ID: 1022411449

View in Genome Browser
Species Human (GRCh38)
Location 7:30141605-30141627
Sequence TGCTTCAGCCCAGGAATTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 34908
Summary {0: 8, 1: 341, 2: 3057, 3: 9484, 4: 22018}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022411449_1022411453 8 Left 1022411449 7:30141605-30141627 CCTCAAATTCCTGGGCTGAAGCA 0: 8
1: 341
2: 3057
3: 9484
4: 22018
Right 1022411453 7:30141636-30141658 CTTCATCCTGGCAAGTAGCCAGG 0: 1
1: 1
2: 2
3: 310
4: 9625
1022411449_1022411451 -4 Left 1022411449 7:30141605-30141627 CCTCAAATTCCTGGGCTGAAGCA 0: 8
1: 341
2: 3057
3: 9484
4: 22018
Right 1022411451 7:30141624-30141646 AGCAGCCTGCTGCTTCATCCTGG No data
1022411449_1022411455 16 Left 1022411449 7:30141605-30141627 CCTCAAATTCCTGGGCTGAAGCA 0: 8
1: 341
2: 3057
3: 9484
4: 22018
Right 1022411455 7:30141644-30141666 TGGCAAGTAGCCAGGACTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022411449 Original CRISPR TGCTTCAGCCCAGGAATTTG AGG (reversed) Intronic
Too many off-targets to display for this crispr