ID: 1022410344

View in Genome Browser
Species Human (GRCh38)
Location 7:30135026-30135048
Sequence GGCCCCGGAGGAGCCCGCGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 367
Summary {0: 1, 1: 0, 2: 9, 3: 41, 4: 316}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022410335_1022410344 -6 Left 1022410335 7:30135009-30135031 CCCAGCCGGCCCAGCCCGGCCCC 0: 1
1: 4
2: 11
3: 141
4: 973
Right 1022410344 7:30135026-30135048 GGCCCCGGAGGAGCCCGCGCAGG 0: 1
1: 0
2: 9
3: 41
4: 316
1022410326_1022410344 25 Left 1022410326 7:30134978-30135000 CCCGCCCCACTCCGCACCGCATG 0: 1
1: 0
2: 0
3: 19
4: 236
Right 1022410344 7:30135026-30135048 GGCCCCGGAGGAGCCCGCGCAGG 0: 1
1: 0
2: 9
3: 41
4: 316
1022410336_1022410344 -7 Left 1022410336 7:30135010-30135032 CCAGCCGGCCCAGCCCGGCCCCG 0: 1
1: 3
2: 21
3: 202
4: 1410
Right 1022410344 7:30135026-30135048 GGCCCCGGAGGAGCCCGCGCAGG 0: 1
1: 0
2: 9
3: 41
4: 316
1022410329_1022410344 20 Left 1022410329 7:30134983-30135005 CCCACTCCGCACCGCATGTAAAC 0: 1
1: 0
2: 0
3: 1
4: 35
Right 1022410344 7:30135026-30135048 GGCCCCGGAGGAGCCCGCGCAGG 0: 1
1: 0
2: 9
3: 41
4: 316
1022410330_1022410344 19 Left 1022410330 7:30134984-30135006 CCACTCCGCACCGCATGTAAACA 0: 1
1: 0
2: 0
3: 2
4: 63
Right 1022410344 7:30135026-30135048 GGCCCCGGAGGAGCCCGCGCAGG 0: 1
1: 0
2: 9
3: 41
4: 316
1022410331_1022410344 14 Left 1022410331 7:30134989-30135011 CCGCACCGCATGTAAACAGTCCC 0: 1
1: 0
2: 0
3: 6
4: 60
Right 1022410344 7:30135026-30135048 GGCCCCGGAGGAGCCCGCGCAGG 0: 1
1: 0
2: 9
3: 41
4: 316
1022410332_1022410344 9 Left 1022410332 7:30134994-30135016 CCGCATGTAAACAGTCCCAGCCG 0: 1
1: 0
2: 0
3: 0
4: 74
Right 1022410344 7:30135026-30135048 GGCCCCGGAGGAGCCCGCGCAGG 0: 1
1: 0
2: 9
3: 41
4: 316
1022410328_1022410344 21 Left 1022410328 7:30134982-30135004 CCCCACTCCGCACCGCATGTAAA 0: 1
1: 0
2: 1
3: 0
4: 44
Right 1022410344 7:30135026-30135048 GGCCCCGGAGGAGCCCGCGCAGG 0: 1
1: 0
2: 9
3: 41
4: 316
1022410325_1022410344 28 Left 1022410325 7:30134975-30134997 CCGCCCGCCCCACTCCGCACCGC 0: 1
1: 0
2: 6
3: 105
4: 924
Right 1022410344 7:30135026-30135048 GGCCCCGGAGGAGCCCGCGCAGG 0: 1
1: 0
2: 9
3: 41
4: 316
1022410327_1022410344 24 Left 1022410327 7:30134979-30135001 CCGCCCCACTCCGCACCGCATGT 0: 1
1: 0
2: 0
3: 6
4: 180
Right 1022410344 7:30135026-30135048 GGCCCCGGAGGAGCCCGCGCAGG 0: 1
1: 0
2: 9
3: 41
4: 316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022410344 Original CRISPR GGCCCCGGAGGAGCCCGCGC AGG Exonic