ID: 1022410717

View in Genome Browser
Species Human (GRCh38)
Location 7:30136403-30136425
Sequence CGTGGGCGCGGGTGACCGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 92}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022410711_1022410717 -1 Left 1022410711 7:30136381-30136403 CCAAATGTAAGATGGAGGCGGCC 0: 1
1: 0
2: 0
3: 2
4: 41
Right 1022410717 7:30136403-30136425 CGTGGGCGCGGGTGACCGTGTGG 0: 1
1: 0
2: 0
3: 11
4: 92
1022410708_1022410717 1 Left 1022410708 7:30136379-30136401 CCCCAAATGTAAGATGGAGGCGG 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1022410717 7:30136403-30136425 CGTGGGCGCGGGTGACCGTGTGG 0: 1
1: 0
2: 0
3: 11
4: 92
1022410710_1022410717 0 Left 1022410710 7:30136380-30136402 CCCAAATGTAAGATGGAGGCGGC 0: 1
1: 0
2: 0
3: 3
4: 50
Right 1022410717 7:30136403-30136425 CGTGGGCGCGGGTGACCGTGTGG 0: 1
1: 0
2: 0
3: 11
4: 92
1022410705_1022410717 26 Left 1022410705 7:30136354-30136376 CCAAGGTCGGGGAATAAATAATG 0: 1
1: 0
2: 1
3: 2
4: 65
Right 1022410717 7:30136403-30136425 CGTGGGCGCGGGTGACCGTGTGG 0: 1
1: 0
2: 0
3: 11
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022410717 Original CRISPR CGTGGGCGCGGGTGACCGTG TGG Intronic