ID: 1022407848

View in Genome Browser
Species Human (GRCh38)
Location 7:30108809-30108831
Sequence GCCACAGACCCTCCTGCCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 196}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022407848_1022407851 1 Left 1022407848 7:30108809-30108831 CCTTTGGCAGGAGGGTCTGTGGC 0: 1
1: 0
2: 2
3: 21
4: 196
Right 1022407851 7:30108833-30108855 TTCCACAGCACCCCAGGTGTGGG 0: 1
1: 0
2: 1
3: 17
4: 173
1022407848_1022407852 2 Left 1022407848 7:30108809-30108831 CCTTTGGCAGGAGGGTCTGTGGC 0: 1
1: 0
2: 2
3: 21
4: 196
Right 1022407852 7:30108834-30108856 TCCACAGCACCCCAGGTGTGGGG No data
1022407848_1022407849 -5 Left 1022407848 7:30108809-30108831 CCTTTGGCAGGAGGGTCTGTGGC 0: 1
1: 0
2: 2
3: 21
4: 196
Right 1022407849 7:30108827-30108849 GTGGCTTTCCACAGCACCCCAGG No data
1022407848_1022407850 0 Left 1022407848 7:30108809-30108831 CCTTTGGCAGGAGGGTCTGTGGC 0: 1
1: 0
2: 2
3: 21
4: 196
Right 1022407850 7:30108832-30108854 TTTCCACAGCACCCCAGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022407848 Original CRISPR GCCACAGACCCTCCTGCCAA AGG (reversed) Intronic
900538694 1:3191961-3191983 GCCATTGCCCCTCCTGCCATCGG - Intronic
901439883 1:9271513-9271535 CCCACAGACCCTCTTGCAAACGG - Intergenic
901926254 1:12568008-12568030 GGGACAGACCCTCCTGGAAATGG + Exonic
902160476 1:14526310-14526332 GCCCCAGACTCTGCTGCAAAGGG - Intergenic
902926620 1:19700230-19700252 GTGACAGACCCTCCAGCCAGAGG - Intronic
904112016 1:28133540-28133562 GCCACCCACCTCCCTGCCAAAGG + Intergenic
905180721 1:36164542-36164564 TCCACACTCCCTCCTGCCACAGG - Intronic
905857116 1:41321492-41321514 ACCACAGACACCCCTGGCAAAGG - Intergenic
909305520 1:74070935-74070957 GCCACGGACCACCCTGCTAAAGG - Intronic
916422343 1:164648712-164648734 GCCAAACGCCCTCCCGCCAAGGG - Intronic
918210066 1:182342579-182342601 CTGACAGACCCTCCTGTCAATGG - Intergenic
919738424 1:200968113-200968135 GGCACAGAGCCTCCTGCCCCAGG - Intergenic
922425138 1:225485318-225485340 GCCACAGGCTCTCATGGCAAAGG - Intergenic
922770134 1:228177183-228177205 GGCACAGACCCTCATTCCAGGGG - Exonic
923686100 1:236154833-236154855 GCCCGGGACCCTCCTGCCATAGG + Intronic
923776480 1:236983238-236983260 GCCACAAATCCTCCTGCAACAGG - Intergenic
924558127 1:245134631-245134653 TCCACACAGCCTCCTGCCCAGGG + Intergenic
1062843491 10:688783-688805 GCCACAAACCCTCCTACGAGAGG + Intronic
1062843953 10:690312-690334 GACACTGACCCTCCAGGCAAAGG - Intergenic
1062862631 10:822444-822466 GACACAGACCTGCCTGCCATGGG + Intronic
1063809736 10:9691298-9691320 GCCAAAGACCCCCCTGCACAGGG - Intergenic
1066043174 10:31572871-31572893 GCCAAAGACCCACCTGATAAAGG + Intergenic
1067311942 10:45121820-45121842 GCCACCTACCCTCAGGCCAAAGG + Intergenic
1067568033 10:47352101-47352123 GTCTCAGACCCTCCTTGCAAGGG - Intronic
1069757861 10:70784757-70784779 GCCCCAAATCCTCCTGCCTATGG + Exonic
1070599141 10:77853653-77853675 GCTACAGACCTACCTGCCATTGG - Intronic
1074860508 10:117506533-117506555 CCCACAGGCACCCCTGCCAATGG - Intergenic
1075094574 10:119462373-119462395 GCCACTGATCTTCCTGCCGATGG + Intergenic
1075209309 10:120477699-120477721 GCCAAGGCCCCTCCTCCCAAGGG - Intronic
1076405502 10:130209869-130209891 GCCACAGACCATGCGGCCTACGG - Intergenic
1076751992 10:132547863-132547885 ACCCCAGACGCTGCTGCCAAAGG - Intronic
1077217914 11:1402741-1402763 GACACAGGGTCTCCTGCCAAAGG + Intronic
1077481961 11:2819185-2819207 GCCAAAGTCCCTCCTCCCAAGGG + Intronic
1080937867 11:36882493-36882515 CCCACTGCCCCTCCTGCAAAGGG + Intergenic
1081654609 11:44849222-44849244 GACACAGTCCCTCCTGGCACGGG - Intronic
1082035840 11:47644677-47644699 GGCACAGAGCCTCTTGCCAGGGG + Intergenic
1083263953 11:61537634-61537656 GCCCCAGACCCTCCCACCATGGG + Intronic
1083938561 11:65883023-65883045 CCCACACACCCACATGCCAAGGG + Intronic
1084960972 11:72716471-72716493 TCCACAGGCCATGCTGCCAAAGG - Intronic
1085736274 11:79041961-79041983 GGCCCAGACCCTCCGGCTAAGGG - Intronic
1086402205 11:86470009-86470031 ACCTCAGACCCTCCTACCCATGG - Intronic
1089330445 11:117685530-117685552 ACCACAGACCCTCTTACCTAGGG - Intronic
1090604349 11:128405968-128405990 GCCACAGCTCCTCCCTCCAAGGG + Intergenic
1090676971 11:129007659-129007681 GTCACAAACCGTCCTGCCTAGGG + Intronic
1090958809 11:131537668-131537690 GCCAAAGCCTCTCCTGCCAAGGG - Intronic
1091288882 11:134425761-134425783 GCCACATACCCACCAGCCACTGG - Intergenic
1092295049 12:7190464-7190486 GCCTCAATCCCTCCTGCCGAAGG - Exonic
1096054540 12:48640658-48640680 GCTACAGACACTCCTAACAATGG + Intergenic
1096230721 12:49895422-49895444 CCCACAGACCCTCCTCCAGAAGG + Intronic
1096780572 12:53989572-53989594 ACCTCAGACTCTCCTTCCAAGGG + Exonic
1096863250 12:54545586-54545608 GACAGAGACCCTCCTGGTAAAGG - Exonic
1099989473 12:89708235-89708257 GCCACAGCCCATCCCGCCACCGG - Intronic
1102062560 12:109944501-109944523 GGCACAGCCCCTGCTCCCAAAGG - Intronic
1104972667 12:132539069-132539091 GCCACAGACCCACCTGCTGCCGG - Intronic
1104975869 12:132551736-132551758 GCCAAGGAGCCTCCTGCCAAGGG - Intronic
1106763357 13:32890005-32890027 GCCAAAGACACTCCTGACAGAGG - Intergenic
1107865172 13:44696282-44696304 GCCAAAGACTTTCCTGCCCAGGG + Intergenic
1108576388 13:51795171-51795193 CACCCAGACCCTCCTGCCCAAGG + Intronic
1111219035 13:85180498-85180520 GCCACAGCCCCTCCTGTTATAGG + Intergenic
1114399220 14:22394234-22394256 GCCACAGACCCTCCTGTCTTGGG + Intergenic
1118316920 14:64731223-64731245 GCCACAGTCCCTCTTCCCAGCGG - Intronic
1119768373 14:77205115-77205137 GCCACCTTCCCTCCTGCCACAGG - Intronic
1121285218 14:92729806-92729828 GCCTCAGCCCTCCCTGCCAAGGG - Intronic
1121333585 14:93063274-93063296 GACCCACACCCTCCTGCCCAGGG + Intronic
1122838739 14:104444069-104444091 GCCACAGCCCCTCCTCCCCCAGG - Intergenic
1124369724 15:29097297-29097319 GCCACAGCCCCTCCTGCCAGTGG - Intronic
1124505898 15:30273073-30273095 GACACAGACCATCATGACAAGGG + Intergenic
1124737655 15:32265559-32265581 GACACAGACCATCATGACAAGGG - Intergenic
1126267080 15:46767438-46767460 GCCACAGGGAGTCCTGCCAAGGG - Intergenic
1126800889 15:52295633-52295655 GCCCCGGCCCCTCCTGCCCATGG - Exonic
1127993667 15:64138873-64138895 CCCAAAGACGCTCCTGCCACTGG + Exonic
1128071870 15:64802284-64802306 GGCTCAGAGCCTCCTGCCACTGG + Intergenic
1128613393 15:69091210-69091232 GCCACAGGCCCTCCTTCCACAGG + Intergenic
1129794370 15:78364780-78364802 GCAACATACACTCATGCCAAAGG + Intergenic
1130769628 15:86911419-86911441 GCCACAAAGCCTCTTGCCAGAGG - Intronic
1131889012 15:96952013-96952035 GGCACAGACTCTCCTGCGCAGGG - Intergenic
1132059631 15:98681588-98681610 GCAGCAGACCCTCCTGCCTGGGG + Intronic
1133054350 16:3138138-3138160 GCTGGGGACCCTCCTGCCAAAGG - Intronic
1133476681 16:6128950-6128972 GAAACAGACCCACCTGACAAAGG + Intronic
1134240658 16:12503466-12503488 GTCACAGACCCTCCTTCCCTGGG - Intronic
1135937693 16:26795221-26795243 GTCCCAGACCCTCCCGCCACTGG + Intergenic
1136395989 16:29992811-29992833 GCCACACACCCTTCTCCAAAAGG + Exonic
1142329570 16:89442766-89442788 GGCACACACCTTCCTGCCACCGG - Intronic
1142597741 17:1037718-1037740 GCCTCAGCCCCTCCTGCCTCAGG - Intronic
1142867585 17:2800020-2800042 CCCAGGGACCCTCCTGCCCAAGG - Intronic
1143099749 17:4498714-4498736 GGCAGAGCCCCTCCTGCCAATGG - Intergenic
1143296251 17:5874166-5874188 GCAGCAGACCCTCCAGCCACAGG + Intronic
1144783147 17:17817753-17817775 GCCACTGCCCCTGCTGCCAAGGG + Exonic
1145909619 17:28534905-28534927 GGCACACACCCTCCTGCTATGGG + Exonic
1146176048 17:30667388-30667410 GCCACGGAGCCGCCTGCCACCGG + Intergenic
1146349506 17:32083498-32083520 GCCACGGAGCCGCCTGCCACCGG + Intergenic
1149422183 17:56521580-56521602 TCCACAGACCAGCCTGCCAGGGG + Intergenic
1151327114 17:73386266-73386288 GCCAGAGACACTTTTGCCAAGGG - Intronic
1151660095 17:75514472-75514494 GCCAGGGCCCCTCCTGCCCAAGG - Intronic
1152071013 17:78133620-78133642 GCCATGGGCCTTCCTGCCAATGG - Intronic
1152515028 17:80818020-80818042 GAGATAAACCCTCCTGCCAATGG + Intronic
1152730457 17:81967332-81967354 GCCACAGCAGCTCCTGACAAGGG - Intergenic
1155833849 18:30553526-30553548 ACCCCAGACCCACCTCCCAACGG + Intergenic
1157239382 18:45995619-45995641 CCCACTGGCCCTCATGCCAAGGG + Intronic
1157831113 18:50857825-50857847 GCCACTGTCCCTTCTGCCCAAGG + Intergenic
1158768382 18:60484552-60484574 GCCAGAGAGCCTCCCACCAATGG + Intergenic
1159365764 18:67464240-67464262 GGCACAAACACTACTGCCAAGGG + Intergenic
1160007304 18:75076821-75076843 GCCACAGCCCCTCCTGGCAGGGG + Intergenic
1162105791 19:8368910-8368932 ACCACACACCGTCCTGCCACAGG - Intronic
1162139526 19:8577469-8577491 GCCTCGGCCCCTCCCGCCAAAGG - Exonic
1162384560 19:10353347-10353369 GCCACACCCCCTCCTCCCAAGGG - Intronic
1162791543 19:13065592-13065614 GACAAAGGCCCACCTGCCAATGG - Intronic
1162982776 19:14249514-14249536 GCCACGGAGCCGCCTGCCACCGG - Intergenic
1163667146 19:18608531-18608553 GCCATAGTCCCACCTGCCAGGGG + Intronic
1165879177 19:39031075-39031097 GCCACAGACCCTCCTCCTCTAGG + Exonic
1166682903 19:44778918-44778940 GCCCCAGCCCCTCCTTCCTAAGG + Intronic
1166719689 19:44989957-44989979 GCCACAGATCTTCCTTCCCAGGG + Intronic
1167984912 19:53306651-53306673 GCCACTGAGCTTCCTGCCATGGG - Intergenic
925209427 2:2033838-2033860 ACCACAGAAGCTCCTGACAAGGG - Intronic
926238851 2:11069615-11069637 GCCACAGACCCTTCAGGGAAAGG - Intergenic
927081964 2:19639404-19639426 GCCACAGATCCCCTTGCCTATGG - Intergenic
927886331 2:26721032-26721054 ACCCGAGGCCCTCCTGCCAAGGG + Intronic
928528510 2:32166027-32166049 GAGACAGCCGCTCCTGCCAAGGG - Intronic
930034218 2:47075620-47075642 GCAACAGCCCCTCCTGTCCAGGG - Exonic
932447775 2:71791310-71791332 TACACAGACCTTCCTCCCAAGGG + Intergenic
933180096 2:79217185-79217207 GCCTCAGACCCACCAGCCCAAGG - Intronic
937098400 2:119250499-119250521 CCCGCAGAGCCTCCTGCCAAGGG - Intronic
939456704 2:142446390-142446412 GCCACAGACCCAGCTCCCAGTGG + Intergenic
940088525 2:149889851-149889873 GCAAGAAACCCTCCTGCCACAGG - Intergenic
940754223 2:157663377-157663399 GAAACAGTCCCTGCTGCCAATGG + Intergenic
942172270 2:173299899-173299921 GCCCCAGGACCTCCTTCCAAAGG + Intergenic
948928010 2:241111772-241111794 GCGACAGCCCCTCCAGCCAAGGG + Intronic
1169230913 20:3888646-3888668 GCTCCAGACTCTCCTGCAAAAGG + Intergenic
1169689788 20:8317403-8317425 GGCACAGCCCCTCCTACCATGGG - Intronic
1173567785 20:44054242-44054264 GCCCAAGGGCCTCCTGCCAAAGG - Intronic
1174342393 20:49906119-49906141 GCCGCAGAGCATCCTGCCGACGG + Exonic
1175291152 20:57876281-57876303 GCCACCCACCCTTCTGCTAAAGG - Intergenic
1175812079 20:61863844-61863866 GCCACAGAGGCTCCTGCGGATGG + Intronic
1176160157 20:63643623-63643645 GCCACAGCCCCTCCTGCTCCAGG + Intronic
1176955570 21:15099140-15099162 GGCACAGTCTCTTCTGCCAAAGG - Intergenic
1180625420 22:17190744-17190766 CCCTCACACCCTCCTGCCACTGG + Intronic
1180932989 22:19606044-19606066 CCCAGAGACCCACCTGCCCAGGG + Intergenic
1181770856 22:25124334-25124356 GCTTCAGACCCTCCTTCCAAGGG - Intronic
1185128222 22:49023432-49023454 GCCACAGCCCCCTCTGCCATGGG + Intergenic
1185298383 22:50065722-50065744 TCCACCTTCCCTCCTGCCAATGG - Intronic
1185325215 22:50222168-50222190 GCCACAGCCCCTACCGCCCATGG + Intronic
949539119 3:5018455-5018477 GGCACAGGCCCACCAGCCAAGGG - Intergenic
949907394 3:8870087-8870109 GGCAGAGTCCCTCCTGCCACAGG + Intronic
950328368 3:12135136-12135158 GCCACAGACTCTACTGGCACAGG - Intronic
950448984 3:13055078-13055100 GCCACAGACCGCCCTGCCTGCGG + Intronic
950547035 3:13644425-13644447 GCCTCAGAGCCTCCTCCAAAGGG - Intergenic
951409360 3:22343518-22343540 GCCACGGACACTGCTGCCACTGG - Intronic
951705784 3:25543101-25543123 GCCACTAAACCTCCTGCCAAGGG + Intronic
953589432 3:44237388-44237410 GCCATAGACCCTCATTCCAGAGG - Intergenic
953912247 3:46899021-46899043 GCCGCCGACCCTGCTGCCAAGGG + Intronic
953917065 3:46926945-46926967 GCCACAGACACCCCTGCCTCTGG - Intronic
953927081 3:46988029-46988051 GCCACTGCCCCTCTTGCCCATGG + Intronic
954108193 3:48420223-48420245 TCCCCAGACCCTCCTGCAAGAGG - Exonic
954616572 3:51971727-51971749 GCCACAGAACACCCTGCCCAGGG + Intronic
956650986 3:71504608-71504630 GCCACAGTTCCTTCTGACAAAGG + Intronic
959672496 3:108995259-108995281 GACACTGATCCTCCTGACAAAGG + Intronic
960907501 3:122616169-122616191 GCAACAGAACCACCTGCCACGGG - Intronic
962192639 3:133327537-133327559 CCCTCAGGCCCTCCTGCCAATGG - Intronic
968006438 3:195246368-195246390 GCCAAAGACCCTCTTGCCATTGG - Intronic
968288093 3:197519847-197519869 GCCACAGAGCCATCTGCCACCGG - Intronic
968538346 4:1149280-1149302 GCCCCACACCCTAGTGCCAAGGG - Intergenic
969045116 4:4331016-4331038 GCAGCAGACCCACCTGCCCAGGG + Intergenic
969621648 4:8281737-8281759 GCCACAGCCCCTACTGCTGACGG + Intronic
969901489 4:10354599-10354621 GCCACAGCAAGTCCTGCCAAAGG - Intergenic
971474274 4:27057588-27057610 GCCACAAACCCACATTCCAATGG - Intergenic
973771482 4:54211173-54211195 TCCACACTCCCTCCTTCCAAGGG - Intronic
975724003 4:77274688-77274710 GCCACAGTCACTCCTGTCAGAGG - Intronic
976184311 4:82429822-82429844 GCCACAGTCCCTCTTGCCTTGGG + Exonic
985642143 5:1068700-1068722 GCCCCAGACCCCCCAGCCGAAGG + Intronic
992203802 5:74410048-74410070 TCCCCAGGCCCTCCTGCCTATGG - Intergenic
995481209 5:112595022-112595044 GCCACACACCCCCTTCCCAAGGG + Intergenic
998097436 5:139404138-139404160 GCCACAGAGCACCCTGGCAACGG + Intergenic
998404462 5:141866293-141866315 GCCACAGAGCCTGCTGGCAGTGG + Intronic
999083777 5:148868797-148868819 GGCTCAGACTCTCCTGCCAAAGG + Intergenic
1000480227 5:161764261-161764283 ATCACAGAACCTCCTTCCAAGGG - Intergenic
1001011670 5:168104478-168104500 GACTCAGGCCCTCCTGCCAGGGG + Intronic
1001542036 5:172546347-172546369 GCCAGATACACTCCTGCCACAGG - Intergenic
1018661235 6:166089053-166089075 ACCACAGAGCCACCTGCCTAGGG + Intergenic
1019120460 6:169799878-169799900 GCCACAGACACTCTTGCTGATGG - Intergenic
1019218074 6:170456323-170456345 ACAACAGACCCTCCTGGGAATGG + Intergenic
1019592786 7:1844164-1844186 GCCACAGAACGGCCTGCCAGGGG + Intronic
1020152721 7:5696014-5696036 GCCACAGCCCCTCCTTCAAGTGG - Intronic
1021997120 7:26190448-26190470 GCAAGACACCTTCCTGCCAAAGG + Exonic
1022407848 7:30108809-30108831 GCCACAGACCCTCCTGCCAAAGG - Intronic
1023758087 7:43439041-43439063 GCCACTAACTCTCCAGCCAAAGG + Intronic
1026403141 7:70036676-70036698 GCCACAGACCCACAGGCCCAAGG - Intronic
1029519202 7:101049396-101049418 GCCACAGACCCTCTTCCCAAGGG - Intronic
1033600593 7:142885856-142885878 GCCACAGACCTGCCTACCAAGGG + Intergenic
1033742380 7:144284844-144284866 GCCACAGAGTCTCCCGCCTACGG - Intergenic
1033751522 7:144364770-144364792 GCCACAGAGTCTCCCGCCTACGG + Exonic
1034423340 7:151000476-151000498 GCCACACACCCTTCTGCCCCAGG + Exonic
1034456484 7:151173795-151173817 GCCCCAGATCCCCGTGCCAAGGG + Intronic
1034458769 7:151186698-151186720 GGCAGAGACCTTCCAGCCAATGG + Intronic
1034840115 7:154387700-154387722 CCCACAGCCCCTGCTGCCAAAGG + Intronic
1035675377 8:1452169-1452191 GCCACAGAACATCCAGCCACGGG - Intergenic
1037390055 8:18383897-18383919 GCCAGAGACCCTGCTGCTCATGG + Intergenic
1039166104 8:34681702-34681724 GTCACACACCCATCTGCCAACGG + Intergenic
1042323600 8:67504654-67504676 GCCACACATCCTCATGCCCAGGG + Intronic
1044332796 8:90941291-90941313 GCCACAGGGCGTACTGCCAAGGG - Intronic
1047291810 8:123538340-123538362 TCCACAGACCATTCTGCAAACGG - Intronic
1047878334 8:129165521-129165543 GCCACATACCCCATTGCCAAGGG - Intergenic
1047907052 8:129483378-129483400 GCCACAGATCCTCATGCCTCTGG + Intergenic
1049494477 8:142923341-142923363 GCCACGGCCCCTCCTGCCGTTGG - Intergenic
1050530586 9:6585534-6585556 GCCACATACCCTCTTCCCAAAGG + Intronic
1051106643 9:13587915-13587937 GCCCCACACCCTCCAGCCAGTGG + Intergenic
1056949891 9:91033594-91033616 GCCACACACACTCAGGCCAAGGG - Intergenic
1057482987 9:95460399-95460421 CCCACAAGCCCTCCTGCCGAGGG - Intronic
1059260563 9:112972079-112972101 TTCACAGACCTTCCTCCCAAAGG - Intergenic
1060479148 9:124007895-124007917 GCCCCAGACCCGCCTGCCTGGGG - Intronic
1060858393 9:126933880-126933902 GACACAAACTCTCCTGCCACAGG - Intronic
1062530027 9:136995710-136995732 GTCACTGCCCCTCCTGCCAGCGG - Exonic
1185580562 X:1208614-1208636 GCCCCAAACCTTCTTGCCAAGGG - Intronic
1186315908 X:8370035-8370057 TCCACAGGCCCACATGCCAATGG - Intergenic
1190493857 X:51008538-51008560 GACCCAAACCCTCCTGCCAGGGG + Intergenic
1190510901 X:51173492-51173514 GACCCAAACCCTCCTGCCAGGGG - Intergenic
1190597147 X:52061500-52061522 GCCACTGCCCCTCCCGCCGAGGG - Intergenic
1190611677 X:52192573-52192595 GCCACTGCCCCTCCCGCCGAGGG + Intergenic
1192991818 X:76467533-76467555 GCCACAGAAAGCCCTGCCAAAGG - Intergenic
1193885565 X:86981601-86981623 GAGGCAGACCCTCCTGTCAAAGG - Intergenic
1198095815 X:133378645-133378667 GCCACTGATCCTACTGCCTATGG + Intronic