ID: 1022407845

View in Genome Browser
Species Human (GRCh38)
Location 7:30108801-30108823
Sequence CCCTCCTGCCAAAGGAACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 195}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022407845_1022407851 9 Left 1022407845 7:30108801-30108823 CCTTTGTTCCTTTGGCAGGAGGG 0: 1
1: 0
2: 2
3: 16
4: 195
Right 1022407851 7:30108833-30108855 TTCCACAGCACCCCAGGTGTGGG 0: 1
1: 0
2: 1
3: 17
4: 173
1022407845_1022407852 10 Left 1022407845 7:30108801-30108823 CCTTTGTTCCTTTGGCAGGAGGG 0: 1
1: 0
2: 2
3: 16
4: 195
Right 1022407852 7:30108834-30108856 TCCACAGCACCCCAGGTGTGGGG No data
1022407845_1022407850 8 Left 1022407845 7:30108801-30108823 CCTTTGTTCCTTTGGCAGGAGGG 0: 1
1: 0
2: 2
3: 16
4: 195
Right 1022407850 7:30108832-30108854 TTTCCACAGCACCCCAGGTGTGG No data
1022407845_1022407849 3 Left 1022407845 7:30108801-30108823 CCTTTGTTCCTTTGGCAGGAGGG 0: 1
1: 0
2: 2
3: 16
4: 195
Right 1022407849 7:30108827-30108849 GTGGCTTTCCACAGCACCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022407845 Original CRISPR CCCTCCTGCCAAAGGAACAA AGG (reversed) Intronic
903016030 1:20362390-20362412 ACCTCCTGACAAAGCAACACAGG + Intergenic
903176867 1:21586639-21586661 CCCTCCTGCCACTGGAACCGAGG + Intergenic
903695092 1:25200571-25200593 CCCTCCAGACAAGGGAGCAAAGG - Intergenic
904408013 1:30306317-30306339 CCCTCCTCCCAAGGGAATATTGG + Intergenic
904884238 1:33724454-33724476 CTCTCCTGCCACAGAAACACAGG - Intronic
905732572 1:40306698-40306720 CCCTCCTGCCATATCAGCAATGG - Intronic
906401973 1:45511148-45511170 CATTCCTACCAAAGGAAGAAAGG + Exonic
908656551 1:66394765-66394787 ACCTGCTGCCACGGGAACAAGGG + Intergenic
909514044 1:76487748-76487770 CTCGCCAGCCAACGGAACAAAGG - Intronic
909822757 1:80086793-80086815 CCCTGCTCCCAAATGAACATAGG + Intergenic
910208374 1:84770310-84770332 CCCTCCTGCCAGAGGCTGAAGGG + Intergenic
915690386 1:157683240-157683262 TCCTCCTGCAAAACAAACAAAGG + Exonic
916465182 1:165066914-165066936 CCCTCCAGCCAAAGCAGCAATGG + Intergenic
918985851 1:191624285-191624307 CATTCCTGCCACAGGAAGAAGGG - Intergenic
920684493 1:208099026-208099048 CCATCCTGCCCAGGGGACAATGG - Intronic
1062911017 10:1212546-1212568 CCCTCCTGCTAAACCAACAAGGG + Intronic
1063767332 10:9157734-9157756 CCCTCCTGCCCTAGCAATAAAGG + Intergenic
1065273377 10:24060005-24060027 ACCTGCTGCCACAGGAAAAAAGG - Intronic
1067451503 10:46384761-46384783 CCCTGCTGCCCTAGGAACAGAGG - Exonic
1067585736 10:47474995-47475017 CCCTGCTGCCCTAGGAACAGAGG + Exonic
1069843199 10:71352841-71352863 GCCTCCTGGCAAAGCACCAATGG - Intronic
1074248187 10:111714746-111714768 CCCTGCTGCGACAGGCACAAAGG + Intergenic
1075375577 10:121975381-121975403 ACCTCTTGTCAAGGGAACAAAGG - Intergenic
1076176819 10:128374576-128374598 CCCTGGTGCCAGAGGGACAAAGG - Intergenic
1078230000 11:9432233-9432255 CACTCCTGCCTAGGCAACAAAGG - Intronic
1080413786 11:32050952-32050974 CCCTACTGCCAACGGCACAATGG - Intronic
1082309706 11:50631814-50631836 CCCTTCTGCCAGAGGAACAATGG + Intergenic
1082883464 11:58060467-58060489 CCCTCCTGCCTAAGGAAAGCTGG + Intronic
1083418730 11:62541830-62541852 CCCTTGTTCCAAAGGAACAAGGG + Intronic
1084309695 11:68309754-68309776 GGCTCCAGCCACAGGAACAAAGG - Intergenic
1084379359 11:68801272-68801294 CCATCCTGCCAGTGGAACAGGGG + Intronic
1085923127 11:80982310-80982332 CCCGCCTGCAAAAGGATCAAGGG + Intergenic
1086281314 11:85192851-85192873 CCATGCTGCCACAGGAACATGGG - Intronic
1088212574 11:107473003-107473025 ATCTCCTGCCAAGGGACCAAAGG + Intergenic
1089362105 11:117897855-117897877 CACTCCTGCCAATGGGACATGGG - Intergenic
1089728492 11:120504147-120504169 ACCTCCTGCCAGAGGAAGGATGG - Intergenic
1090462174 11:126901377-126901399 CCCTGCTCCCCAAGGAAGAAGGG - Intronic
1091313395 11:134592626-134592648 CCCTCTTGCCACAGGAAAATGGG + Intergenic
1092216752 12:6689020-6689042 CCCGCCTGCCCAAGGAAAAGGGG + Intronic
1093743117 12:22710822-22710844 CCTTCCTGGCAGAGGCACAAAGG - Intergenic
1097601630 12:61699684-61699706 CTCCCCTGCCTAAGGAACGATGG - Intergenic
1101740733 12:107497933-107497955 CCCTCCTGACATGGGAAAAAAGG - Intronic
1101747957 12:107558515-107558537 CCCTGCTGTCAAAGGATCAAAGG - Intronic
1102261543 12:111446242-111446264 TCCTGCTGGCAAAGGAACAGTGG + Intronic
1102351350 12:112194453-112194475 CCCTCATGCCAAGGGCACACAGG + Intronic
1103612600 12:122133330-122133352 CTCTCCTGAAAAAGGAAGAAAGG - Exonic
1103841577 12:123869563-123869585 CCCTGCTTCAACAGGAACAACGG + Intronic
1104064545 12:125296313-125296335 CACTCCTGGCAAGGGAACAACGG - Intronic
1105303014 13:19152055-19152077 CCCTCCTGCAAAAGGGCCAGAGG - Intergenic
1105810208 13:23988798-23988820 CCCGACTGACAAATGAACAAAGG - Intronic
1106074112 13:26442526-26442548 CCCTCCTGCCACTGTCACAAGGG + Intergenic
1106616679 13:31336495-31336517 CTCTCCTGCCAAATGCAGAAAGG - Intergenic
1106927877 13:34632084-34632106 CCCTCTTGCTAAAGGAAAAGGGG + Intergenic
1108185381 13:47883536-47883558 GGATCATGCCAAAGGAACAAAGG - Intergenic
1109264060 13:60176473-60176495 CCATGCTGGCAAAGGAAGAAAGG + Intergenic
1111889268 13:94061486-94061508 TGCTCCTGCCCAAGGAGCAAAGG + Intronic
1113118468 13:106900219-106900241 CCCTCCTTACAAGGGAACACAGG + Intergenic
1113784575 13:112995709-112995731 CCCTCCTTCCACAGGAACGGGGG + Intronic
1117055969 14:51912299-51912321 CAGTCCTGCCTAAGGTACAAGGG - Intronic
1117340259 14:54785993-54786015 ACCTCCTGCCAGAGGTACCAGGG - Intronic
1119049206 14:71349730-71349752 TCCTGCTGCCGGAGGAACAAAGG + Intronic
1121176183 14:91892364-91892386 CCCTGGTTCCAAAGGAACAGGGG - Intronic
1121296980 14:92835250-92835272 TCCTCCTCACATAGGAACAAAGG + Intronic
1122182992 14:99969464-99969486 CCCACCTGCCAGAGGAGGAATGG + Intergenic
1123878686 15:24652870-24652892 GCCTCCAGGAAAAGGAACAATGG + Intergenic
1125289354 15:38128780-38128802 CCCTCATACTAAAGGAAGAAAGG + Intergenic
1127234828 15:57037826-57037848 CCTTCCTGAAAAAGGAACACTGG - Intronic
1127704755 15:61535739-61535761 CCGCCCTGCCTGAGGAACAATGG - Intergenic
1128397539 15:67243469-67243491 CAATCCTGCCAAGGGGACAAAGG + Intronic
1129442893 15:75594688-75594710 CCCTCCTGCCAAGGCAAGCAAGG - Intergenic
1129719208 15:77868963-77868985 CCTTCCTGCCTAAGGGACAGTGG + Intergenic
1130459718 15:84151898-84151920 CCTTCCTGCCTAAGGGACAGTGG - Intergenic
1135601481 16:23787560-23787582 CCCTCCTGTCAATGGAAGAAGGG - Intergenic
1135690788 16:24535961-24535983 CACTCCAGCCTAAGCAACAAAGG - Intergenic
1136084369 16:27874117-27874139 CCCTCCTGAAACAGGGACAAGGG - Intronic
1136597551 16:31262002-31262024 CCCTCCTGGGAAGGGAACTAGGG - Intronic
1137408843 16:48210996-48211018 CCCTCGGGCCAGAGGAAGAAGGG - Exonic
1137796633 16:51225731-51225753 CACACCTGCCACAGGGACAATGG - Intergenic
1140137797 16:72223166-72223188 CCATCCTGCACAAGGAAGAAAGG + Intergenic
1146054664 17:29575070-29575092 CCCTCTTCCCAAAGGTACAGGGG - Exonic
1146525818 17:33566125-33566147 CCCTCCTGACAAAAGGACAGAGG - Intronic
1151431472 17:74066383-74066405 CCTTCCAGCCAAAGGCAGAAAGG + Intergenic
1152735898 17:81996635-81996657 CCCACCCGAGAAAGGAACAAAGG - Exonic
1153056536 18:951112-951134 CCCTTCTGCCAGAGGAAACAGGG - Intergenic
1153092924 18:1369083-1369105 CCCTCATGCTAGAGGGACAATGG - Intergenic
1155114945 18:22754750-22754772 CTCTCCTGCCAAAAGAAGGAGGG + Intergenic
1156485103 18:37460365-37460387 ACCTCCTGGAAAAGAAACAAGGG - Intronic
1156689177 18:39685430-39685452 TCCCCCTGCCCAAGTAACAAAGG + Intergenic
1156716760 18:40021661-40021683 CCCTTCTGCAGAAAGAACAAGGG - Intergenic
1159828870 18:73249226-73249248 CTCTCTTGCCAAAGGGCCAAAGG + Intronic
1160693094 19:469123-469145 CCCTCCTGCCAGTCTAACAAAGG - Intronic
1161331817 19:3692227-3692249 TCCTCCTGCCAACAGCACAATGG + Intronic
1162438926 19:10680793-10680815 CCCCCCTTCCAAAGGAATACAGG - Intronic
1162533003 19:11246641-11246663 CCCCCATGCCAACGGAACAAGGG - Intronic
1162872623 19:13598013-13598035 CTCTCCTGCAAATGGAAAAATGG + Intronic
1164783973 19:30914688-30914710 CCATCCTGCCGAAGGAACAAAGG + Intergenic
1165383834 19:35498893-35498915 CCCCCCTGCAAAAAGATCAAAGG + Exonic
1165473040 19:36014380-36014402 CCCTCCTGCCAATGGCTCAGAGG - Intergenic
1166373703 19:42315676-42315698 CCCTCCTCCCCCAGGAACCAGGG - Intronic
1167793062 19:51692563-51692585 CCCTCCTCCCCAAGGAACCCAGG - Intergenic
934717678 2:96552916-96552938 CCCTCCTGCCAGGGGAACCTGGG - Intergenic
939255342 2:139736962-139736984 CCCTCCTGCCAGAAGCACAAGGG + Intergenic
939846768 2:147256012-147256034 CACTCCTGCCAAATTAACACCGG + Intergenic
940069332 2:149667684-149667706 ACCTCTTGCAAAAGGAACAAAGG + Intergenic
940923568 2:159338169-159338191 CCCTGCAGTCAAAGGAAAAATGG - Intronic
947694378 2:232171604-232171626 CCCTCCAGCTAAGGGAAGAAGGG - Intronic
1168959662 20:1860234-1860256 CCATTTTGCCAAAGAAACAAAGG + Intergenic
1169843375 20:9963690-9963712 TCCTTCTGCAAAGGGAACAATGG + Intergenic
1170080864 20:12473336-12473358 TCCTCCTTTAAAAGGAACAAGGG - Intergenic
1172450095 20:35015905-35015927 CTCTACTCCCAAAGGAAAAAAGG + Intronic
1172533655 20:35653411-35653433 TCCCCCTGCCCAAGGAAAAAAGG - Exonic
1172749252 20:37238384-37238406 CGATCCTGCCAAAGGAAAGAGGG - Intronic
1172982852 20:38957582-38957604 CCCTCAGGCCAAAGAAACAGAGG + Intergenic
1173485766 20:43439827-43439849 CCCTCAAGCCAGAGGAACTAAGG + Intergenic
1173534300 20:43797686-43797708 CCCTTCTGACAATGGAACAGAGG - Intergenic
1174369176 20:50074803-50074825 CCCACCTGCAAGAGGGACAAAGG + Intergenic
1176369036 21:6051673-6051695 CCCTCCTGCCAAGGGTCCAGGGG - Intergenic
1177872311 21:26588774-26588796 CACTCCAGCCAAAGAAATAAAGG - Intergenic
1179640703 21:42745682-42745704 CCCTCCTGCCAAAGCAGCCATGG - Intronic
1179754483 21:43486868-43486890 CCCTCCTGCCAAGGGTCCAGGGG + Intergenic
1179836723 21:44039476-44039498 GCCTGCTGCCAGAGGAACCAGGG - Intronic
1181021703 22:20106922-20106944 TCCTCCTGCCACAGGGACAAGGG - Intronic
1181330492 22:22087064-22087086 CCCTCCTGGGAAAGGAGGAAGGG - Intergenic
1181363803 22:22358302-22358324 CCCTCCTGACAGAGGAGGAAGGG - Intergenic
1181366613 22:22381387-22381409 CCCTCCTGACAGAGGAGGAAGGG - Intergenic
1183426215 22:37740847-37740869 CCATCCTGCCAAAGGGACCTGGG + Intronic
1184241834 22:43215116-43215138 TCCTCCTCTCAAAGGAACCAGGG + Intronic
1184806303 22:46796834-46796856 CCCTCATCCCAAGGAAACAAAGG - Intronic
951407434 3:22317632-22317654 CCCTCCTCCCCTAGGAATAAGGG + Intronic
951753023 3:26057975-26057997 TTCTTCTGCCAAAGGAAGAAGGG - Intergenic
953179390 3:40582178-40582200 CCCTTCTGTCAAAGGGCCAAAGG + Intergenic
953180430 3:40589686-40589708 ACCTCCTGCCAAGGGAGCCAGGG - Intergenic
953249905 3:41235706-41235728 CCCTCCTGCCAAAAGAAACATGG - Exonic
954160309 3:48716965-48716987 CCCTCCTCCCAAATGACCCAGGG + Intronic
954947461 3:54439129-54439151 CCCAACTGCCATAGGATCAATGG - Intronic
958858882 3:99420831-99420853 CCCTTGTGCCAAAGCTACAAGGG + Intergenic
960464362 3:117978225-117978247 AACTCCTTCCAAATGAACAAAGG - Intergenic
964524725 3:157606408-157606430 CCCCACTGCCAGGGGAACAAGGG + Intronic
967885534 3:194331121-194331143 CTTTCCTGCCCAAGGGACAAGGG - Intergenic
967903604 3:194483174-194483196 CCTTCCTGCCTCAGCAACAAGGG - Intronic
969867846 4:10087016-10087038 CCCCCCAGCCAATGGAACACAGG + Intronic
970976898 4:22052267-22052289 CACTCCTGCCATATGAACCATGG + Intergenic
972970455 4:44568541-44568563 CCTTGCTTCCAAAAGAACAACGG + Intergenic
973267153 4:48222021-48222043 CCCTCCTGGCAAAAGTAGAATGG - Intronic
979381486 4:120011664-120011686 TGCTCCTGCCACAGGAACCAGGG - Intergenic
982494453 4:156073526-156073548 CCCTCCTGCTCACTGAACAATGG - Intergenic
982970293 4:161976205-161976227 CCTTTCTGCCAAAGGAAAGAAGG - Intronic
983320369 4:166189497-166189519 CCCTCCTGCTCACTGAACAATGG - Intergenic
983456596 4:167972607-167972629 CCCTCCTGCTAATCAAACAATGG + Intergenic
989322987 5:40158889-40158911 CTCTCCTGCCAAAGTAAGAGAGG + Intergenic
990516898 5:56538841-56538863 CCCTCCTGGCAGAAAAACAATGG + Intronic
996030744 5:118701969-118701991 CCCTCCTTCCAAAGGAATGCTGG - Intergenic
997388733 5:133496475-133496497 CCCTCCCACCAAAGGAATCAGGG + Intronic
997558072 5:134818949-134818971 CCCTCCTGGCAAAGAACCCAAGG + Exonic
998123301 5:139597233-139597255 CCCTCCAGCCACTGGAACCATGG + Intronic
1001096254 5:168777834-168777856 CCTTCCTCCCAAAGGAAAGAGGG - Intronic
1001592916 5:172878636-172878658 CCCTCTGTCCAAAGGAAAAAAGG - Intronic
1002322405 5:178383571-178383593 CCCACCTCCCCAAGAAACAACGG - Intronic
1002877721 6:1226332-1226354 GCCTCCTGCCAGAGGAGCAGAGG + Intergenic
1002907474 6:1462425-1462447 CCCTGCATCCACAGGAACAAAGG - Intergenic
1003795850 6:9602180-9602202 CCCTCCTGAAATATGAACAAAGG - Intronic
1004429546 6:15531320-15531342 CCTTCCTCCCAAAGGAGCCATGG + Intronic
1005567759 6:27113800-27113822 GACTCCTGCCAAAAGAACATGGG + Intergenic
1009058689 6:58371543-58371565 CCCTCGTGCCAAAGACAGAAAGG + Intergenic
1009232148 6:61075574-61075596 CCCTCGTGCCAAAGACAGAAAGG - Intergenic
1010252531 6:73722850-73722872 CCCTCGTGATAAAGGAAGAAAGG - Intronic
1015174947 6:130296418-130296440 CCCTCATGACAAAGGAAATAAGG + Intronic
1016301465 6:142636345-142636367 CACTCCTGCCACAGGCCCAAGGG - Intergenic
1017772198 6:157652026-157652048 CCCTCCCTTCAAAGGTACAAAGG - Intronic
1018555261 6:165042924-165042946 CCCTGCAGACAAAGGAACTATGG - Intergenic
1020580135 7:9987478-9987500 CTCCTCTGCTAAAGGAACAAAGG + Intergenic
1022407845 7:30108801-30108823 CCCTCCTGCCAAAGGAACAAAGG - Intronic
1023124928 7:36946007-36946029 CTCTCCTGCCAAAGGAGGATGGG + Intronic
1024826616 7:53397853-53397875 CCCACCTGACAAAGGACTAATGG - Intergenic
1024883479 7:54115512-54115534 ACCTCCTCCCAATGGGACAAAGG - Intergenic
1025015157 7:55433465-55433487 CCCTCCAGGCAAAGGAGAAACGG + Exonic
1028117245 7:87012780-87012802 ACCTTCTGCCAAAGGACCCATGG - Intronic
1030066707 7:105665076-105665098 CTTTCCTGCGAAAGGATCAAGGG - Exonic
1030302033 7:107984094-107984116 TCTTACTGTCAAAGGAACAAGGG - Intronic
1032000973 7:128265162-128265184 CCCTCCTGTCATGGGAAGAAGGG + Intergenic
1032898016 7:136273892-136273914 CCCACCTGCCAAAGGGATGAAGG - Intergenic
1033771350 7:144556058-144556080 CCCTCCAGCCTGGGGAACAAGGG + Intronic
1035771182 8:2148134-2148156 CCCTCCAGTAAAAGGAACCAGGG - Intronic
1037816461 8:22115202-22115224 CCCTCCTGCCAAAAGATCTGGGG - Exonic
1041240269 8:55843089-55843111 TCCTCATTCCAAAGGAATAAGGG + Intergenic
1042192869 8:66205698-66205720 GCCTGCTGCCACTGGAACAAGGG - Intergenic
1045548974 8:103153177-103153199 TCCTCTTGGCAAAGGAAAAATGG + Intronic
1046563670 8:115871027-115871049 CTCTCTTGCCAAAAGAAGAATGG + Intergenic
1047264562 8:123293951-123293973 CCCTAAGCCCAAAGGAACAAGGG - Intergenic
1047680337 8:127248053-127248075 CCCTCCTGCCAATGGCAGTATGG + Intergenic
1048544680 8:135375809-135375831 CCCTCCTGGTAAAAGAACCAGGG - Intergenic
1050139316 9:2501164-2501186 CTTTCCTGCCAAAGGAAATAGGG + Intergenic
1050283566 9:4077917-4077939 CCCTCTTGAGATAGGAACAAAGG - Intronic
1051001836 9:12291423-12291445 CCCTCATGCCAAAAGGAAAAGGG + Intergenic
1052332114 9:27280856-27280878 CCCTACTGCCAAAGGAACCTAGG - Intergenic
1055079924 9:72258765-72258787 CCCTGCTGCCAAAGGAAGCTTGG + Intergenic
1055139013 9:72854311-72854333 GCCTACTGCAAAAGGAACCATGG + Intergenic
1055397952 9:75892882-75892904 CCCTCCTGCCCCTGGAACTAAGG + Intronic
1058720629 9:107760585-107760607 CCTTCCTGCCTGAGGAACTATGG + Intergenic
1059944092 9:119389041-119389063 CATTTCTTCCAAAGGAACAAAGG + Intergenic
1062094739 9:134697267-134697289 CTCTCCTGGCAAAATAACAATGG - Intronic
1062163357 9:135092333-135092355 CCTTCTTGCCCAAGAAACAAGGG - Intronic
1062553088 9:137099354-137099376 GCCTCTGGCCAAAGGGACAAGGG - Intronic
1203785689 EBV:126240-126262 CCCTCCTGCGAAGGGAAGATGGG + Intergenic
1187996663 X:24934314-24934336 TCCTCATGTCAGAGGAACAAAGG + Intronic
1189609682 X:42718929-42718951 ACCTCCTGTCTAAGGAACAGCGG + Intergenic
1193885563 X:86981593-86981615 CCCTCCTGTCAAAGGCCCAAAGG - Intergenic
1196124674 X:112084618-112084640 CCCTCATGCCAAAGGGAAGACGG - Intergenic
1198568463 X:137930423-137930445 CCCTCCTGCCAGAGAAAACAGGG - Intergenic
1202264343 Y:23002262-23002284 CCCTCCTGCAAAAAGAATACTGG + Intronic
1202379520 Y:24263262-24263284 CCTTCCTGCCTAAGGGACAGTGG + Intergenic
1202417334 Y:24636004-24636026 CCCTCCTGCAAAAAGAATACTGG + Intronic
1202453452 Y:25034082-25034104 CCCTCCTGCAAAAAGAATACTGG - Intronic
1202491262 Y:25406859-25406881 CCTTCCTGCCTAAGGGACAGTGG - Intergenic