ID: 1022407842

View in Genome Browser
Species Human (GRCh38)
Location 7:30108797-30108819
Sequence CCTGCCAAAGGAACAAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 342
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 316}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022407842_1022407850 12 Left 1022407842 7:30108797-30108819 CCTTCCTTTGTTCCTTTGGCAGG 0: 1
1: 0
2: 2
3: 23
4: 316
Right 1022407850 7:30108832-30108854 TTTCCACAGCACCCCAGGTGTGG No data
1022407842_1022407851 13 Left 1022407842 7:30108797-30108819 CCTTCCTTTGTTCCTTTGGCAGG 0: 1
1: 0
2: 2
3: 23
4: 316
Right 1022407851 7:30108833-30108855 TTCCACAGCACCCCAGGTGTGGG 0: 1
1: 0
2: 1
3: 17
4: 173
1022407842_1022407852 14 Left 1022407842 7:30108797-30108819 CCTTCCTTTGTTCCTTTGGCAGG 0: 1
1: 0
2: 2
3: 23
4: 316
Right 1022407852 7:30108834-30108856 TCCACAGCACCCCAGGTGTGGGG No data
1022407842_1022407849 7 Left 1022407842 7:30108797-30108819 CCTTCCTTTGTTCCTTTGGCAGG 0: 1
1: 0
2: 2
3: 23
4: 316
Right 1022407849 7:30108827-30108849 GTGGCTTTCCACAGCACCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022407842 Original CRISPR CCTGCCAAAGGAACAAAGGA AGG (reversed) Intronic
900279556 1:1857564-1857586 CTTGCCAAAGGGACAATGGGTGG + Intronic
901372863 1:8815549-8815571 GCTGCAAAAGGAATAAAGGGAGG + Intronic
901938674 1:12645355-12645377 GATGCTAAAGGAAGAAAGGAAGG - Intronic
902137465 1:14322444-14322466 GCTGTCAAAGGAGCAAAGAAGGG - Intergenic
904052346 1:27647198-27647220 CCTACCAGAGGAGCAAAAGAAGG + Intergenic
906124697 1:43420627-43420649 CCTGCCAAAGGTTCCAAGCATGG - Intronic
906401975 1:45511152-45511174 CCTACCAAAGGAAGAAAGGCTGG + Exonic
906571234 1:46843268-46843290 CCTACCAAAGGAAGAATGGAAGG - Intergenic
906774785 1:48519462-48519484 CCAGCTAAAGCAGCAAAGGAAGG - Intergenic
907003386 1:50885769-50885791 TCTGTAAAAGGAAGAAAGGAAGG - Intronic
907384066 1:54114415-54114437 CCTGGCAAGGGAGCATAGGAGGG - Intergenic
908057556 1:60306117-60306139 CCAGCCTGAGCAACAAAGGAAGG - Intergenic
908352001 1:63295195-63295217 CGTTACAAAGTAACAAAGGAAGG - Intergenic
909751971 1:79172616-79172638 GGTGCCAAAGGAACAAAAGCAGG - Intergenic
910146785 1:84089229-84089251 CCTGCCAATGGAGGAAAGGGAGG - Intronic
911667921 1:100575213-100575235 CCTGATAAAGAAACAAAAGAGGG - Intergenic
911669299 1:100590462-100590484 CCTGACAAAGAAATAAAGCAAGG - Intergenic
911705706 1:101009862-101009884 CTTGTTAAAGGAACCAAGGAAGG - Intronic
912173225 1:107126011-107126033 GCTTCCAGAGAAACAAAGGAAGG - Intergenic
914232594 1:145777496-145777518 CCTGACCAAAGAACACAGGATGG + Intronic
915455011 1:156034634-156034656 CTTGCCAAAAGATCAGAGGATGG + Intergenic
915466995 1:156103815-156103837 CCTGCCCAAGGACCAGAGTAGGG + Intronic
915690389 1:157683244-157683266 CCTGCAAAACAAACAAAGGAAGG + Exonic
916468412 1:165095295-165095317 CTTCCCAAATGAACAAAGCAAGG + Intergenic
917054684 1:170967842-170967864 TGTGCCAAAGGAACAAAGCTAGG - Intronic
918145453 1:181752136-181752158 CCTGCAGAACCAACAAAGGACGG + Exonic
918524318 1:185449044-185449066 CCCTCCAAAGAAACAAGGGAGGG - Intergenic
918947856 1:191093003-191093025 CCTGCCAAGGCTACAAAGAAAGG - Intergenic
918985848 1:191624281-191624303 CCTGCCACAGGAAGAAGGGGTGG - Intergenic
919114785 1:193267273-193267295 TCTGACAAAGGTGCAAAGGAAGG - Intergenic
920727294 1:208448106-208448128 CCTCCCAAAAAAACAAGGGAAGG + Intergenic
923294601 1:232581337-232581359 TCTGCCAAAGGAACTAAGCTAGG + Intergenic
924324550 1:242882761-242882783 GCTCCCAAAGGAATAAAGGTTGG + Intergenic
924576577 1:245286081-245286103 CCTGCCAAAGTAGCAAAGCTGGG - Intronic
1063418463 10:5891362-5891384 CCAGCAAAAGAAAAAAAGGAAGG + Intronic
1065093994 10:22263078-22263100 CCTGTCGAAGGAAGGAAGGAAGG + Intergenic
1065790108 10:29252863-29252885 CCTGCCAAAGGTAGTAAGGATGG - Intergenic
1066988265 10:42487525-42487547 CCAGCTAAAGCAGCAAAGGAGGG + Intergenic
1068353732 10:55883216-55883238 CAAGCAAAAGGGACAAAGGAGGG + Intergenic
1069105939 10:64383510-64383532 CCTTCCAAAGGAACCATGGGTGG - Intergenic
1069599648 10:69695225-69695247 CCTGCAAAAGGAGCCAAGCAAGG - Intergenic
1069684017 10:70305640-70305662 ATTTCCAAAGGAAAAAAGGAGGG - Intronic
1070100472 10:73381336-73381358 CCTGGAATAGGAAGAAAGGAAGG + Intronic
1070429078 10:76318237-76318259 ACTACGAAAGGAAAAAAGGAAGG - Intronic
1072415336 10:95242255-95242277 CCTCCCAAAGGAAGGGAGGAAGG - Intronic
1072723952 10:97800183-97800205 TCTGCCAAATGGGCAAAGGAAGG + Intergenic
1072992199 10:100208028-100208050 CCTGCCAAAGGATAAATGGGTGG - Intronic
1073237772 10:102033172-102033194 CCTGCCAAGGAAACAAATAAGGG + Exonic
1073321345 10:102617989-102618011 CCAGCCAGAAGAGCAAAGGAAGG - Intronic
1074892844 10:117749642-117749664 CCTAACAAAGGAATGAAGGAGGG + Intergenic
1076043343 10:127270110-127270132 CCTGCCACAGGAGAGAAGGATGG - Intronic
1076189610 10:128473795-128473817 CCAGCAAAAAGAACAATGGAAGG - Intergenic
1076305702 10:129464535-129464557 ACTGTTAAAGGAACACAGGATGG - Intergenic
1076318833 10:129564031-129564053 AGTGCCAAAGGGACAAAGGCTGG + Intronic
1076435812 10:130440581-130440603 CCTGCCAAGGGTACACATGAGGG + Intergenic
1076822813 10:132948874-132948896 CCTGCAAATGAAACAAAAGACGG - Intergenic
1076934988 10:133561931-133561953 CCAGCAAAAGGAAAAAAGGGGGG + Intronic
1077875249 11:6299151-6299173 CATGGCAAAGGAAGGAAGGAAGG + Intergenic
1079704389 11:23595715-23595737 GCAGACAAAGGAACAAAGGAGGG + Intergenic
1079914652 11:26353574-26353596 CCATCCAAAGAAAGAAAGGAAGG - Intronic
1081446811 11:43138769-43138791 CCAGCCATTGGAACAAAGAAGGG - Intergenic
1081534507 11:43987321-43987343 CTTTCCAAAGGAACAAACGGAGG - Intergenic
1082697880 11:56392498-56392520 CCTGCCAAAGAAAAATAGGCTGG + Intergenic
1085155247 11:74287291-74287313 CCTGGCAAAGGAGGAAAGGAAGG + Intronic
1085510670 11:77086597-77086619 CTTGACAAAGGAAGAGAGGAAGG - Intronic
1087973712 11:104517725-104517747 ACTGCCCAAGGAAGAAAGCAGGG - Intergenic
1088760023 11:112920709-112920731 TCTGCCAGAGGAACAGATGAAGG - Intergenic
1089088238 11:115842311-115842333 CTTGTCAAAAGAAAAAAGGAAGG + Intergenic
1089461473 11:118656661-118656683 TCTGCCAAAGGAAGAGAGGAAGG - Exonic
1090028089 11:123184817-123184839 CCTGCCAAATGAATGAATGAGGG - Intronic
1090523900 11:127508556-127508578 CTCGTCAAAGGAAGAAAGGAAGG - Intergenic
1090620538 11:128556854-128556876 CATGCCAAAGGAAAAAAAAATGG + Intronic
1091158592 11:133398089-133398111 GCTGCCACTGGAACAAAGGGAGG + Intronic
1091503968 12:1048010-1048032 ACTTCAAAATGAACAAAGGAAGG - Intronic
1091619629 12:2076539-2076561 CTTAACAAAGGAAGAAAGGAGGG - Intronic
1092191171 12:6522127-6522149 CCAGCCTGAGCAACAAAGGAAGG - Intronic
1092216756 12:6689024-6689046 CCTGCCCAAGGAAAAGGGGAGGG + Intronic
1092777018 12:11952637-11952659 CCTGCCATATGAACTATGGAGGG - Intergenic
1093741202 12:22692018-22692040 CCAGCCAAAAGAACCTAGGATGG - Intergenic
1093950669 12:25162692-25162714 CCTGGGAAAGGAAGAAATGAAGG - Intronic
1094672965 12:32588766-32588788 AGTGCCAAGAGAACAAAGGATGG + Intronic
1095507454 12:42912336-42912358 ACAGCCAAAGAAACACAGGAAGG - Intergenic
1095523348 12:43094906-43094928 CATAGCACAGGAACAAAGGAAGG - Intergenic
1096576455 12:52555946-52555968 TCCACCAAAGGAAGAAAGGAAGG - Intergenic
1097297405 12:57981709-57981731 ACTGCCACAGAAACGAAGGATGG - Intergenic
1097349242 12:58529881-58529903 CAAGGCAAAGAAACAAAGGAAGG + Intergenic
1098038408 12:66330084-66330106 CCTGCCAAAGGAAAAATTGTGGG - Intronic
1100362624 12:93892520-93892542 CCAAACAAAGGAACAAAGAAGGG - Intronic
1100577907 12:95909460-95909482 CCTACCAGAGGTACAAAGAAAGG + Intronic
1100639798 12:96471494-96471516 CATGCCAGAGGGACAAAGGGAGG + Intergenic
1100852861 12:98731623-98731645 ACTGCCATAGGCACAAAGGTGGG + Intronic
1101204789 12:102475799-102475821 CCTGCCCAAGAAACAGAGGGAGG + Exonic
1102446232 12:113004916-113004938 CCTCCCTAAGGAAGAAAGGAAGG - Exonic
1104071089 12:125345881-125345903 CCTGCCAATGGGAAAAAGAATGG + Intronic
1105469923 13:20684376-20684398 CCAGCTAAAGAGACAAAGGAGGG - Intronic
1106464813 13:30004106-30004128 GATCCCGAAGGAACAAAGGATGG - Intergenic
1107305537 13:39014294-39014316 CCTGCCCTGGGAACACAGGAAGG + Exonic
1107463293 13:40626302-40626324 CCTGACAAAGCAACCAAGTAAGG + Intronic
1108268295 13:48733790-48733812 CCTCCCAAAGGAACACAGTCCGG + Intergenic
1109185651 13:59264651-59264673 ACTGGGAAAGGAAGAAAGGAAGG - Intergenic
1110277174 13:73653224-73653246 CCTGCCCAAGAAACAAAGAGGGG - Intergenic
1110312983 13:74072540-74072562 CCAGCCAAAGCAACATAGCAAGG + Intronic
1111738362 13:92171148-92171170 CCAGCAAAAGGAAAAGAGGAAGG - Intronic
1111889271 13:94061490-94061512 CCTGCCCAAGGAGCAAAGGGAGG + Intronic
1115706798 14:36007536-36007558 CCTTCCAAGGGCACTAAGGAAGG + Intergenic
1116221984 14:42098475-42098497 CATGTGAAAGGAACAAGGGAAGG - Intergenic
1117340256 14:54785989-54786011 CCTGCCAGAGGTACCAGGGATGG - Intronic
1117437538 14:55731179-55731201 CCTGGCAAAGTCACAATGGATGG - Intergenic
1118109146 14:62696432-62696454 CCTGCCCGAGGAGAAAAGGAAGG - Intergenic
1118427034 14:65676630-65676652 CTTACAAAAGGAAGAAAGGAAGG - Intronic
1118718322 14:68576010-68576032 TCAGCCAAAGGAGCAAAGAAAGG + Intronic
1120176978 14:81304718-81304740 ACTGTCACAGGAAAAAAGGAAGG + Intronic
1121512834 14:94525341-94525363 CCTGCCAAGCGGACTAAGGAGGG + Intergenic
1122261946 14:100528744-100528766 CCTGCCACAGGGACACAGGCAGG + Intronic
1123791664 15:23727169-23727191 CCTGCCAAAGTAAAACAGAATGG - Intergenic
1124430651 15:29605139-29605161 CCTCCCCAATGAACAAATGATGG + Intergenic
1125066351 15:35490194-35490216 CTTCCTAAAGGAAGAAAGGAAGG + Intronic
1125390875 15:39191403-39191425 CAGGGCACAGGAACAAAGGAGGG + Intergenic
1126730874 15:51681344-51681366 CCCGGGAATGGAACAAAGGAGGG - Exonic
1127910533 15:63412730-63412752 CCTGCCAAAGGAAGAACAGATGG - Intergenic
1128612047 15:69081821-69081843 CCTGGCTAAGGAACACAGGGAGG + Intergenic
1129116086 15:73366169-73366191 TCTGTCAAAGGAAAAAAGGGGGG + Intronic
1129359415 15:75015246-75015268 CCTGCTGAATAAACAAAGGAAGG - Intronic
1129489128 15:75905767-75905789 CCTGCCAAAGACACAATTGATGG - Intronic
1130222326 15:82030129-82030151 CCTACCAAATGAATACAGGAGGG + Intergenic
1130663426 15:85849721-85849743 CTTGGCAAAGAAACAAAGTATGG - Intergenic
1130856191 15:87841725-87841747 CCTCCAAAAGGAACATGGGAGGG - Intergenic
1130892930 15:88148965-88148987 CCTGCCAAAGGATCACATGGAGG + Intronic
1131053828 15:89364118-89364140 CCTGAGGAAGGAACAAGGGAGGG + Intergenic
1131412321 15:92220128-92220150 CCTGCTGCAGGAAGAAAGGAAGG - Intergenic
1131940941 15:97564292-97564314 CCTACCAAAGAAACAAAAAAAGG - Intergenic
1132053834 15:98634339-98634361 CCAGCCTAAGCAACACAGGAAGG - Intergenic
1132103237 15:99043092-99043114 CCTGCCAAGTGCACCAAGGATGG + Intergenic
1132642892 16:985713-985735 ACAGCCCAAGGACCAAAGGAGGG + Exonic
1133218908 16:4309962-4309984 CCTGCCCCAGGGAGAAAGGAGGG - Intergenic
1133790550 16:9006422-9006444 CCTGCCACAGGTACAGAGAAAGG - Intergenic
1135984809 16:27176328-27176350 CCTGACAGAGGAAGCAAGGATGG + Intergenic
1139328681 16:66171078-66171100 CCTGCCCTGGGAACAAAGGGAGG + Intergenic
1140068495 16:71628969-71628991 CTTTCCAAAGTAACAAAGGGAGG + Intronic
1140655390 16:77134474-77134496 CCTGTCAGGGGAACAAGGGAAGG - Intergenic
1140942204 16:79732783-79732805 CATTCCAAAGGAATAAAGTAAGG - Intergenic
1141534210 16:84668040-84668062 CCTGCCGAAGGGACAAGGAAAGG - Intergenic
1142068558 16:88076568-88076590 TCTGCAAAAGGGAGAAAGGAGGG - Exonic
1143430650 17:6880741-6880763 CCAGCTAAAGCAGCAAAGGAAGG - Intronic
1143536691 17:7545067-7545089 CCTGCTAAAGGAAAAAAACAGGG - Intergenic
1146010986 17:29194264-29194286 CCAAGAAAAGGAACAAAGGAAGG + Intergenic
1146100778 17:29979581-29979603 CCAGCTAAAGAAACAAAGGGAGG - Intronic
1146466356 17:33089813-33089835 TCTGCCAAAGGAAAAAATGAGGG - Intronic
1147198325 17:38782442-38782464 CCTCACCAAGGAACAATGGAGGG + Intronic
1148865013 17:50623885-50623907 TCTGCAAAAGGAACAGGGGAGGG - Exonic
1149785957 17:59435177-59435199 CTTGCCAAATGAGCAAAGAAAGG + Intergenic
1151545134 17:74788251-74788273 ACTGCCAAAGAAAAAAGGGATGG + Intronic
1152792552 17:82289501-82289523 CCAGCCAAAGAAAGAAAGAAGGG + Intergenic
1153097669 18:1426928-1426950 CCTCCCAAAAGAACAATGGATGG + Intergenic
1155565841 18:27133140-27133162 CCTGCCAACAGAACTAATGAAGG + Intronic
1156055038 18:32992205-32992227 GCTGTCAAAAGAACAAAGAATGG - Intronic
1156167683 18:34442965-34442987 CCTGTGAAAGGAGAAAAGGAAGG + Intergenic
1156297608 18:35807078-35807100 CATGCCTAGGGTACAAAGGAAGG + Intergenic
1158420352 18:57287614-57287636 CCTGCCACAGAAACCGAGGAGGG - Intergenic
1158943702 18:62430268-62430290 GTTGCTAAAAGAACAAAGGAAGG + Intergenic
1159253737 18:65917776-65917798 CCTGACAAATGAAGAAAAGATGG - Intergenic
1160231235 18:77051129-77051151 CCTGTCAGAGGAAGAAAGGCAGG + Intronic
1161223225 19:3128493-3128515 CCAGCAACAGGCACAAAGGAGGG + Intergenic
1162065060 19:8120492-8120514 CCTGTCTAAAGAAAAAAGGAAGG - Intronic
1163271809 19:16258979-16259001 CCTGGGACAGGATCAAAGGAGGG - Intergenic
1163361935 19:16852246-16852268 CATGCCAAAAGGACACAGGAAGG - Intronic
1164863562 19:31583191-31583213 CTTGCGGAAGGAACAGAGGAGGG - Intergenic
1164953661 19:32361919-32361941 TCTGTCAAAGAAAAAAAGGAAGG - Intronic
1165687000 19:37830556-37830578 CGTGCCATAGGAACAGAGCAAGG + Intergenic
1167863722 19:52306972-52306994 CCAGCTAAAGCAGCAAAGGAGGG - Intronic
1168490305 19:56803382-56803404 TCTGCAAGAGGAACAGAGGAGGG + Intronic
925106944 2:1299766-1299788 CTTGCCAAAGGCACAGAGGACGG - Intronic
925288095 2:2729006-2729028 CCTGCCAAAAGCACATAGTAGGG - Intergenic
925607187 2:5671554-5671576 CCTGTCAAAGAAAGGAAGGAAGG - Intergenic
926495966 2:13588780-13588802 CCTTCCAAAGAAACACAGTATGG - Intergenic
926610896 2:14945421-14945443 TCTCCCAAAGAAACAAAGCAAGG + Intergenic
927424517 2:22967205-22967227 TCTGCCAAATGTCCAAAGGAAGG - Intergenic
929134536 2:38610784-38610806 CCTGCCAAATGGACACAGTAAGG - Intergenic
930649131 2:53946904-53946926 CCTGAAAAAGGAAGGAAGGAAGG + Intronic
931810449 2:65849559-65849581 CCTGCCTGAGCAACAAAGCAAGG - Intergenic
932622223 2:73271482-73271504 CCTCCCAAAAGGAGAAAGGATGG - Intronic
933708048 2:85305955-85305977 CCTGACAGAGGAACAGAGCATGG - Intronic
933852746 2:86384217-86384239 CCTGCCAACAGTACTAAGGATGG - Intergenic
934611002 2:95736207-95736229 CCTGGGAAAGGAAAAAAGGCTGG + Intergenic
935196115 2:100818050-100818072 TCTTCCAAAGCAAAAAAGGAAGG + Intergenic
935702503 2:105824718-105824740 ACTGCCAAAGGAACCAAGGCCGG - Intronic
936073261 2:109385088-109385110 CCTGTCAGAGGGACAGAGGAAGG - Intronic
936475676 2:112837714-112837736 CCTGTCAAAGAGGCAAAGGAGGG - Intergenic
936544340 2:113377781-113377803 CCTGGGAAAGGAAAAAAGGCTGG + Intergenic
938794466 2:134706273-134706295 CCAGACAAAGGAAACAAGGAGGG - Intronic
940551698 2:155166628-155166650 CCTGCTTAAAGAAAAAAGGATGG - Intergenic
943543080 2:189241893-189241915 CCTGCCAAATTAGCAAAGGTTGG - Intergenic
943821842 2:192333325-192333347 ACAGGCAAAGGAAGAAAGGAAGG - Intergenic
945287095 2:208093920-208093942 CCTGCGAAAGGAAGGAAGGAAGG - Intergenic
1170910336 20:20560162-20560184 CATGCCATGGGAACCAAGGAAGG + Intronic
1172913939 20:38429959-38429981 CCTGCCAGAAGCAGAAAGGAAGG + Intergenic
1173618310 20:44417272-44417294 CTTGCCTGAGGACCAAAGGATGG - Intronic
1173783417 20:45775032-45775054 GCTGGCAAAGGAACACAGGGTGG - Intronic
1174609666 20:51788754-51788776 CCTCCCAAAGGAGGAATGGAAGG + Intronic
1175946121 20:62559565-62559587 CATGTCTAAGGAACACAGGATGG - Intronic
1177872309 21:26588770-26588792 CCAGCCAAAGAAATAAAGGTTGG - Intergenic
1179313804 21:40223047-40223069 CCTGAGAAGGGAACAAAGGTTGG - Intronic
1181021700 22:20106918-20106940 CCTGCCACAGGGACAAGGGCTGG - Intronic
1181639212 22:24187985-24188007 CCTCCCAACGGACAAAAGGAGGG + Exonic
1182009734 22:26990378-26990400 CTTGCCAAAGGTATAAAAGATGG + Intergenic
1182017468 22:27052698-27052720 CCTGCAAAAGGTACAGAGAAAGG + Intergenic
1183787810 22:40041053-40041075 CCTCTCAAGGGAAAAAAGGAAGG + Exonic
1184418367 22:44364881-44364903 CCTGCCCAGGGAAGCAAGGAAGG - Intergenic
1184451752 22:44586563-44586585 CCTTCCAAACGAACACAGCAAGG + Intergenic
1184802846 22:46773106-46773128 CCTGCCAGAGAAGGAAAGGAGGG - Intronic
1184854780 22:47140686-47140708 CCTGCAGAAGGAGCAAAGGCAGG - Intronic
949550118 3:5105466-5105488 CCTGTCAAGGGAACACAGAAAGG + Intergenic
951987205 3:28633884-28633906 TCTCCCAAAGAAACAAAGGAAGG - Intergenic
952418900 3:33114050-33114072 CCGGCGAAAGGAAGGAAGGAAGG - Exonic
953328692 3:42034170-42034192 CCTGCCAGGTGCACAAAGGAAGG - Intronic
954137872 3:48590413-48590435 ACTGCCAAAGGGACCAATGAGGG - Intronic
957515383 3:81244114-81244136 CCTACTAAAGGAATAAAGGGAGG - Intergenic
957816034 3:85298275-85298297 ATTGTCAAAGGAGCAAAGGATGG + Intronic
959832700 3:110883433-110883455 CCTTCCAAAGGAAAATAGGGTGG - Intergenic
961213912 3:125144996-125145018 CCTACCCAAGAAACAAAGCAGGG + Intronic
962988732 3:140559587-140559609 ACTGGGAAAGGAACAAGGGAGGG + Intronic
964154776 3:153571604-153571626 CCTGCTAAAGGAGGAAAGGGAGG + Intergenic
965094710 3:164210084-164210106 CTTGCCAAAGGGACAAAGCAAGG + Intergenic
965831126 3:172790350-172790372 CCTACCAAGGGAAGAAAGGCTGG + Intronic
966605508 3:181817864-181817886 CCTGTGAAAGAAGCAAAGGAAGG - Intergenic
966637186 3:182148451-182148473 CATGCCAAAGAAGCAAAGGTTGG + Intergenic
966674289 3:182568547-182568569 GCTGCAAAATTAACAAAGGAAGG - Intergenic
967099034 3:186200879-186200901 CCTGGCACAGCAACAGAGGAGGG - Intronic
973850267 4:54954979-54955001 CTTTCCAAAGGAACAGAGAAAGG - Intergenic
974096758 4:57372544-57372566 GCTGCCACAGGAAAACAGGATGG - Intergenic
975029663 4:69599766-69599788 CCTGGGAAAGGAAGGAAGGAGGG + Intronic
975227455 4:71891339-71891361 CCTGCCAAAGGAAGGCATGAAGG + Intergenic
975285705 4:72616897-72616919 TTTGCCAAAGGAACACAGGAAGG + Intergenic
976977876 4:91186228-91186250 CCAGCTAAAGCAGCAAAGGAAGG - Intronic
977873532 4:102122929-102122951 CTTGCCAAATGAACTAAGTAAGG - Intergenic
978481543 4:109197120-109197142 CCTGCCTGAGGAACATAGCAAGG + Intronic
979619961 4:122787688-122787710 CCTGCCTCAGGGAAAAAGGATGG + Intergenic
980137220 4:128870129-128870151 CCTGCCACAGGAAAAGAGAATGG - Intronic
982046770 4:151455507-151455529 CTTTCCAAAGGAACCATGGAAGG + Intronic
983239867 4:165220139-165220161 CCAGACAAAGCAACAATGGAAGG - Intronic
984885687 4:184447182-184447204 CCTGGGAAAGGAAATAAGGAAGG + Intronic
985219238 4:187685246-187685268 TTTTCCAAAGGAAGAAAGGAAGG - Intergenic
985618619 5:939769-939791 TCTTACAAAGGAGCAAAGGAAGG - Intergenic
988642215 5:33052611-33052633 CCTGTCACAAGAACAAAGGAAGG + Intergenic
989754876 5:44940250-44940272 CCTGCCATAGGACCAAAGTTTGG - Intergenic
990073338 5:51812209-51812231 CCTGCTACAGGAAGTAAGGAGGG - Intergenic
990545776 5:56819506-56819528 CATCCCAAAGGAAGAAATGAGGG + Intronic
993197736 5:84770868-84770890 CCTACAAAAGCAACAAAGGAAGG - Intergenic
993910065 5:93670407-93670429 CCTGTTGAAGGAACAAACGAAGG - Intronic
995606704 5:113864655-113864677 TCTGGTAAAGGAAGAAAGGATGG - Intergenic
996024167 5:118625183-118625205 CCAGGCAAAGTAAGAAAGGAAGG - Intergenic
996090412 5:119345520-119345542 CCTTAAAAAGGAAGAAAGGAAGG + Intronic
997375404 5:133394052-133394074 CCTGCCACAGCAGCAAAGGCTGG + Intronic
997435563 5:133871810-133871832 CCTGTGAAAGGAAGGAAGGAAGG + Intergenic
997558075 5:134818953-134818975 CCTGGCAAAGAACCCAAGGAAGG + Exonic
997965106 5:138350677-138350699 CCTGCCCTGGAAACAAAGGAAGG + Intergenic
998461141 5:142311129-142311151 CGTACCAAAGGACCAAAGGAAGG + Exonic
998852506 5:146364425-146364447 CCTGCAAAAAGAAGGAAGGAAGG - Intergenic
1000973402 5:167739117-167739139 CTAGCCAAGGGAACAAATGAGGG - Intronic
1001482196 5:172096109-172096131 GCTGTGACAGGAACAAAGGATGG + Intronic
1003173257 6:3736619-3736641 CCTGGCACAGGAAGGAAGGAAGG - Intronic
1004330026 6:14712933-14712955 CCTCACAAAGGAAAGAAGGAAGG + Intergenic
1005005294 6:21281799-21281821 CCTTACAAAGGTTCAAAGGAAGG - Intergenic
1006320523 6:33316941-33316963 CCAGCCACAGGAACAAAGAAAGG + Exonic
1009412648 6:63384209-63384231 CCTGCCACGAGAACCAAGGAGGG + Intergenic
1010252529 6:73722846-73722868 CGTGATAAAGGAAGAAAGGAAGG - Intronic
1010708657 6:79145490-79145512 CCTGTCATAGGAACAAAGGAAGG + Intergenic
1012581582 6:100876425-100876447 TCTGGCATAGGAACAAAGGTTGG + Intronic
1013412376 6:109893403-109893425 CCAGCCGAAGGAACAATAGATGG - Intergenic
1013524462 6:110961444-110961466 CCTGGCCAAGGAATAAAAGAAGG + Intronic
1014518510 6:122408710-122408732 ACTGCCAAAAGAAAAACGGAAGG - Intronic
1014720714 6:124914487-124914509 CATGCAAAAAGAACAAAAGAAGG - Intergenic
1015058337 6:128931061-128931083 CCTCCCAAAGGAACAAAGAATGG + Intronic
1015322584 6:131892857-131892879 CCTGCCAAAGGACCAGAAAAGGG - Exonic
1015383401 6:132594933-132594955 CAGGCCAAAGGCAAAAAGGATGG + Intergenic
1017941332 6:159055811-159055833 CCTGACAGAGAAACAAAGGCAGG - Intergenic
1019172432 6:170140650-170140672 CCTGCCACTGGAACAAGGTATGG + Intergenic
1019493118 7:1324269-1324291 CCTGGTAAATGAACAAATGAAGG - Intergenic
1019881722 7:3866978-3867000 CCTGCCAGAAGGACAGAGGATGG - Intronic
1021602306 7:22376563-22376585 GCAGCAAAAGGAACAGAGGAGGG - Intergenic
1022204451 7:28149979-28150001 CCTGGCAAGGGAATAGAGGAAGG - Intronic
1022407842 7:30108797-30108819 CCTGCCAAAGGAACAAAGGAAGG - Intronic
1022608971 7:31849276-31849298 CCTGCCCAAGGAAGAGAGGTGGG - Intronic
1023606141 7:41932944-41932966 CATGTGGAAGGAACAAAGGAAGG - Intergenic
1024764963 7:52647068-52647090 ACTGCTAAAGCAACAAAGGTGGG - Intergenic
1024796284 7:53025377-53025399 CCTGCCTAAGAACCAAAGCAGGG - Intergenic
1026077558 7:67186287-67186309 ACTGCGAAAGTAAGAAAGGAGGG - Intronic
1026520135 7:71110250-71110272 CATCCCAAAGGGACAGAGGAAGG - Intergenic
1026613771 7:71883920-71883942 TCTGTCAAAGAAAGAAAGGAAGG - Intronic
1026699307 7:72625860-72625882 ACTGCGAAAGTAAGAAAGGAGGG + Intronic
1026989445 7:74575325-74575347 CCTGCCAAGGTATCAGAGGAAGG + Intronic
1028397855 7:90392183-90392205 CCTAGCAAAGTAATAAAGGAAGG - Intronic
1033286168 7:140042429-140042451 ACTGCCTAAAGACCAAAGGAAGG + Intronic
1037680976 8:21097201-21097223 CAAGCCCAGGGAACAAAGGAAGG + Intergenic
1038030524 8:23634577-23634599 CCTGTCTAAGAAAGAAAGGAAGG - Intergenic
1038468732 8:27791941-27791963 CCTGCCAAAGGAAAACAAAAGGG - Exonic
1039898346 8:41732321-41732343 CATGGGAAAGGAACAGAGGAGGG + Intronic
1041240272 8:55843093-55843115 CATTCCAAAGGAATAAGGGAGGG + Intergenic
1041727662 8:61032947-61032969 CCTGTCAAAAGAAACAAGGAAGG + Intergenic
1041923992 8:63216690-63216712 TCTCCCAAAGAAACAAAAGAAGG - Intergenic
1041940100 8:63377490-63377512 ACTGTCACAGGAACAAAGGGAGG - Intergenic
1042717248 8:71787544-71787566 CCTGTCAAAAGAAAAGAGGAAGG + Intergenic
1042884231 8:73530409-73530431 ACACACAAAGGAACAAAGGATGG + Intronic
1043925692 8:86034083-86034105 CCTGCAAAACAAACAAAGCAAGG - Intronic
1045520199 8:102896738-102896760 ACTGGAAAAGGAATAAAGGAAGG - Intronic
1045557567 8:103229483-103229505 TCTGCCAATGGAAGGAAGGAAGG - Exonic
1046001171 8:108422196-108422218 CAGGCCAAAGGAACAAATAAAGG + Intronic
1046298527 8:112255379-112255401 CCTGCCCAAGGAAAAAGAGAAGG - Exonic
1046379648 8:113435154-113435176 ACTGCCAAATGTACAAAGCACGG - Intronic
1047036179 8:120940916-120940938 CCTGCCAAATGAGTAAAAGAAGG - Intergenic
1047465959 8:125114555-125114577 ACTGCCAAAGGAACCCTGGAGGG - Intronic
1047895465 8:129361658-129361680 TGTGCCAAAGGAAGGAAGGAAGG - Intergenic
1050096855 9:2076207-2076229 CCTGGAAAAGGAACAAAGATAGG - Exonic
1051054822 9:12972665-12972687 CCTTCCAAAAGAAGAAAGGCTGG + Intergenic
1054380563 9:64485980-64486002 CCTGCCAAGGAACCAAAGCAAGG + Intergenic
1054515183 9:66030331-66030353 CCTGCCAAGGAACCAAAGCAAGG - Intergenic
1054741057 9:68806151-68806173 GCTGCAGAAGGAACCAAGGAGGG - Intronic
1054826656 9:69580278-69580300 TCTGCCAAGGGCACAGAGGATGG + Intronic
1055716449 9:79123206-79123228 CCTTCCAAATGAGGAAAGGAAGG - Intergenic
1056886328 9:90447423-90447445 CCTGCTAGAGGACCAAAGAAGGG + Intergenic
1057189265 9:93077365-93077387 CCTGCCTGAGGAATGAAGGAAGG - Intronic
1058438359 9:104985114-104985136 CTTGCCAGAGGAAGAAAAGAGGG + Intergenic
1058949602 9:109891265-109891287 CTAGCCAAGGGAACAAAGGGAGG - Intronic
1059358538 9:113720180-113720202 CCTTCCAAAGGAAGGAAGGAAGG - Intergenic
1059555976 9:115280759-115280781 CCTGCCAAAGAAACAATCCAGGG + Intronic
1059733920 9:117083079-117083101 CATGCCAGAGGAAAAAGGGAAGG - Intronic
1060899797 9:127247010-127247032 CATGGCAAAGGCACAAAGCAGGG + Intronic
1061584315 9:131556123-131556145 CCTGCCAAAGGACTACATGATGG + Intergenic
1062184946 9:135213189-135213211 CCTACCAAAGGCACAAGGCAGGG - Intergenic
1062401594 9:136375191-136375213 CATGCAAAAGGAACAGTGGAGGG + Intergenic
1185767041 X:2733716-2733738 CCTGCCAAGGGAACAAACTGGGG + Intronic
1185878795 X:3722042-3722064 CCTGTGAAAGAAAAAAAGGAAGG + Intergenic
1186257676 X:7740318-7740340 TCTGCCAGAGGACCAGAGGATGG - Intergenic
1186550806 X:10503222-10503244 GCTGCCAGAGGAACAATGAAAGG + Intronic
1188004268 X:25006436-25006458 ACAGACAAAGAAACAAAGGAGGG - Intronic
1190845470 X:54186787-54186809 CATCTCAAAGGAACAGAGGAAGG + Intergenic
1191687926 X:63911640-63911662 GCTGCCAAGGGAAAAAGGGAGGG + Intergenic
1192276202 X:69633684-69633706 CCTGTAAAAGGGAAAAAGGACGG - Intronic
1193376092 X:80763452-80763474 TCTGCCAAAGCAACAAAAGTGGG + Intronic
1197670479 X:129272324-129272346 CTTGCCAAAGAAACAAAATAAGG - Intergenic
1198110385 X:133497786-133497808 CCAGCCAGAGGAATACAGGAAGG + Intergenic
1199722082 X:150549352-150549374 CCTACCCAAGGAATAAAGGCGGG + Intergenic