ID: 1022410319

View in Genome Browser
Species Human (GRCh38)
Location 7:30134949-30134971
Sequence GCGCGGCGCCGCGCTGTCCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 182}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022410308_1022410319 20 Left 1022410308 7:30134906-30134928 CCGCAAGGGGGCGGGGGGAGGCG 0: 1
1: 0
2: 2
3: 31
4: 305
Right 1022410319 7:30134949-30134971 GCGCGGCGCCGCGCTGTCCCCGG 0: 1
1: 0
2: 2
3: 26
4: 182
1022410307_1022410319 21 Left 1022410307 7:30134905-30134927 CCCGCAAGGGGGCGGGGGGAGGC 0: 1
1: 0
2: 2
3: 41
4: 532
Right 1022410319 7:30134949-30134971 GCGCGGCGCCGCGCTGTCCCCGG 0: 1
1: 0
2: 2
3: 26
4: 182
1022410300_1022410319 30 Left 1022410300 7:30134896-30134918 CCACGGCGGCCCGCAAGGGGGCG 0: 1
1: 0
2: 1
3: 13
4: 97
Right 1022410319 7:30134949-30134971 GCGCGGCGCCGCGCTGTCCCCGG 0: 1
1: 0
2: 2
3: 26
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022410319 Original CRISPR GCGCGGCGCCGCGCTGTCCC CGG Exonic