ID: 1022407850

View in Genome Browser
Species Human (GRCh38)
Location 7:30108832-30108854
Sequence TTTCCACAGCACCCCAGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022407839_1022407850 22 Left 1022407839 7:30108787-30108809 CCAGTAGCTCCCTTCCTTTGTTC 0: 1
1: 0
2: 3
3: 19
4: 320
Right 1022407850 7:30108832-30108854 TTTCCACAGCACCCCAGGTGTGG No data
1022407848_1022407850 0 Left 1022407848 7:30108809-30108831 CCTTTGGCAGGAGGGTCTGTGGC 0: 1
1: 0
2: 2
3: 21
4: 196
Right 1022407850 7:30108832-30108854 TTTCCACAGCACCCCAGGTGTGG No data
1022407845_1022407850 8 Left 1022407845 7:30108801-30108823 CCTTTGTTCCTTTGGCAGGAGGG 0: 1
1: 0
2: 2
3: 16
4: 195
Right 1022407850 7:30108832-30108854 TTTCCACAGCACCCCAGGTGTGG No data
1022407841_1022407850 13 Left 1022407841 7:30108796-30108818 CCCTTCCTTTGTTCCTTTGGCAG 0: 1
1: 0
2: 2
3: 36
4: 437
Right 1022407850 7:30108832-30108854 TTTCCACAGCACCCCAGGTGTGG No data
1022407842_1022407850 12 Left 1022407842 7:30108797-30108819 CCTTCCTTTGTTCCTTTGGCAGG 0: 1
1: 0
2: 2
3: 23
4: 316
Right 1022407850 7:30108832-30108854 TTTCCACAGCACCCCAGGTGTGG No data
1022407838_1022407850 30 Left 1022407838 7:30108779-30108801 CCACAGAACCAGTAGCTCCCTTC 0: 1
1: 0
2: 2
3: 16
4: 185
Right 1022407850 7:30108832-30108854 TTTCCACAGCACCCCAGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022407850 Original CRISPR TTTCCACAGCACCCCAGGTG TGG Intronic
No off target data available for this crispr