Intergenic
959807684 3:110577133-110577155 CTACCCAAGGAACAAAAGATTGG - Intergenic
961724611 3:128918831-128918853 CTATCCAAGGAACACAGGAACGG + Intronic
962120671 3:132556964-132556986 CTCCCCAAGGAGCAGAGGAAAGG - Intergenic
962402919 3:135077155-135077177 TTGCCAAAGGAACCATGGACAGG + Intronic
964237564 3:154550824-154550846 CTGACAAATGAAAAAAGAAATGG + Intergenic
964531460 3:157672483-157672505 TTCTCAAAGGAACAAAGGACAGG - Intronic
965281499 3:166759806-166759828 CTGAGAAAGGAATAAATGAATGG - Intergenic
965880869 3:173386617-173386639 CTGCTAAAGGAAATAAGAAAGGG + Intergenic
966605507 3:181817863-181817885 CTGTGAAAGAAGCAAAGGAAGGG - Intergenic
967102257 3:186225331-186225353 CTGCCAAAGGAGAGAATGAATGG - Intronic
969194307 4:5548130-5548152 CTGCCAAAGGCAGCAAGGCATGG - Intronic
969270353 4:6095328-6095350 CAGCGAAAGAAAGAAAGGAAGGG + Intronic
969376710 4:6768062-6768084 CTGGCTAAGGACGAAAGGAAGGG - Intergenic
970318116 4:14848515-14848537 CTAGTAAAGGAAGAAAGGAAGGG - Intergenic
971433106 4:26589579-26589601 CTGCCAAAGGGATAAGGGGATGG - Intronic
971461604 4:26904703-26904725 CTGCAAAGGGAAGAAAGAAATGG + Intronic
971822599 4:31577947-31577969 TTGACAAAAGAACAAAAGAAAGG + Intergenic
972266215 4:37462668-37462690 CATTCAAAGAAACAAAGGAATGG - Intronic
972797948 4:42440949-42440971 CTGCCAAATCAACACAGGAAAGG + Intronic
973047622 4:45554092-45554114 CTCTCCAAAGAACAAAGGAAAGG - Intergenic
973211800 4:47623538-47623560 CAGGCAAAGGAAAAAAGGAAAGG + Intronic
973564685 4:52172330-52172352 CTGGTAAAGGCACAAATGAATGG - Intergenic
973737440 4:53886441-53886463 CTTCCAAAAGAAAAAAGGAAAGG + Intronic
973850266 4:54954978-54955000 TTTCCAAAGGAACAGAGAAAGGG - Intergenic
974821517 4:67072120-67072142 CTGCCGTAGGAATGAAGGAAAGG - Intergenic
978672514 4:111267534-111267556 CTGCCACAGAGGCAAAGGAAAGG + Intergenic
980665935 4:135935619-135935641 CTGACAAACGAATAGAGGAATGG - Intergenic
981740049 4:147991911-147991933 CTGCCAAAGCAAAAGAGGAAAGG - Intronic
981901024 4:149863667-149863689 GAGCAAAAAGAACAAAGGAAAGG + Intergenic
982234361 4:153238519-153238541 CTGGCAAGGGAAGAAAGGACTGG + Intronic
982602174 4:157466058-157466080 CTGTCACAGGAAAAAAAGAATGG + Intergenic
982653510 4:158117800-158117822 CTGAAAGAGGAACAAAGAAATGG - Intergenic
982665008 4:158251036-158251058 CTGGAAAAAGAAAAAAGGAATGG - Intronic
983352305 4:166606185-166606207 CTGTGAAAGAAAGAAAGGAAAGG + Intergenic
983545714 4:168961883-168961905 CTGTCATAGAAAGAAAGGAAGGG + Intronic
983893720 4:173058848-173058870 CTGCCAGGGGAACAGAGAAAAGG + Intergenic
984461036 4:180036812-180036834 CTGCCTACGAAACAGAGGAATGG - Intergenic
984590248 4:181609064-181609086 TTGCAAAAGGAAGACAGGAAAGG + Intergenic
984769527 4:183425244-183425266 CTGTCAAATGAACAAACAAATGG + Intergenic
984817733 4:183853426-183853448 CTGCCAGAGCAACCAGGGAAGGG + Intronic
984885688 4:184447183-184447205 CTGGGAAAGGAAATAAGGAAGGG + Intronic
985034084 4:185820892-185820914 ATGCCGAATGAACAAATGAACGG + Intronic
985273663 4:188217711-188217733 CTGGCAAGGGAATAAAGAAATGG - Intergenic
985820546 5:2157237-2157259 CTGCCAGAGACACACAGGAATGG + Intergenic
985821122 5:2160950-2160972 CTGCCAAATGGACAGATGAATGG - Intergenic
985827457 5:2203595-2203617 CTGGAAAGGGAACTAAGGAAAGG - Intergenic
986356797 5:6936678-6936700 CTAACAAAGGAAAGAAGGAAGGG - Intergenic
986729179 5:10622919-10622941 CTGGCAAAGGAAGAAGGAAAGGG + Intronic
988016740 5:25569277-25569299 CAGAAAAAGGAAAAAAGGAAAGG - Intergenic
988736068 5:34022643-34022665 GTGCCAATGGAACAGAAGAAAGG - Intronic
990013418 5:51027595-51027617 CTGACCATGGAACAAAGGAGAGG + Intergenic
990156399 5:52882608-52882630 CTGCAGATGGAAGAAAGGAAGGG - Intronic
990374668 5:55157334-55157356 CTGCCAAAACAACAAAGAAGAGG + Intronic
990878485 5:60514831-60514853 CAGCCAAAGCAATAAAGCAAGGG + Intronic
990883458 5:60565778-60565800 TTGCCAAAGGAAGAAGGGACAGG + Intergenic
991187054 5:63821365-63821387 ATGTCACAGGAACCAAGGAAAGG + Intergenic
991229043 5:64309133-64309155 CAGTCATAGGAACAAAGGCAAGG + Intronic
991311267 5:65245322-65245344 CTGCCCAAGGCACAGAGGAAAGG - Intronic
991521021 5:67496308-67496330 CTGCCAAAGGAATAGAACAAAGG + Intergenic
992013183 5:72550971-72550993 GTGCTAAAGGAATGAAGGAAGGG + Intergenic
992352417 5:75943855-75943877 TTGCCAAAGGAAATATGGAAGGG - Intergenic
993087257 5:83378449-83378471 CTGCCCAAGGCAGAAAGAAATGG + Intergenic
993118236 5:83743312-83743334 CTGCAAAAGAGACAAAGAAACGG - Intergenic
993408572 5:87545259-87545281 CTACCAGAGGAAGACAGGAATGG - Intergenic
994031883 5:95152618-95152640 TTGCCAAAAGAACAAAACAAAGG - Intronic
994508991 5:100679437-100679459 CTGGGAAAGGAAGAATGGAATGG - Intergenic
994822039 5:104665441-104665463 AGTCCAAAGGAAAAAAGGAAAGG - Intergenic
995133845 5:108659527-108659549 CTTCAAAAGGAAGAAAGAAAAGG + Intergenic
995839835 5:116433184-116433206 CTGCCAAAGGAAGTAACAAAAGG + Intergenic
996024166 5:118625182-118625204 CAGGCAAAGTAAGAAAGGAAGGG - Intergenic
996498597 5:124190455-124190477 CTGACAGAGGAACTATGGAAAGG - Intergenic
996800069 5:127393451-127393473 ATGACAAATGAAGAAAGGAAAGG + Intronic
997222986 5:132184678-132184700 CGGTCCAAAGAACAAAGGAAGGG + Intergenic
997776802 5:136616408-136616430 CTCCGAAAGCAACAAAGGATAGG + Intergenic
997965107 5:138350678-138350700 CTGCCCTGGAAACAAAGGAAGGG + Intergenic
998413876 5:141931259-141931281 TTGCTAGAGGAACAAAAGAAAGG + Intronic
998461142 5:142311130-142311152 GTACCAAAGGACCAAAGGAAGGG + Exonic
998860146 5:146435147-146435169 TTGCCAAATGGACAAATGAATGG + Intergenic
999617252 5:153437427-153437449 CTGGAAAAGGAAGATAGGAATGG - Intergenic
999653627 5:153791888-153791910 TTTCCAAATGAACAAATGAATGG - Intronic
1000280942 5:159781520-159781542 CTACAAAAGGAAGAAAGCAATGG + Intergenic
1001482197 5:172096110-172096132 CTGTGACAGGAACAAAGGATGGG + Intronic
1001524851 5:172421597-172421619 CTGGCCAGGGAACAAAGGCAAGG + Intronic
1002088893 5:176793058-176793080 CTGCCGCTGCAACAAAGGAAGGG - Intergenic
1003173256 6:3736618-3736640 CTGGCACAGGAAGGAAGGAAGGG - Intronic
1003482156 6:6544368-6544390 TTCACAAAGGAACAAAGGTAGGG - Intergenic
1004293990 6:14393796-14393818 CTCACCAAGGAACAAAGGGAGGG + Intergenic
1004330027 6:14712934-14712956 CTCACAAAGGAAAGAAGGAAGGG + Intergenic
1004434248 6:15575492-15575514 CTCACAAAGGAACAAATTAATGG + Intronic
1004485980 6:16066994-16067016 CTGCCAGAGGCACAAAGCAGAGG + Intergenic
1005208109 6:23428338-23428360 CTGCTGAAGGAAAAAAGAAAGGG - Intergenic
1005740028 6:28782511-28782533 GGGCAAAAGGAAGAAAGGAATGG + Intergenic
1006203052 6:32314011-32314033 TTGCCTCAGGAACAAAGGTAGGG - Intronic
1006203708 6:32320498-32320520 TTGCCTCAGGAACAAAGGTAGGG - Intronic
1006523787 6:34587463-34587485 CACCCAAGGAAACAAAGGAAAGG + Exonic
1007234677 6:40382091-40382113 CTGGCGAAGGAAGAAAGGACTGG - Intergenic
1007517956 6:42428638-42428660 TTTCCATATGAACAAAGGAAGGG - Intronic
1007970297 6:46045371-46045393 TTGCAAAAGGAAGGAAGGAAAGG - Intronic
1008143425 6:47859545-47859567 TTGACAAAGGAAGGAAGGAAAGG - Intergenic
1008413776 6:51215421-51215443 CTTCCAAAATAAAAAAGGAAAGG + Intergenic
1009196575 6:60693849-60693871 CTACCAAAGGAAAAAAAAAAAGG - Intergenic
1010708658 6:79145491-79145513 CTGTCATAGGAACAAAGGAAGGG + Intergenic
1010795566 6:80113372-80113394 CTGAAAAAGAAAAAAAGGAAAGG + Intronic
1011891001 6:92160136-92160158 CTTTCAAAAGAAGAAAGGAAAGG + Intergenic
1012096065 6:94963034-94963056 ATGACAAATGAACAAAAGAAAGG + Intergenic
1012493303 6:99807314-99807336 CTGCAAAAGCAGCACAGGAAAGG - Intergenic
1012625941 6:101402970-101402992 CGGCTAAAGTAACAAAAGAAAGG - Intronic
1013327354 6:109060431-109060453 CTCCCAAAGGAAAAAAGGCTTGG - Intronic
1013524463 6:110961445-110961467 CTGGCCAAGGAATAAAAGAAGGG + Intronic
1014682981 6:124456472-124456494 CTGGCAAATGAACAAAGGAACGG - Intronic
1014869234 6:126571157-126571179 ATGCCAAAGGAAAAAAAGTAAGG + Intergenic
1015160343 6:130146182-130146204 CTGACAAAAGAAGAAAGCAATGG + Intronic
1015637461 6:135291759-135291781 ATGATAAAAGAACAAAGGAAAGG + Intronic
1015927367 6:138323648-138323670 CTGCCAAAAGAAACAAGTAAAGG - Intronic
1016647040 6:146422888-146422910 TTACAAAAGGAAGAAAGGAAAGG + Intronic
1017843054 6:158237697-158237719 CAACCAAAGGAACAAGGAAAGGG - Intronic
1018049244 6:159994038-159994060 CTACCAAAGGTACAAAGAACTGG - Intronic
1018895773 6:168016040-168016062 CTGGCATAGCATCAAAGGAACGG + Intronic
1019801690 7:3092550-3092572 CTGCTAAAGGAAGAAGGGTAGGG + Intergenic
1020036402 7:4965910-4965932 CTGCCTCAGGAACCAAGGGAAGG - Intergenic
1020691845 7:11365147-11365169 GTGCCAAAGGAATAACGAAAAGG - Intergenic
1021666606 7:22988175-22988197 CTACCAAATTAACCAAGGAATGG + Intronic
1022250340 7:28601040-28601062 GAGCAAAAGGACCAAAGGAAAGG + Intronic
1022407841 7:30108796-30108818 CTGCCAAAGGAACAAAGGAAGGG - Intronic
1022587985 7:31634040-31634062 CTGCCAAAGGACCTTTGGAATGG - Intronic
1023155465 7:37247202-37247224 ATGTCTGAGGAACAAAGGAAAGG + Intronic
1024003579 7:45208810-45208832 CTGAAAAAGCAAGAAAGGAAAGG - Intergenic
1024443076 7:49443982-49444004 CTGGAAAAGCGACAAAGGAATGG + Intergenic
1024764962 7:52647067-52647089 CTGCTAAAGCAACAAAGGTGGGG - Intergenic
1026021700 7:66712817-66712839 CTGTCAAAAAAAAAAAGGAAAGG - Intronic
1026077557 7:67186286-67186308 CTGCGAAAGTAAGAAAGGAGGGG - Intronic
1026509149 7:71013503-71013525 CTGCCAAAAGAAAGAAAGAAAGG + Intergenic
1026699308 7:72625861-72625883 CTGCGAAAGTAAGAAAGGAGGGG + Intronic
1026812974 7:73484258-73484280 CTGTCAAAGGAAGGAAGGGAGGG + Intronic
1027657259 7:80945792-80945814 CTGCCAATGGAACACAGGAGAGG + Intergenic
1027906213 7:84185836-84185858 TTACCAAAGGAAAAAAGAAAAGG - Intronic
1028484589 7:91343993-91344015 TGGGCAAAGGAGCAAAGGAAAGG - Intergenic
1028665023 7:93332273-93332295 CTTCCACATGATCAAAGGAAAGG - Intronic
1028980632 7:96964216-96964238 CTCCCAAAGGAGAAAAAGAATGG - Intergenic
1030303268 7:107995308-107995330 CTCTCAAAGGAAAAAAGGGAGGG + Intronic
1031300993 7:120060608-120060630 CGGCCAAAGGAACAATAGATAGG - Intergenic
1031444023 7:121828751-121828773 CTGCCAAGGGGACTAAGGAAAGG + Intergenic
1031495793 7:122446593-122446615 CTGGCAAAGAACCACAGGAAAGG - Intronic
1031707396 7:124997772-124997794 CTGAGACAGGAATAAAGGAAGGG - Intergenic
1032246682 7:130219293-130219315 CTGCCAAATGAACAGATGACAGG - Intergenic
1032570327 7:132989301-132989323 TTTCCAAAGGAACATAGAAAAGG + Intronic
1033308282 7:140240572-140240594 ATCCCAAAGGATCAAAGGAATGG - Intergenic
1033863251 7:145656112-145656134 GTCCCAAAGGAACAGAGGCAGGG - Intergenic
1035049684 7:155991670-155991692 CTGTCAAATGAGCAAATGAATGG - Intergenic
1035648195 8:1244453-1244475 GTGCCATAGAAACATAGGAAGGG + Intergenic
1037398910 8:18473358-18473380 CTGATAAAAGAACAAAAGAAAGG + Intergenic
1037926851 8:22850383-22850405 CTGGAAAAGGAACAAAGCCAGGG + Intronic
1038094128 8:24288372-24288394 CTGCAAAAGGAAGTATGGAATGG - Intergenic
1038485973 8:27935588-27935610 GGGCCAGAGGCACAAAGGAATGG + Intronic
1038859236 8:31368114-31368136 CAGCCAAAGGAATAAACGCATGG - Intergenic
1039142735 8:34411115-34411137 CTGTCTAAAGAAAAAAGGAAGGG + Intergenic
1039345497 8:36699871-36699893 AGGCCAAAGGAACAAATTAAAGG - Intergenic
1039365148 8:36921343-36921365 CTCCCATAGGAGCAAAGGGAAGG - Intronic
1039426019 8:37486913-37486935 CTGCCAGTGGAACAGGGGAATGG - Intergenic
1039540427 8:38363190-38363212 CTGCTAAATGAACATAGGAATGG + Intronic
1039596758 8:38797403-38797425 ACGCCAAAGGAAGAAAGCAATGG - Intronic
1039748615 8:40456152-40456174 CTGGCACAGCAGCAAAGGAAGGG - Intergenic
1041273026 8:56127418-56127440 ATGACAATGGCACAAAGGAAAGG + Intergenic
1042214977 8:66421971-66421993 TTGCCAAAGGAAGACAGCAAAGG - Intergenic
1042413914 8:68497729-68497751 TTGCTAAATGAAAAAAGGAAGGG + Intronic
1042884232 8:73530410-73530432 CACACAAAGGAACAAAGGATGGG + Intronic
1043442662 8:80290085-80290107 TTGCTAAAAGAACAAAGGAGAGG + Intergenic
1043648673 8:82558857-82558879 CTACCAAAGGAACAAAAAAAAGG + Intergenic
1044750785 8:95413438-95413460 CTGCCAAAGGAGAGCAGGAAGGG - Intergenic
1044802996 8:95976243-95976265 CTGAGAAAGGAAGAAAAGAAAGG + Intergenic
1046062591 8:109157116-109157138 CTTCCAAAGAAACAAAGAGAAGG - Intergenic
1046152586 8:110247122-110247144 CTGCCAAAGTTACAAAGAAGAGG - Intergenic
1047235086 8:123034023-123034045 CTGTCAAAGGAAGAAAGGGTTGG + Intronic
1049478550 8:142808100-142808122 CTGCCCCAGGAAGAAAGGCATGG + Intergenic
1050096854 9:2076206-2076228 CTGGAAAAGGAACAAAGATAGGG - Intronic
1050180055 9:2912523-2912545 TTTGCAAAGGAAGAAAGGAAGGG - Intergenic
1050257147 9:3806587-3806609 CTTCTAAAGTAATAAAGGAAAGG - Intergenic
1050616799 9:7409683-7409705 CTAGCAGAGGAACAAAGGAAAGG - Intergenic
1051150857 9:14077624-14077646 CTTCCAAAAGAAGAAAGCAAAGG + Intergenic
1051230319 9:14948949-14948971 CTGCCAAAGAGGCAAATGAAAGG + Intergenic
1051362630 9:16294626-16294648 CTGCGAAAGAAAAAAAGAAAAGG - Intergenic
1053444182 9:38138889-38138911 TTGCCAAAGGATGAGAGGAAGGG - Intergenic
1054380564 9:64485981-64486003 CTGCCAAGGAACCAAAGCAAGGG + Intergenic
1054515182 9:66030330-66030352 CTGCCAAGGAACCAAAGCAAGGG - Intergenic
1054826657 9:69580279-69580301 CTGCCAAGGGCACAGAGGATGGG + Intronic
1057098959 9:92339545-92339567 CTGCCAAAGTGACCAAGAAAAGG + Intronic
1057189264 9:93077364-93077386 CTGCCTGAGGAATGAAGGAAGGG - Intronic
1057504786 9:95625246-95625268 CTGCCAATGGAACTAAGTAGCGG - Intergenic
1058367992 9:104233046-104233068 TTGGGAAATGAACAAAGGAAAGG + Intergenic
1058539811 9:105999889-105999911 CTGCCTAATGGACAAGGGAAAGG + Intergenic
1058687309 9:107489878-107489900 CTGCCATAGCAACGATGGAAGGG - Intronic
1059358537 9:113720179-113720201 CTTCCAAAGGAAGGAAGGAAGGG - Intergenic
1059733919 9:117083078-117083100 ATGCCAGAGGAAAAAGGGAAGGG - Intronic
1060509545 9:124222126-124222148 CTCCTTAAGGAACAAAGGAGTGG + Intergenic
1060883297 9:127133585-127133607 CTGGCAGAGGAAGAAAGGCAAGG - Intronic
1062401576 9:136375115-136375137 CTGCCACAGAGACAAAGGAAAGG + Intergenic
1186077683 X:5898322-5898344 CAGACAAAGGAACGAAGGGAGGG - Intronic
1186550807 X:10503223-10503245 CTGCCAGAGGAACAATGAAAGGG + Intronic
1186808404 X:13162754-13162776 GTGGCAAAGGAGCATAGGAAAGG + Intergenic
1188368558 X:29340587-29340609 GTGCCACACGACCAAAGGAAAGG - Intronic
1188769912 X:34140492-34140514 ATGTAAAAGGAGCAAAGGAAAGG - Intergenic
1189208531 X:39263000-39263022 GTGCTAAGGGAACATAGGAAAGG + Intergenic
1190904367 X:54711179-54711201 CTGCCAAAGGAGTAAAAGAAAGG - Intergenic
1191687927 X:63911641-63911663 CTGCCAAGGGAAAAAGGGAGGGG + Intergenic
1192910134 X:75594976-75594998 CTAGCAAAGAAAGAAAGGAAAGG - Intergenic
1193830736 X:86286539-86286561 CTCTAAAAGGAACACAGGAAGGG - Intronic
1194335942 X:92646149-92646171 CACCCACAGGAACAAATGAAAGG - Intergenic
1194862252 X:99014549-99014571 ATGCCTGAGTAACAAAGGAAAGG - Intergenic
1195151446 X:102074217-102074239 CCCCCAAAGGCACAAAGTAAAGG + Intergenic
1195306106 X:103585647-103585669 CTGCCAGCGGAACACTGGAATGG + Intronic
1196261792 X:113591546-113591568 GTGCAAAAGAAACACAGGAATGG - Intergenic
1196386346 X:115157390-115157412 CTGCCAAAAGAATACAGAAATGG + Intronic
1198328420 X:135597227-135597249 CTGACCAAGGAAAAAAAGAAAGG - Intergenic
1198578920 X:138042057-138042079 CTACCAGAGGTACAAAGAAAAGG + Intergenic
1199466817 X:148147410-148147432 GTGCCAAAGGACTAATGGAATGG - Intergenic
1199694957 X:150337287-150337309 CTGCCAAAGGGGCACAGCAAGGG + Intergenic
1200644375 Y:5762901-5762923 CACCCACAGGAACAAATGAAAGG - Intergenic
1201400923 Y:13603015-13603037 TTGCCTAAGGAAAAAAGCAATGG - Intergenic
1201580322 Y:15504421-15504443 CTGTCACAGGAAGACAGGAATGG - Intergenic