ID: 1022411448

View in Genome Browser
Species Human (GRCh38)
Location 7:30141599-30141621
Sequence AGCCCAGGAATTTGAGGTTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2315
Summary {0: 5, 1: 45, 2: 171, 3: 562, 4: 1532}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022411448_1022411455 22 Left 1022411448 7:30141599-30141621 CCGTAACCTCAAATTCCTGGGCT 0: 5
1: 45
2: 171
3: 562
4: 1532
Right 1022411455 7:30141644-30141666 TGGCAAGTAGCCAGGACTACAGG No data
1022411448_1022411451 2 Left 1022411448 7:30141599-30141621 CCGTAACCTCAAATTCCTGGGCT 0: 5
1: 45
2: 171
3: 562
4: 1532
Right 1022411451 7:30141624-30141646 AGCAGCCTGCTGCTTCATCCTGG No data
1022411448_1022411453 14 Left 1022411448 7:30141599-30141621 CCGTAACCTCAAATTCCTGGGCT 0: 5
1: 45
2: 171
3: 562
4: 1532
Right 1022411453 7:30141636-30141658 CTTCATCCTGGCAAGTAGCCAGG 0: 1
1: 1
2: 2
3: 310
4: 9625

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022411448 Original CRISPR AGCCCAGGAATTTGAGGTTA CGG (reversed) Intronic
Too many off-targets to display for this crispr