ID: 1022410344

View in Genome Browser
Species Human (GRCh38)
Location 7:30135026-30135048
Sequence GGCCCCGGAGGAGCCCGCGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 367
Summary {0: 1, 1: 0, 2: 9, 3: 41, 4: 316}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022410325_1022410344 28 Left 1022410325 7:30134975-30134997 CCGCCCGCCCCACTCCGCACCGC 0: 1
1: 0
2: 6
3: 105
4: 924
Right 1022410344 7:30135026-30135048 GGCCCCGGAGGAGCCCGCGCAGG 0: 1
1: 0
2: 9
3: 41
4: 316
1022410329_1022410344 20 Left 1022410329 7:30134983-30135005 CCCACTCCGCACCGCATGTAAAC 0: 1
1: 0
2: 0
3: 1
4: 35
Right 1022410344 7:30135026-30135048 GGCCCCGGAGGAGCCCGCGCAGG 0: 1
1: 0
2: 9
3: 41
4: 316
1022410331_1022410344 14 Left 1022410331 7:30134989-30135011 CCGCACCGCATGTAAACAGTCCC 0: 1
1: 0
2: 0
3: 6
4: 60
Right 1022410344 7:30135026-30135048 GGCCCCGGAGGAGCCCGCGCAGG 0: 1
1: 0
2: 9
3: 41
4: 316
1022410336_1022410344 -7 Left 1022410336 7:30135010-30135032 CCAGCCGGCCCAGCCCGGCCCCG 0: 1
1: 3
2: 21
3: 202
4: 1410
Right 1022410344 7:30135026-30135048 GGCCCCGGAGGAGCCCGCGCAGG 0: 1
1: 0
2: 9
3: 41
4: 316
1022410328_1022410344 21 Left 1022410328 7:30134982-30135004 CCCCACTCCGCACCGCATGTAAA 0: 1
1: 0
2: 1
3: 0
4: 44
Right 1022410344 7:30135026-30135048 GGCCCCGGAGGAGCCCGCGCAGG 0: 1
1: 0
2: 9
3: 41
4: 316
1022410330_1022410344 19 Left 1022410330 7:30134984-30135006 CCACTCCGCACCGCATGTAAACA 0: 1
1: 0
2: 0
3: 2
4: 63
Right 1022410344 7:30135026-30135048 GGCCCCGGAGGAGCCCGCGCAGG 0: 1
1: 0
2: 9
3: 41
4: 316
1022410326_1022410344 25 Left 1022410326 7:30134978-30135000 CCCGCCCCACTCCGCACCGCATG 0: 1
1: 0
2: 0
3: 19
4: 236
Right 1022410344 7:30135026-30135048 GGCCCCGGAGGAGCCCGCGCAGG 0: 1
1: 0
2: 9
3: 41
4: 316
1022410335_1022410344 -6 Left 1022410335 7:30135009-30135031 CCCAGCCGGCCCAGCCCGGCCCC 0: 1
1: 4
2: 11
3: 141
4: 973
Right 1022410344 7:30135026-30135048 GGCCCCGGAGGAGCCCGCGCAGG 0: 1
1: 0
2: 9
3: 41
4: 316
1022410327_1022410344 24 Left 1022410327 7:30134979-30135001 CCGCCCCACTCCGCACCGCATGT 0: 1
1: 0
2: 0
3: 6
4: 180
Right 1022410344 7:30135026-30135048 GGCCCCGGAGGAGCCCGCGCAGG 0: 1
1: 0
2: 9
3: 41
4: 316
1022410332_1022410344 9 Left 1022410332 7:30134994-30135016 CCGCATGTAAACAGTCCCAGCCG 0: 1
1: 0
2: 0
3: 0
4: 74
Right 1022410344 7:30135026-30135048 GGCCCCGGAGGAGCCCGCGCAGG 0: 1
1: 0
2: 9
3: 41
4: 316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022410344 Original CRISPR GGCCCCGGAGGAGCCCGCGC AGG Exonic
900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG + Exonic
901007547 1:6179381-6179403 GGCCCAGGAGGACTCCGCTCTGG - Intronic
902410260 1:16207943-16207965 GGCACCGGAGCAGCCCGGGAAGG - Exonic
902963926 1:19984566-19984588 GGCCGCGCAGGAGCCCACGGCGG + Intergenic
903072102 1:20731717-20731739 GGCCCCTGAGGGGCGGGCGCGGG + Intronic
903132754 1:21290289-21290311 GCCCACGGAGCGGCCCGCGCGGG + Intronic
903652371 1:24929927-24929949 GGCCGAGGAGGCGCCCGCGCCGG - Intronic
903652444 1:24930156-24930178 GGCCGCGGCGGGGCCCGCGCGGG + Intronic
904162260 1:28530648-28530670 CACCGCTGAGGAGCCCGCGCTGG - Intronic
904256355 1:29257451-29257473 AGCCCGGGAGGAGGCAGCGCTGG + Intronic
904822672 1:33256012-33256034 GGCCCCGGGAGCCCCCGCGCTGG + Intergenic
905177915 1:36149498-36149520 TGCCCCGCGGGAGGCCGCGCAGG - Intronic
906204333 1:43979171-43979193 GGCCGCGGGGGCGCGCGCGCGGG + Intronic
913186511 1:116374013-116374035 GGCCCGGGAGGAGGCCCCGGCGG - Exonic
915014070 1:152717145-152717167 GGCCACGGTGGAGCCTGCACTGG + Intergenic
918450102 1:184649731-184649753 GGCCCCGGCCCAGCCCGCCCAGG - Intergenic
919801938 1:201359470-201359492 GGCCCCGGAGGAGCCAGAGAAGG + Intronic
920225362 1:204434564-204434586 GGCCACGCAGCAGCCAGCGCAGG + Exonic
922250624 1:223845964-223845986 GGCCCCAGCCGAGCCCGTGCCGG + Exonic
922502931 1:226110222-226110244 GGCCGCGGCGGAGGCCGGGCTGG + Intergenic
922505151 1:226121922-226121944 GGCGCCTGGGGAGCCCGCGGAGG + Intergenic
924539924 1:244970814-244970836 GCCTCCGGCGCAGCCCGCGCAGG - Exonic
924948056 1:248858952-248858974 GGCCCGGGAGGCGCAGGCGCAGG - Intronic
1065099768 10:22321408-22321430 GGCCCCGGAGGAGGAGGCGTTGG + Exonic
1067113923 10:43420471-43420493 GCCCCTGGAGGATCCCGCGTTGG - Intergenic
1069158192 10:65054415-65054437 GGCCCAGGACGCGCCCGCGCTGG + Intergenic
1069660969 10:70123331-70123353 GACCCTGGAGGATCCCGCCCAGG + Intronic
1069827395 10:71262504-71262526 GGACCCAGAGGAGCCCGCCCGGG + Intronic
1070162585 10:73874717-73874739 CGCCCCGGAGCCGCCCTCGCTGG + Intergenic
1070752765 10:78973832-78973854 GGGGAGGGAGGAGCCCGCGCGGG + Intergenic
1072784001 10:98268258-98268280 GGCCGCGGAGGAGGCCCCGCAGG + Intergenic
1074182914 10:111078866-111078888 CGCCCCTGGCGAGCCCGCGCCGG + Exonic
1074413032 10:113244038-113244060 GGCCCAGGAGGACCCAGTGCTGG - Intergenic
1075054401 10:119207177-119207199 GGCCCGGCAGGAGCCAGTGCGGG - Intergenic
1075520071 10:123137776-123137798 GACCCCGGAGGAGACTGGGCCGG + Intergenic
1075802191 10:125160486-125160508 CGGCCCGGAGGAGCCGGCGGCGG - Intronic
1077219869 11:1411114-1411136 GGCCCCTGAGGATCCCCAGCTGG - Intronic
1077320235 11:1937727-1937749 CACCACGGAGGAGCCCGCCCTGG - Intronic
1078066319 11:8081447-8081469 GGGCCCGGAGGGGCCGGCGCGGG - Intronic
1079071814 11:17353562-17353584 GGCCCCTGAGGAGGGGGCGCCGG - Intronic
1079136013 11:17776395-17776417 GGCACCGGAGGGGCGCACGCGGG - Intronic
1081126895 11:39333144-39333166 GGCCGCGCAGGAGCCCACGGAGG + Intergenic
1083272721 11:61580407-61580429 TGCCCCGGGGGTGCCAGCGCTGG - Intronic
1083319613 11:61837852-61837874 GGCCCCGGAGGAGCCCAGCCAGG + Exonic
1083755265 11:64788775-64788797 GGCCCAGGAGGAGCCCCCAGAGG - Intergenic
1083997220 11:66278415-66278437 GGCCCGGGGGGCGCCAGCGCGGG - Exonic
1084546781 11:69818671-69818693 GGCCCCGGGGGAAGCGGCGCCGG - Intronic
1084814705 11:71639402-71639424 GCCCGCGGAGGAGCCCGCGCCGG + Intergenic
1086087609 11:82970959-82970981 GGCCGCGCAGGAGCCCACGGTGG - Intergenic
1089666907 11:120026185-120026207 GGCCGCGCAGGAGCCCACGGTGG - Intergenic
1090820488 11:130337471-130337493 GGCTGCGCAGGAGCCCACGCGGG + Intergenic
1091218709 11:133918590-133918612 GGCCCCGGAGCAGCCCGCGGTGG + Intronic
1091393309 12:138914-138936 GGCCCCCGCAGAGCCCGCGGCGG + Exonic
1092239536 12:6828524-6828546 GTCCCCGGGGGCGCCCCCGCAGG + Exonic
1092428289 12:8390614-8390636 GCCCGCGGAGGAGTCCGCGCCGG - Intergenic
1092609170 12:10153794-10153816 GGCCCCGTCGCAGCCCGTGCCGG - Intergenic
1095986251 12:48001615-48001637 GGCCCGGGAAGCGCCGGCGCAGG + Intronic
1096868603 12:54579383-54579405 GGCCCAGGAGGAGGCCCCGAGGG + Exonic
1097237018 12:57547093-57547115 GGCCTCGGTGGAGCCGGGGCCGG + Exonic
1098288629 12:68933632-68933654 CGTCCCGCAGGAGCCCGCGCGGG - Intronic
1100604196 12:96137789-96137811 GTCCACGCAGGAGCCCGGGCTGG + Intergenic
1101253460 12:102956547-102956569 GGCCGCCGAGGTGCCCGCGGCGG + Intronic
1101910499 12:108857440-108857462 GGCCGAGGAGGAGGCGGCGCTGG + Exonic
1102197528 12:111035349-111035371 GACCCCGTAGGAGCCGGGGCTGG + Intronic
1102519810 12:113471266-113471288 CGCCCCAGTGGAGCGCGCGCAGG + Intronic
1102937654 12:116911181-116911203 GGCCTCGGGGGACCCGGCGCTGG + Exonic
1103678677 12:122676711-122676733 GGCCACGCAGGAGCCCACGGAGG + Intergenic
1105426978 13:20302354-20302376 GGCCCAGGAGGAGCCCTCCCGGG - Intergenic
1108478445 13:50843459-50843481 GGCCCCGGCCGGGCCCGCGGCGG + Exonic
1108688977 13:52846006-52846028 CTCCCCGGAGGAGGCCGCCCGGG - Exonic
1110705935 13:78602169-78602191 GGCCCCGGGGGAGGCGGCGGTGG - Exonic
1111006687 13:82258246-82258268 GGCCGCGCAGGAGCCCACGGTGG - Intergenic
1112282660 13:98076411-98076433 GGCCGCGCAGGAGCCCACGGCGG + Intergenic
1113201218 13:107868316-107868338 GTCCTCGGAGGAGCCCACCCGGG - Intergenic
1113659137 13:112092795-112092817 GGTCCCAGAGGAGCCCGGGCAGG - Intergenic
1115502171 14:34059925-34059947 GGCTCCGGGGGAGCCTGCGGAGG - Intronic
1115851712 14:37594846-37594868 GGCGCCGCTGGAGCCCGTGCCGG - Intronic
1116901003 14:50362182-50362204 GGCCGCGCAGGAGCCCACGGTGG - Intronic
1117353488 14:54902575-54902597 GGCCGCGGCGGATCCCGCTCGGG + Exonic
1120209826 14:81623841-81623863 GGCCGCGCAGGAGCCCACGGCGG + Intergenic
1121635661 14:95452344-95452366 GGCCTCGGAGGAGCCCCGGGTGG - Exonic
1122275072 14:100587069-100587091 GGCCCGGGAGGAGCCGGGCCGGG - Intronic
1122447658 14:101781457-101781479 GGCCCGGCGGGAGCCCACGCGGG - Intronic
1123165821 14:106324183-106324205 GGAGGCGGAGGAGCCGGCGCAGG - Intergenic
1124696906 15:31870856-31870878 GGCCCCGGAGGGGCGGGGGCGGG - Intergenic
1125894192 15:43288176-43288198 GGCCCTGGAGGAGCCAGGGTGGG + Intronic
1128067742 15:64775245-64775267 GGCGCCGCCGGAGCCCGCGCCGG + Exonic
1131154625 15:90067359-90067381 GGCCTTGGAGGAGCCGGCGGAGG + Exonic
1131250288 15:90825759-90825781 GGCCTCGCAGGAGCCCACGGTGG - Intergenic
1131257019 15:90869729-90869751 GGCCCCAGGGGAGCCCGCAGTGG - Intronic
1131892147 15:96984250-96984272 GGCCGCGCAGGAGCCCACGGCGG + Intergenic
1132501599 16:286903-286925 GCCCACGGAGGAGCCCCCGGAGG + Exonic
1132585949 16:705812-705834 GGCCACGGAGGAGCGCGGGGAGG - Exonic
1132779396 16:1614422-1614444 GGCCCGGGAGGGTCCCGGGCTGG + Intronic
1132861594 16:2074441-2074463 GGCACCAGAGAAGCCCGCACAGG - Intronic
1132862346 16:2077895-2077917 GGCCCCGTATGAGCACGGGCTGG + Intronic
1133318029 16:4895891-4895913 GGCCCCTAAGGAGCCAGCTCAGG - Intronic
1133352128 16:5108626-5108648 GGCCGCGCAGGAGCCCACGGTGG + Intergenic
1133369938 16:5239739-5239761 GCCCGCGGAGGAGCCCGCGCCGG + Intergenic
1133464875 16:6019569-6019591 AGCCCCGGAGGCGCGCGCGTGGG - Intronic
1133784374 16:8963430-8963452 GGCCCCGGGGCGGCCCGCGGCGG + Exonic
1135470184 16:22723070-22723092 GGCCACGCAGGAGCCCACGTGGG + Intergenic
1135776129 16:25258368-25258390 GGCCCCAGATGAGACCGCGCCGG - Intergenic
1136223778 16:28845406-28845428 TGCCCCGGAGGAGCGAGCTCGGG - Exonic
1138688821 16:58749142-58749164 GGCCGCGCAGGAGCCCACGGCGG - Intergenic
1140481647 16:75265675-75265697 GGCCCCGGGGGAGAGCGCACCGG - Intronic
1141526893 16:84617677-84617699 GGCCACGGAGAAGCCCGCGGGGG + Intronic
1141710894 16:85698395-85698417 GGCCCCGGAGCAGCCCACCTGGG - Intronic
1141965032 16:87436324-87436346 GGGCCCGGAGGTGCCCTGGCGGG - Intronic
1142764082 17:2056125-2056147 GGCCCGGGCGGCGGCCGCGCGGG - Intronic
1142906900 17:3049449-3049471 GGCCGGGGAGGAGACCACGCTGG + Intergenic
1143007458 17:3846160-3846182 GGCCCCGGCGGGGCCGGCCCTGG - Exonic
1143223728 17:5282621-5282643 GGCCCCGGGGGTGACCCCGCCGG + Intronic
1144128124 17:12221149-12221171 GGCCGCGCAGGAGCCCACGGCGG - Intergenic
1144496472 17:15749327-15749349 CGCCCAGGACGCGCCCGCGCTGG - Intergenic
1144606056 17:16666731-16666753 CGCCCAGGACGCGCCCGCGCTGG - Intergenic
1144905112 17:18635372-18635394 GGCCCAGGAAGCGCCCGCGCTGG + Exonic
1145910017 17:28537059-28537081 GGCACCGGAGGAGCCCTGTCTGG - Intronic
1147311633 17:39599215-39599237 GCCCCTGGAGGGGCCCGCGCCGG - Intergenic
1147907298 17:43831728-43831750 TGCCCCCGAGGAGCCCGAGTGGG + Intronic
1147971244 17:44219929-44219951 GCCCCCCGCGGAGCCCGCCCGGG - Intronic
1148209625 17:45800365-45800387 GGCCCTGGGGGAGGCCCCGCAGG - Intronic
1148331951 17:46818564-46818586 GGCCGAGGAGCAGCCCGAGCAGG + Exonic
1148647021 17:49225061-49225083 GGCGCGGCAGGAGCCCGCCCGGG + Exonic
1150314169 17:64154898-64154920 TTCCTCGGAGGAGCCAGCGCTGG + Exonic
1152071946 17:78138417-78138439 GGCCCAGGAGGAGCACTAGCTGG - Exonic
1152639998 17:81445377-81445399 GGATCTGGAGGAGCCCGCCCAGG + Exonic
1152640553 17:81447532-81447554 GGCCCCTGAGGAGGACGAGCTGG + Exonic
1152797234 17:82314437-82314459 GGCCCCGGGGGAGACCCAGCTGG - Intergenic
1152800534 17:82328724-82328746 GGCCCAGCAGGAGCCCTGGCAGG + Intronic
1152809589 17:82375299-82375321 GGCCCCGCACGCGGCCGCGCAGG - Exonic
1152925342 17:83085096-83085118 GGCCCCCGAGGAGTCCGTGAAGG - Exonic
1153935236 18:9914626-9914648 CGCCCAGGAGGCGCCCCCGCGGG - Intronic
1154194039 18:12253363-12253385 GGCTCAGGAGGAGCCGGCGAGGG + Intergenic
1157867117 18:51197002-51197024 GGCCCCGGAGGCGGCCGAGCTGG - Exonic
1160450746 18:78964906-78964928 GGCTCCGGAGAAGGCGGCGCTGG - Intergenic
1160450784 18:78965029-78965051 GGCTCCGGAGAAGGCGGCGCTGG - Intergenic
1160450803 18:78965090-78965112 GGCTCCGGAGAAGGCGGCGCTGG - Intergenic
1160450821 18:78965151-78965173 GGCTCCGGAGAAGGCGGCGCTGG - Intergenic
1160499188 18:79394126-79394148 GGCTCCTGAGGAGCCGGGGCCGG - Intergenic
1160499345 18:79394542-79394564 GGCGCCGTAGGGGCCCCCGCAGG + Intergenic
1160500683 18:79400060-79400082 GGGTCCGGAGGAGCCTGCGCCGG + Intronic
1160548807 18:79680114-79680136 GGCCCCGGAGGACTGCGCGGAGG - Exonic
1160733489 19:651581-651603 GGCCCCGGGGGTGGCCGCGAGGG - Intronic
1160756257 19:758482-758504 GGCCCCAGACGAGCCCCAGCAGG + Exonic
1160760358 19:781090-781112 GGCCCCGGAGGGGCGGGGGCAGG + Intergenic
1160765399 19:805376-805398 GGCCCCGGCAGAGCCTTCGCGGG - Intronic
1160828421 19:1091419-1091441 GCCCCTGGAGGACCCCGTGCCGG + Intronic
1161073001 19:2271548-2271570 GGCCCCAGAGCAGCCCCAGCAGG - Intronic
1161104534 19:2436847-2436869 GGCCCTGGAGGGGCCCTCACAGG - Intronic
1161484719 19:4529176-4529198 TGGCCCGGAGGGGCCGGCGCTGG - Exonic
1161628593 19:5340234-5340256 GGCCCCGGCGGCGCCCGGCCCGG - Intronic
1162375950 19:10305437-10305459 GGACCCAGAGGACCCCGCTCTGG - Exonic
1162578652 19:11514197-11514219 GGCCCCGAGGGAGCCGGCGAGGG + Exonic
1162760458 19:12885690-12885712 GCCACCCGAGGAGCCGGCGCCGG + Exonic
1163700713 19:18785321-18785343 GGCCCGGGAGGAGAAGGCGCGGG - Intronic
1163830214 19:19543955-19543977 GGCCCCGGACCAGCCCCCGAGGG - Exonic
1168459101 19:56538907-56538929 GGCCATGGGGGAGCGCGCGCGGG + Intergenic
925068853 2:950856-950878 CGCCCCGGTGGAGCCCGAGCCGG + Exonic
925404513 2:3597199-3597221 GACCCCGGAGCAGCCCAGGCCGG - Intronic
925744856 2:7035099-7035121 GGCCTCAGAGGAGCCCGCTCAGG + Intronic
926474733 2:13308388-13308410 GGCCGCGCAGGAGCCCACGGCGG + Intergenic
932383953 2:71313365-71313387 GGCCCCGGCGTGGCCCACGCTGG + Intronic
933666896 2:84971369-84971391 GGTCCCGGCGCTGCCCGCGCCGG - Exonic
934547506 2:95230625-95230647 GGCGACGGAGGAGCCAGCGCGGG - Intronic
934754558 2:96816343-96816365 CGCCGCGGGGGAGGCCGCGCCGG + Exonic
935265104 2:101387176-101387198 GGCCCGGGCGGCGCCCGCCCGGG + Exonic
940971854 2:159904373-159904395 GGGCCCGGAGGAGGGCGCGGTGG - Intronic
941095907 2:161239052-161239074 GCCCTCGGGCGAGCCCGCGCGGG - Intergenic
941686839 2:168456301-168456323 GGCCGCGGAGGAGGCGGCGGCGG + Exonic
946966383 2:225042091-225042113 GGCGCCGGGGGAGCCCGCAGAGG + Intronic
948567382 2:238895731-238895753 AGCCCCGGTAGAGCCCGCCCTGG + Intronic
948759146 2:240179738-240179760 AGCCCAGGAGGAGCCAGTGCAGG + Intergenic
948806750 2:240456360-240456382 GGCACAGGAGGAGCCGGCGGGGG + Intronic
1168777734 20:462240-462262 GGCGCCGGAGGGGCGCGGGCTGG - Intronic
1170605141 20:17870030-17870052 GGCCCCTGAGGGGCACACGCTGG + Intergenic
1173812646 20:45965671-45965693 GGCCCCGAAGGAGACCTGGCCGG - Exonic
1174377166 20:50133661-50133683 GGCCGAGGAGGAGCCAGCACAGG - Intronic
1174388087 20:50198573-50198595 GGCGCTGGAGGAGCCAGGGCCGG + Intergenic
1174611666 20:51802288-51802310 GGCCCCAGCGGCGCCCGCGGCGG - Exonic
1176138477 20:63535249-63535271 GGCCCCTGAGGACCCGGCGGGGG + Intronic
1176549793 21:8216197-8216219 GGCCCGGGTGGAGCCGCCGCAGG + Intergenic
1176557684 21:8260426-8260448 GGCCCGGGTGGAGCCGCCGCAGG + Intergenic
1176568718 21:8399231-8399253 GGCCCGGGTGGAGCCGCCGCAGG + Intergenic
1176576632 21:8443466-8443488 GGCCCGGGTGGAGCCGCCGCAGG + Intergenic
1178518623 21:33268546-33268568 CGCACCGGAGGAGCCAGCCCTGG + Intronic
1178610300 21:34073775-34073797 GGCAGCGGGGGCGCCCGCGCGGG - Intronic
1179479714 21:41669499-41669521 GGTCCCGGAGGTCCCCGAGCCGG - Intergenic
1179810374 21:43865680-43865702 CGCCCGGGAGGGGCCCGGGCCGG + Intronic
1180229218 21:46416547-46416569 GGCCCCGGAAGAGCCCGGTCGGG + Exonic
1180699714 22:17774553-17774575 GGGACCCGGGGAGCCCGCGCCGG + Intronic
1180727341 22:17956192-17956214 GGCCCCGGAGGAGTGGGCTCTGG - Intronic
1181077639 22:20392485-20392507 GGCCGCGCAGGAGCCCACGGCGG + Intergenic
1181464388 22:23102919-23102941 GGCCCCAGCAGAGCCCACGCTGG - Intronic
1183537738 22:38412994-38413016 GGGCCCGCAGGGGCCCGCGGAGG + Intergenic
1183828307 22:40405215-40405237 GGGCCCGGAGCACCCTGCGCAGG - Exonic
1183961432 22:41413890-41413912 GGGCGCGGAGGGGGCCGCGCTGG + Intergenic
1184035252 22:41914992-41915014 GGCCCTAGCGGAGGCCGCGCCGG + Intergenic
1184236708 22:43186991-43187013 GACGCCGGAGGAGGGCGCGCAGG - Exonic
1184712753 22:46262843-46262865 GGCCGCGGGGGAGGCCGGGCGGG + Exonic
1185118349 22:48950743-48950765 GGTCGCGGAGGAGCCAGCACAGG - Intergenic
1185402093 22:50624496-50624518 GGCCCCAGAGGAGCCGTCTCAGG + Intronic
1203254682 22_KI270733v1_random:132523-132545 GGCCCGGGTGGAGCCGCCGCAGG + Intergenic
1203262738 22_KI270733v1_random:177602-177624 GGCCCGGGTGGAGCCGCCGCAGG + Intergenic
951332915 3:21387326-21387348 GGCCGCGCAGGAGCCCACGGCGG + Intergenic
952453731 3:33453742-33453764 GGCCACGCAGGAGCCCACGGCGG - Intergenic
953705210 3:45225820-45225842 GGGCCCGGAGGAGGCGGCGGCGG - Exonic
953863692 3:46565855-46565877 GGCGCCGGAGCAGTACGCGCAGG + Intronic
954459281 3:50617261-50617283 GTCCCCGGAGGAGGCCGCAGAGG - Intronic
954718008 3:52536462-52536484 GGCCTCGAAGGAGCTGGCGCAGG - Intronic
954798158 3:53172015-53172037 GGCCCAGGAGGAGCGCTGGCTGG + Intronic
957072988 3:75580326-75580348 GCCCGCGGAGGAGCCCGCGCCGG - Intergenic
957193733 3:77040971-77040993 TGCCCCCAAGGAGCCCGTGCCGG - Intronic
960096689 3:113696493-113696515 AGCCCCGGAGGAGCAGGCGGTGG - Exonic
961465013 3:127076359-127076381 GGCCACGCAGGAGCCCACGGCGG + Intergenic
961873289 3:130003133-130003155 GCCCGCGGAGGAGCCCGCGCCGG - Intergenic
963673474 3:148280640-148280662 GGCCGCGCAGGAGCCCACGGCGG + Intergenic
964118914 3:153162451-153162473 GGCCCCGCAGCAGTCCGCGGCGG - Exonic
964219125 3:154324292-154324314 GGCTCCGGAGGAGGCGGCGGCGG - Exonic
964682716 3:159360096-159360118 GGACCCAGAGGAGCCCTCCCTGG + Intronic
965596981 3:170419648-170419670 CGCCCCGGGGGAGGCCGGGCGGG - Intronic
967196028 3:187026308-187026330 GTCCCCAGAGGAGCCTGCCCAGG - Intronic
967197717 3:187043120-187043142 GGTCCCGGAGGTGGCAGCGCAGG - Exonic
967272655 3:187743921-187743943 GGCGCGGGAGGAGCGGGCGCGGG - Intronic
967316289 3:188154322-188154344 CACCCCGGAGGCGCTCGCGCCGG - Intronic
967849558 3:194071437-194071459 GGACGCAGAGGGGCCCGCGCCGG + Intergenic
968047416 3:195631939-195631961 GGCCCAGGAGGAGCCTGGCCAGG - Intergenic
968092668 3:195908707-195908729 GGACCCGGAGGCGCCGGCGGAGG - Intronic
968307197 3:197657985-197658007 GGCCCAGGAGGAGCCTGGCCAGG + Intergenic
968462719 4:733298-733320 GGAGCAGGAGGAGCCCGCGAAGG - Intronic
968481853 4:836790-836812 GGGGCCGGAGCAGCCCCCGCCGG - Intergenic
968502301 4:956353-956375 GGCCGCGGAGGAGCAGACGCTGG - Intronic
968621733 4:1606418-1606440 GTCCCGCGAGGAGCCCGCGGCGG - Intergenic
968653846 4:1770355-1770377 GGCCCCGCGGCAGCCCGGGCGGG + Intergenic
968764730 4:2462470-2462492 GGCCCCGGCGGCGCCCTCGCAGG + Exonic
968998945 4:3964810-3964832 GGCCACGAAGGAGCCCACGAGGG + Intergenic
969016592 4:4107624-4107646 GCCCGCGGAGGAGCCCGCGCCGG - Intergenic
969572406 4:8017170-8017192 GGCCTGGGAGGAGGCGGCGCAGG - Intronic
969737366 4:9000693-9000715 GCCTGCGGAGGAGCCCGCGCCGG + Intergenic
969795451 4:9524535-9524557 GGCCACGCAGGAGCCCACGGAGG + Intergenic
976690555 4:87863734-87863756 GGCCGCGCAGGAGCCCACGGCGG + Intergenic
981617291 4:146655173-146655195 GGCCCCAGAGGGGCCCCCGGAGG - Intergenic
981617374 4:146655503-146655525 GGCTCCGGGGCAGACCGCGCGGG - Intergenic
982745790 4:159103338-159103360 GGCCGCGGCGGCGCCGGCGCCGG + Intergenic
983216492 4:165007370-165007392 TGCCCCTGAGGAGCCTGGGCAGG - Intergenic
985269343 4:188179246-188179268 GGCCGCGCAGGAGCCCGCAGCGG - Intergenic
985641142 5:1064003-1064025 GGCCTCAGAGGAGCCCGTCCCGG + Intronic
985688504 5:1294544-1294566 GGCCTCGGGGGGGCCCCCGCGGG + Exonic
985780739 5:1869535-1869557 GGCCCTGGAGGAGGCTGGGCTGG + Intergenic
987379895 5:17275513-17275535 GCCCCCGAAGGCGCCCGAGCAGG + Exonic
988883637 5:35531914-35531936 GGCCGCACAGGAGCCCACGCAGG - Intergenic
992473205 5:77077585-77077607 GGCACCTGAGGAGCGCGCACCGG - Exonic
992550158 5:77852035-77852057 AGCCCCGGCGGTGCCCGCGGCGG - Intronic
992690610 5:79236958-79236980 GGCCCCGGCGGAGCTCGGCCTGG + Exonic
993905610 5:93620669-93620691 TGCCCTGAAGGAGACCGCGCGGG - Exonic
994620386 5:102155227-102155249 GGCCGCGCAGGAGCCCACGGCGG - Intergenic
995512348 5:112921890-112921912 GGCATCGGAGGACCCCGCGGGGG - Intronic
995552444 5:113294634-113294656 GGCAGCGGCGGAGCCCGCGCGGG + Intronic
996858953 5:128042914-128042936 GGACCCAGAGGAGCCAGGGCAGG + Intergenic
997625300 5:135327129-135327151 CGTCCCAGAGAAGCCCGCGCGGG + Intronic
998149294 5:139747760-139747782 GGGCCCGGTGGGGCCAGCGCTGG - Intergenic
998385250 5:141753661-141753683 GGCCCCGGGGGCTCCCGGGCTGG + Intergenic
1000463523 5:161548832-161548854 GGCGCCCGAGGAGCCCGCGGCGG + Intronic
1001841585 5:174880958-174880980 GGCCACGCAGGAGCCCACGGTGG - Intergenic
1001843605 5:174901805-174901827 GGCCACGCAGGAGCCCACGGAGG - Intergenic
1002600846 5:180353280-180353302 GCCCACGGAGGAGCCCACGGAGG - Exonic
1002887890 6:1312265-1312287 TGCCCCGAAGACGCCCGCGCGGG + Intergenic
1003178515 6:3771878-3771900 GGCCACGCGGGAGCCCGCGGCGG - Intergenic
1003367072 6:5484985-5485007 GGCCCCGGAGGAGCCCTCCCTGG + Intronic
1004250352 6:14018283-14018305 GGCCACGCAGGAGCCCACGGCGG - Intergenic
1004663351 6:17729041-17729063 GGCCGCGCAGGAGCCGGCGGTGG - Intergenic
1006610718 6:35292738-35292760 GGCCACGGAGGAGAGCGAGCAGG + Exonic
1006798166 6:36743915-36743937 GGGCCAGGAGGAGCCCGATCAGG + Intronic
1010703165 6:79077288-79077310 GGCCCCCGCAGACCCCGCGCCGG + Intronic
1011662073 6:89603184-89603206 GGAGCTGGAGGAGCCCGCTCTGG + Intronic
1012625748 6:101401978-101402000 GGCAACGGCGGAGCCCGCCCAGG + Intronic
1015315155 6:131808406-131808428 GGCTGCGGAGGAGAGCGCGCGGG - Intronic
1015625902 6:135181083-135181105 GGCCCGGGAGGCGCGCGGGCAGG - Intergenic
1018046220 6:159968961-159968983 GGCCTGGGAGGAGCCGGGGCGGG + Intergenic
1018374859 6:163201458-163201480 GGCCCCTGGGGAGCCTGCTCAGG + Intronic
1018856525 6:167678984-167679006 GGAACCGGAGGAGCCCGGGAGGG - Intergenic
1018872655 6:167795472-167795494 GGCCTGGGAGGAGCCCACGAGGG - Intronic
1019198677 6:170296736-170296758 GGTGCTGCAGGAGCCCGCGCGGG + Intronic
1019343418 7:518891-518913 TGCGCCGGAGGAGCCGGCGCAGG + Intronic
1019453224 7:1110404-1110426 GGCCCGGGAGGTGCCGGCGCGGG - Intronic
1019457492 7:1138105-1138127 AGCCCCGCGGGAGCCCGCCCCGG + Exonic
1019711472 7:2520003-2520025 GGCGCCGGGGCAGCCCCCGCGGG - Exonic
1019989637 7:4682517-4682539 TACCCCGGAGGAGCCCCCGGAGG - Exonic
1021845294 7:24757444-24757466 GGAGTCGGAGGAGCCTGCGCTGG + Intronic
1022028178 7:26467796-26467818 GGACCCAGAGGAGACCGCCCAGG - Intergenic
1022101760 7:27173394-27173416 GGCCGCGGAGGAGCTCTCCCCGG - Exonic
1022410344 7:30135026-30135048 GGCCCCGGAGGAGCCCGCGCAGG + Exonic
1022427759 7:30284869-30284891 GGCCCCGGCGGAGTCTGGGCGGG + Exonic
1027956079 7:84880814-84880836 GGCCGCGCAGGAGCCCACGGCGG - Intergenic
1029075063 7:97928423-97928445 GCCCGCAGAGGAGCCCGCGCCGG - Intergenic
1029365194 7:100112117-100112139 GGCCTCGCAGGAGCCCACGCAGG + Exonic
1029988207 7:104940440-104940462 GGCCCCCCAGGAGCCCACGGAGG - Intergenic
1030108892 7:106009669-106009691 GAGCCTGCAGGAGCCCGCGCGGG - Intronic
1030820466 7:114086345-114086367 GGCCGCGGAGCTGCACGCGCCGG - Intronic
1030980657 7:116182056-116182078 GGCCGCGCAGGAGCCCACGGGGG + Intergenic
1031134841 7:117873352-117873374 GGCCCCGGAGGACGCGGCGGGGG - Exonic
1031483463 7:122304113-122304135 GGCCCCGGCGGCGCCCGCGGCGG - Exonic
1032117090 7:129126591-129126613 TGCCTCGGAGGCGCCCTCGCTGG - Intergenic
1033361352 7:140640755-140640777 GGCCGCGGGCGAGCCTGCGCTGG - Exonic
1035203299 7:157279849-157279871 GGGCCCGGAGCAGCCGGCGTGGG - Intergenic
1035431690 7:158828397-158828419 GGCCCCTAAGGAGACCCCGCGGG + Intronic
1035573314 8:688197-688219 GGCCCCTGAGCCGCCCACGCAGG + Intronic
1036258330 8:7222056-7222078 GCCCGCGGAGGAGCCCGCGCCGG - Intergenic
1036259391 8:7228200-7228222 GCCCGCGGAGGAGCCCGCACCGG - Intergenic
1036307235 8:7611324-7611346 GCCCGCGGAGGAGCCCGGGCCGG + Intergenic
1036310384 8:7680652-7680674 GCCCGCGGAGGAGCCCGCGCCGG - Intergenic
1036311433 8:7686770-7686792 GCCCGCGGAGGAGCCCGCACCGG - Intergenic
1036358077 8:8059311-8059333 GCCCGCGGAGGAGCCCGGGCCGG + Intergenic
1036359153 8:8065451-8065473 GCCCGCGTAGGAGCCCGCGCCGG + Intergenic
1036588866 8:10149461-10149483 GGCCCTGGAGGGGCCTGGGCAGG - Intronic
1036801402 8:11795050-11795072 GGCCGCGCAGGAGCCCACGGCGG - Intergenic
1036891805 8:12601501-12601523 GCCCGCGTAGGAGCCCGCGCCGG - Intergenic
1036892870 8:12607635-12607657 GCCCGCGGAGGAGCCCGGGCCGG - Intergenic
1037803877 8:22049060-22049082 GCCCCCGGAGGGGCCGGGGCCGG + Intronic
1039068774 8:33631967-33631989 GGCCACGCAGGAGCCCACGGTGG - Intergenic
1040014431 8:42689563-42689585 GGGCTCGGAGGACCCCGCACTGG + Intergenic
1041068575 8:54104482-54104504 GGCCACGCAGGAGCCCACGGCGG - Intergenic
1041292421 8:56320003-56320025 GCTCCCGGAGGAGGTCGCGCTGG - Intronic
1042837858 8:73093368-73093390 CGCCCCGGAGGTCCCCGGGCTGG - Intronic
1042894412 8:73651168-73651190 GGGCCCCGAGGAGCCCCCTCAGG + Intronic
1044441685 8:92231060-92231082 GGCCACGCAGGAGCCCACGGTGG - Intergenic
1047402568 8:124558803-124558825 GGCTTCGGAGGAGGCCGAGCTGG + Intronic
1047542549 8:125784702-125784724 GGCCGGGGAGGAGCCCTCACCGG - Intergenic
1048553968 8:135457600-135457622 GGCCGAGGAGGAGCGGGCGCGGG - Exonic
1048873179 8:138815526-138815548 GGCGGCTGAGGAGCCAGCGCAGG - Intronic
1049098192 8:140561035-140561057 GGCCCCGGAGCTGCCCGCTGTGG + Intronic
1049237152 8:141518152-141518174 GGGCCGGGAGCGGCCCGCGCAGG - Intronic
1049414568 8:142489275-142489297 GGGCCAGGAGGAGCCTGGGCTGG + Intronic
1049419477 8:142510576-142510598 GGCCCCGGAGGAGCTGGGGGCGG + Intronic
1049585455 8:143430662-143430684 GGTCCCGGAGCAGCCCGAGGCGG - Intergenic
1049643842 8:143727474-143727496 GGGCCCGGAGGAGCCTGGCCTGG - Exonic
1049682482 8:143925821-143925843 GGCCGAGGTGGAGGCCGCGCTGG - Exonic
1049749665 8:144277189-144277211 GGCAGGGGAGGAGCCCGGGCCGG - Intronic
1049804784 8:144533923-144533945 GGCCCAGGAAGAGCCCCCGGGGG + Intronic
1049857965 8:144875414-144875436 GGCCACGCAGGAGCCCACGGCGG - Intergenic
1055985489 9:82054455-82054477 GGCCACGCAGGAGCCCACGGTGG + Intergenic
1057653732 9:96936915-96936937 CGCCCCGGAGGAGACGCCGCAGG - Intronic
1058885612 9:109319953-109319975 GGCCCCGGAAGAGACCGGGACGG + Intronic
1059176674 9:112174990-112175012 GGCGCAGGTGGGGCCCGCGCCGG - Intronic
1059891417 9:118809333-118809355 GGCCGCGCAGGAGCCCACGGCGG + Intergenic
1060484969 9:124041066-124041088 GGTCCCGGGGGAGCCGGCCCGGG + Intergenic
1060547665 9:124470494-124470516 GGCCACGGTGAAGCCCGTGCTGG + Exonic
1060700560 9:125746819-125746841 GGCCCCGGCGGGCCGCGCGCCGG - Intergenic
1060700613 9:125746963-125746985 GGCCCCGGGGGAGGCAGCGGCGG - Intergenic
1061006233 9:127929816-127929838 GGCGCCAGAGAAGCCCCCGCCGG + Exonic
1061293593 9:129665835-129665857 GGCCCCGGGGGGGCCGGCGGGGG - Exonic
1061424628 9:130491316-130491338 GGCCCCGGAGCAGCCCGGCCAGG - Intronic
1061489940 9:130939236-130939258 GGCCCCGAGGGCGCCCCCGCCGG + Intronic
1062212314 9:135371808-135371830 GGCCCCAGAGCAGCCCACGGAGG + Intergenic
1062341238 9:136094811-136094833 GGTCCCTGGGGAGGCCGCGCGGG + Intronic
1062476013 9:136727950-136727972 GGCCGCGGAGGAGGCGCCGCTGG - Intergenic
1062624288 9:137435916-137435938 GGCCCAGGAGGGGCCCAGGCTGG - Intronic
1203471083 Un_GL000220v1:115668-115690 GGCCCGGGTGGAGCCGCCGCAGG + Intergenic
1203478904 Un_GL000220v1:159640-159662 GGCCCGGGTGGAGCCGCCGCAGG + Intergenic
1189362894 X:40366861-40366883 GGCCCTGGAGGAGGCAGGGCTGG + Intergenic
1196197943 X:112855146-112855168 GGGCTCGGAGGACCCCACGCTGG - Intergenic
1196645886 X:118116909-118116931 GGCCCCGGCGGCGCCTGCGCGGG + Intronic
1197607976 X:128606911-128606933 GGCCGCACAGGAGCCCACGCGGG - Intergenic
1198773747 X:140157666-140157688 GACCCCAGAGGAGCCTGTGCTGG + Intergenic
1200138280 X:153885439-153885461 GAGCCCGGAGGAGCCCAGGCTGG + Intronic
1200145845 X:153926295-153926317 GGGCTGGGCGGAGCCCGCGCAGG - Intronic
1200147618 X:153934787-153934809 GGCCCCGGCCGAGCCCGGCCCGG - Intronic