ID: 1022409762

View in Genome Browser
Species Human (GRCh38)
Location 7:30130147-30130169
Sequence CTAGCTCATCCTCTAGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 115}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022409762 Original CRISPR CTAGCTCATCCTCTAGAGAG AGG (reversed) Intronic
905244755 1:36604897-36604919 CCAGCTCATGCTCGAGAGTGGGG - Intergenic
905995153 1:42375156-42375178 CCACCCCAGCCTCTAGAGAGAGG - Intergenic
907552787 1:55318541-55318563 CTAACTCAGTCTCTAGGGAGAGG + Intergenic
908609819 1:65845458-65845480 CCAGCCCATGCTGTAGAGAGAGG - Intronic
917262337 1:173183657-173183679 GTAGCTCATCCTCTGAAGAGGGG - Intergenic
917460021 1:175221678-175221700 CCAGGTCGTTCTCTAGAGAGAGG - Intergenic
919609549 1:199728034-199728056 CTACCTCAGCCTCTTGAGTGGGG + Intergenic
919987487 1:202685995-202686017 CAAGCACATCCACCAGAGAGAGG + Intronic
920071021 1:203303481-203303503 CTAACTCAGCCTCGAGAGAATGG + Intergenic
921210471 1:212892317-212892339 CAAGCTCATTCTCTTGTGAGGGG + Intronic
922375720 1:224962584-224962606 CTAGCCCAGCCTCTAGATAAGGG + Intronic
923116745 1:230947444-230947466 TGAGCTCATCCTCTAGAGCAGGG + Intronic
923977666 1:239282340-239282362 CTAGTTCAGCTTCTAGATAGGGG - Intergenic
924656930 1:245981012-245981034 CTATCTGACCCTTTAGAGAGAGG + Intronic
1064607523 10:17059369-17059391 TAAGCTGATCCTCTGGAGAGAGG + Intronic
1068095629 10:52487698-52487720 CTAGCTACTCCTCTAGAACGAGG + Intergenic
1074583198 10:114740918-114740940 CTGCCTCATCCTCCTGAGAGTGG - Intergenic
1074691208 10:116005971-116005993 AGAGCTCACCATCTAGAGAGGGG + Intergenic
1074802444 10:117014520-117014542 CTAACCCATACTCTAGAGAGAGG - Intronic
1076705379 10:132298484-132298506 CCAGCTCATCCTCAGGGGAGGGG - Intronic
1078376643 11:10800206-10800228 CTAGCTCAACCACTAGAAAGTGG - Exonic
1083304480 11:61755344-61755366 CCGGCTAATCCCCTAGAGAGAGG + Intronic
1086665834 11:89481005-89481027 CTCCCTGATCCTCTGGAGAGAGG - Intronic
1087678337 11:101188826-101188848 CTACCTCATCCTCTATATAAGGG + Intergenic
1089909922 11:122087612-122087634 CTATCACATTCTCTAGAGAAGGG + Intergenic
1092794989 12:12101459-12101481 CTAGGTCATGCTGGAGAGAGGGG + Intronic
1100814026 12:98368076-98368098 CTGGCTCACCCTCTAGGGAAGGG - Intergenic
1107801314 13:44110240-44110262 CCAGCTCCACCTCTTGAGAGAGG - Intergenic
1110253639 13:73408172-73408194 CTACCTCTTTCTGTAGAGAGAGG + Intergenic
1111577897 13:90182896-90182918 CTCCCACATCCTCTAGCGAGGGG - Intergenic
1114805060 14:25825670-25825692 CAAGCTCATCATCTATAAAGTGG - Intergenic
1117272973 14:54163793-54163815 CTAGCCCAGCCTCCAGGGAGGGG - Intergenic
1118822455 14:69354161-69354183 CTAGTCCATCCTCTGGGGAGAGG - Exonic
1119733511 14:76966197-76966219 CTTCCTCAGCCTCTAGGGAGAGG - Intergenic
1121721866 14:96115004-96115026 CAAGCTCATCCACTAGAAATGGG - Intergenic
1125700712 15:41680875-41680897 CCAGCTCAACCTCTAGGGTGGGG - Intronic
1127311044 15:57752629-57752651 CTAGCTCCTCCTGAAGACAGTGG - Intronic
1130067675 15:80618264-80618286 CTAGCTCATCCTCCACATCGTGG + Intergenic
1131956286 15:97739695-97739717 CTAGCTCATCCTCTTAGGAGCGG + Intergenic
1132566730 16:626994-627016 CTGACTCATCCCCTAGAGCGGGG - Intronic
1133241550 16:4416952-4416974 CTACCTCTTCCTGTAGAGAGGGG + Intronic
1137510060 16:49091277-49091299 CCAGCTCATTCTCAAGACAGTGG - Intergenic
1144668508 17:17118257-17118279 CCAGCACATCCTCAAAAGAGAGG - Intronic
1149376268 17:56047333-56047355 CTAGTTCATCTCCAAGAGAGGGG + Intergenic
1149454804 17:56779362-56779384 AAAGCTCATCCTCCAGAGAAAGG + Intergenic
1150283027 17:63940420-63940442 CCAGCTCCTCCTCAAGTGAGGGG + Exonic
1150352803 17:64458835-64458857 CCAGCTCATCCTCCCGAGGGTGG + Intronic
1150594988 17:66595993-66596015 CTGGCTCATCCTGTAGGGATGGG + Intronic
1152040628 17:77900300-77900322 CTCACTCTTCCTCTGGAGAGTGG - Intergenic
1152260923 17:79266691-79266713 CTGGCTCAACCTCAGGAGAGGGG + Intronic
1160887455 19:1357077-1357099 TTAACTTTTCCTCTAGAGAGAGG - Exonic
1162830463 19:13281510-13281532 CTGGATCATCCTCTAGAGTGGGG + Intronic
1163126969 19:15249537-15249559 CCTGCTCAGCTTCTAGAGAGTGG + Intronic
1165432021 19:35778312-35778334 CCAGCTCATTCTCTCCAGAGAGG - Exonic
925193198 2:1902225-1902247 CTAGTTCATACTCTAGGTAGTGG + Intronic
928944127 2:36757070-36757092 CTAACTCATCCATTCGAGAGAGG - Intronic
930416306 2:51094630-51094652 CTGGCTCATCCTCTGGATTGTGG - Intergenic
936282309 2:111152702-111152724 CTATCACATCCTCAACAGAGAGG - Intronic
938877149 2:135544173-135544195 TTAGCTAATCCTATAGCGAGAGG - Intronic
940779354 2:157916679-157916701 CTCCCTCATCCTCCAGATAGAGG - Intronic
942051153 2:172142237-172142259 CATGCTCTTCCTCCAGAGAGCGG + Intergenic
943089386 2:183356184-183356206 ATACCACCTCCTCTAGAGAGTGG + Intergenic
1170127354 20:12979157-12979179 TTAGCTTTCCCTCTAGAGAGAGG - Intergenic
1171113230 20:22502835-22502857 TTAGCTCCGCCTATAGAGAGGGG - Intergenic
1172673117 20:36648006-36648028 CCACCTCATCCTCTGGAGTGGGG + Intergenic
1172760610 20:37318612-37318634 CTGGTTCCTCCTCTTGAGAGGGG + Intergenic
1174083998 20:47992137-47992159 CTTCCTCCTCCTCCAGAGAGGGG - Intergenic
1176587904 21:8607556-8607578 AAAGCTCATGCTTTAGAGAGAGG + Intergenic
1177063680 21:16402777-16402799 CTAATTCATCCTCTAGACAAGGG - Intergenic
1177894862 21:26845872-26845894 CTAGCTCATCTCCTAGATTGGGG - Intergenic
1178758137 21:35372650-35372672 TGAGCTCATCCTCTGCAGAGGGG + Intronic
1179618589 21:42597918-42597940 CTAGCTCATCCTGTAAACACGGG - Intergenic
1180270736 22:10584555-10584577 AAAGCTCATGCTTTAGAGAGAGG + Intergenic
1180972048 22:19820887-19820909 CTTGCTCCTCTTCCAGAGAGGGG + Intronic
1182855135 22:33510452-33510474 TTAGCACATCCTCTGGAGACAGG - Intronic
949139452 3:614185-614207 AAAGCTCATGCTTTAGAGAGAGG - Intergenic
952833395 3:37584398-37584420 ATAGATCAGCCTCTAGTGAGAGG + Intronic
954602049 3:51877776-51877798 CCAGCTCAGCCTCTAGCCAGTGG + Intergenic
954607951 3:51928625-51928647 CCAGCTCAGCCTCTAGCCAGTGG + Intergenic
955867450 3:63400035-63400057 CTTGCTCATCCTCTGCAGAATGG - Intronic
959448228 3:106466929-106466951 CTAGCTCAGCCTCTATAGGATGG - Intergenic
975197063 4:71537967-71537989 ATGGCTCATCCACTAGAAAGAGG - Intronic
976217244 4:82726962-82726984 CAAGCTCATCCTGCAGAGTGGGG + Intronic
978142002 4:105328664-105328686 CTACCTCATCCTCTACACATAGG + Intergenic
987169436 5:15239173-15239195 ATATTTCATCCTCTACAGAGGGG - Intergenic
987813396 5:22869083-22869105 CTACCTCACCCACTACAGAGAGG - Intergenic
995617523 5:113982439-113982461 CTAGAACATCCACTAGAGAAAGG - Intergenic
998178678 5:139919355-139919377 CTAAATGATACTCTAGAGAGAGG + Intronic
1004568917 6:16826014-16826036 CTAGCTAATTCTATAGAGACAGG - Intergenic
1004603131 6:17169985-17170007 CTGGCTCAGCCCCTAGAGGGTGG - Intergenic
1005834220 6:29695754-29695776 CTAGCACTCCCTGTAGAGAGGGG + Intergenic
1009214512 6:60904508-60904530 ATAGCTCAGCCTTTAGAGAAGGG - Intergenic
1009730887 6:67604809-67604831 CTAGGTCTTTATCTAGAGAGAGG + Intergenic
1010248959 6:73688647-73688669 CACCCTCATCCTCTGGAGAGGGG + Intergenic
1014824251 6:126030818-126030840 CAACTTCATCCTCTAGAAAGTGG + Intronic
1016701932 6:147064193-147064215 CTAACTCCTGCTCTAGAGATTGG - Intergenic
1019449668 7:1090691-1090713 CGAGCTTATCCTCTGCAGAGAGG - Intronic
1022409762 7:30130147-30130169 CTAGCTCATCCTCTAGAGAGAGG - Intronic
1024216569 7:47254085-47254107 CTAGCTCTTCCTCTACAGTCGGG + Intergenic
1026110033 7:67451720-67451742 CCACCTCCTCCCCTAGAGAGAGG - Intergenic
1026840787 7:73668935-73668957 CCTGCTCATCCTCTCCAGAGGGG - Intronic
1029491063 7:100870381-100870403 CCAGCTCATCCTCTGGAGGCTGG - Exonic
1030244692 7:107369919-107369941 CTAGTTCATCCTCCAAAAAGAGG + Intronic
1032260681 7:130333925-130333947 CTATCTCACCCTAGAGAGAGAGG + Intergenic
1032453627 7:132055635-132055657 TGAGTGCATCCTCTAGAGAGGGG + Intergenic
1035278070 7:157759856-157759878 CCAGCTCCTCCCCAAGAGAGGGG - Intronic
1035430263 7:158814832-158814854 TTAGCTCCTCCTCTGAAGAGCGG + Intronic
1037070538 8:14641753-14641775 CTAGCCCATACGCTAGAAAGTGG - Intronic
1037323263 8:17663939-17663961 CTATTTCATCTTCTAGAGAAGGG - Intronic
1037482337 8:19315986-19316008 CCAGCTCCGCCTCTAGTGAGCGG - Intronic
1038535141 8:28348397-28348419 CAAGCTAATCCCCTAGAGAGTGG + Exonic
1045778639 8:105836963-105836985 CTAGGTAATCCTCTAGAAAATGG - Intergenic
1047170352 8:122486583-122486605 CTTGCTCATGCACTAGATAGAGG - Intergenic
1055284730 9:74716424-74716446 CTCTCTCATCATTTAGAGAGGGG - Intergenic
1055736782 9:79338659-79338681 ACTGCTCATCCTCTTGAGAGAGG - Intergenic
1058977219 9:110136396-110136418 CTAGCACCTCATCTAGATAGCGG - Exonic
1059472456 9:114516352-114516374 CTAACTCTTCCTCTAGAGCAGGG - Intergenic
1059551429 9:115233038-115233060 CTAGCTCATCCTCCAGGGTCCGG - Intronic
1059993595 9:119888294-119888316 CGAGATCATATTCTAGAGAGAGG - Intergenic
1203617909 Un_KI270749v1:86144-86166 AAAGCTCATGCTTTAGAGAGAGG + Intergenic
1193694443 X:84690587-84690609 CTTCCTCATCCTCTATGGAGAGG + Intergenic
1195218805 X:102726541-102726563 CTACCTCATCCTCTAGTGCCTGG + Intronic
1197379116 X:125716493-125716515 TTAGCAAATCTTCTAGAGAGAGG - Intergenic