ID: 1022411450

View in Genome Browser
Species Human (GRCh38)
Location 7:30141614-30141636
Sequence GCAGCAGGCTGCTTCAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 771
Summary {0: 1, 1: 1, 2: 2, 3: 87, 4: 680}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022411450_1022411453 -1 Left 1022411450 7:30141614-30141636 CCTGGGCTGAAGCAGCCTGCTGC 0: 1
1: 1
2: 2
3: 87
4: 680
Right 1022411453 7:30141636-30141658 CTTCATCCTGGCAAGTAGCCAGG 0: 1
1: 1
2: 2
3: 310
4: 9625
1022411450_1022411455 7 Left 1022411450 7:30141614-30141636 CCTGGGCTGAAGCAGCCTGCTGC 0: 1
1: 1
2: 2
3: 87
4: 680
Right 1022411455 7:30141644-30141666 TGGCAAGTAGCCAGGACTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022411450 Original CRISPR GCAGCAGGCTGCTTCAGCCC AGG (reversed) Intronic
900136396 1:1119054-1119076 GCAGGAGGATCCTTGAGCCCGGG - Intergenic
900179533 1:1305152-1305174 GCACCAGGCTGCCCCAGCCAGGG + Intronic
900280269 1:1862685-1862707 GCAGCCGATTGCTTGAGCCCAGG - Intronic
900326320 1:2110294-2110316 GCTGGAGGCAGATTCAGCCCTGG - Intronic
900557443 1:3287538-3287560 GCAGGGGGCGGCTCCAGCCCCGG - Intronic
900557470 1:3287635-3287657 GCAGGGGGCGGCTCCAGCCCCGG - Intronic
900557510 1:3287779-3287801 GCAGGGGGCGGCTCCAGCCCCGG - Intronic
900557537 1:3287875-3287897 GCAGGGGGCGGCTCCAGCCCCGG - Intronic
901403777 1:9032349-9032371 GCAGCAGGGAGGTGCAGCCCAGG - Intergenic
901456391 1:9365342-9365364 ACAGAAGACTGCTTGAGCCCAGG - Intronic
901546873 1:9964443-9964465 GCAGGAGGATCCTTGAGCCCAGG + Intronic
901549670 1:9986652-9986674 GCAGCAGATTGTTTGAGCCCAGG + Intergenic
901746592 1:11377763-11377785 GCAGCAGGATCCTTGAGGCCAGG - Intergenic
901747821 1:11386140-11386162 GCAGGAGGATGCTTGAACCCAGG + Intergenic
901806611 1:11742756-11742778 GGAGAAGACTGCTTGAGCCCAGG - Intronic
901821858 1:11835500-11835522 CCAGCAGATTGCTTGAGCCCAGG - Intronic
901891573 1:12270806-12270828 GCAGGAGGATGCCTGAGCCCAGG - Intronic
902293465 1:15450174-15450196 GCAGAAGGATGCTTGAGCCCAGG + Intergenic
902778631 1:18690581-18690603 CCAGGAATCTGCTTCAGCCCTGG - Intronic
903134882 1:21302889-21302911 ACGGCAGGCTGCTGCTGCCCAGG - Intronic
903200501 1:21733882-21733904 GTAGGAGGATGCTTGAGCCCAGG - Intronic
903291923 1:22319398-22319420 GCAGCAAGGTCCTTCTGCCCTGG - Intergenic
903494873 1:23758976-23758998 GTAGGAGGGTGCTTGAGCCCAGG + Intronic
903503063 1:23812580-23812602 TGGGCAGGTTGCTTCAGCCCAGG - Intronic
903599819 1:24529177-24529199 GCAGAAGGATGCTTGAGCCCAGG + Intronic
903697007 1:25215130-25215152 GCAGGAGAATGCTTGAGCCCAGG + Intergenic
904417336 1:30371407-30371429 GGAGCAGGCTGGGTCATCCCTGG + Intergenic
904518920 1:31078868-31078890 GGGGCAGGATGCTTGAGCCCAGG + Intergenic
905113231 1:35613424-35613446 GCAGGAGGATCCTTAAGCCCCGG + Intronic
905606183 1:39302223-39302245 TAGGCAGGCTGCTTGAGCCCAGG - Intronic
905776751 1:40672771-40672793 GCAGAAGACTGCTTGAGTCCAGG + Intergenic
906026405 1:42677730-42677752 GCAGGAGGATGCTTGAGCCTAGG + Intergenic
906272021 1:44486992-44487014 GCAGCAAACTGCTTTAGCCCAGG + Intronic
906339153 1:44962998-44963020 TGAGCAGACTGCTTGAGCCCAGG + Intronic
906421944 1:45676371-45676393 TGAGCAGACTGCTTGAGCCCAGG + Intronic
907132891 1:52112452-52112474 GCAGGAGGATGCTTGAGCCCAGG - Intergenic
907279561 1:53337722-53337744 GCAGGAGGATCCTTGAGCCCAGG - Intergenic
907427476 1:54389628-54389650 GCAGGAGACTGCTTGAGGCCAGG + Intronic
908130635 1:61071829-61071851 GCAGGAGATTGCTTGAGCCCTGG - Intronic
908274691 1:62458056-62458078 GTGGGAGGATGCTTCAGCCCAGG + Intronic
908599114 1:65719686-65719708 GCACCAGGCTGCTGCTGCCAGGG + Intergenic
909593143 1:77374725-77374747 GCAGAATGTTGCTTGAGCCCAGG + Intronic
909697486 1:78484009-78484031 ACAGCAGGCAGCTGCAGCTCTGG - Intronic
910281576 1:85507273-85507295 TAAGCAGATTGCTTCAGCCCAGG + Intronic
910670205 1:89764580-89764602 GCAGCAGACAGCTTGGGCCCAGG + Intronic
911041355 1:93593441-93593463 CCAGGAGGTTGCTTGAGCCCAGG - Intronic
911799843 1:102122258-102122280 GCAGAAGATTGCTTGAGCCCAGG + Intergenic
912364554 1:109122429-109122451 CCAGCAGATTGCTTGAGCCCAGG + Intronic
912773107 1:112483088-112483110 GCAGGAGGATGCTTCAGCCTAGG + Intronic
913181818 1:116329786-116329808 GAAGCAGGCTGTGTGAGCCCGGG + Intergenic
913266797 1:117053085-117053107 GCGGCAGACTGCTTGAGCTCAGG + Intergenic
913596819 1:120386554-120386576 GGAGCTGCCTGCTTGAGCCCTGG + Intergenic
914090449 1:144492427-144492449 GGAGCTGCCTGCTTGAGCCCTGG - Intergenic
914308159 1:146441795-146441817 GGAGCTGCCTGCTTGAGCCCTGG + Intergenic
914593947 1:149131338-149131360 GGAGCTGCCTGCTTGAGCCCTGG - Intergenic
914710776 1:150211682-150211704 GCAGGAGACGGCTTGAGCCCAGG + Intergenic
914767030 1:150647398-150647420 GCAGGAGGATCCTTGAGCCCTGG + Exonic
914794174 1:150906069-150906091 GCAGAGGGTTGCTTGAGCCCAGG + Intergenic
914884205 1:151571976-151571998 GCAGGAGGATCCTTGAGCCCAGG + Intronic
915502832 1:156331259-156331281 GCAGGAGATTGCTTGAGCCCAGG + Intronic
915683493 1:157606222-157606244 GCTGCAGGCTTCTTCAGCTGAGG + Intergenic
916055244 1:161064662-161064684 GCAGGAGATTGCTTGAGCCCAGG + Intronic
916733375 1:167585916-167585938 GCAGGAGATTGCTTGAGCCCGGG - Intergenic
916745793 1:167683977-167683999 GGAGCAGGCGGCTGCAGCCAAGG + Exonic
918203124 1:182285889-182285911 GCAGGAGGTTGCTTGAGCCCAGG + Intergenic
918773078 1:188589402-188589424 GTGGGAGGCTGCTTGAGCCCAGG - Intergenic
919487670 1:198164011-198164033 TGAGCAGACTGCTTGAGCCCAGG + Intronic
919729904 1:200907051-200907073 GCAGCAGATGGCTTAAGCCCAGG - Intronic
920014585 1:202896277-202896299 GCAGAAGATTGCTTGAGCCCAGG - Intronic
920418449 1:205813628-205813650 GCGGCTGGCTGCTTGAGCCCGGG - Intronic
920919395 1:210285848-210285870 GGGGTCGGCTGCTTCAGCCCTGG + Intergenic
921191532 1:212713065-212713087 GCAGGAGATTGCTTGAGCCCAGG + Intergenic
921233962 1:213104844-213104866 GCAACAGGAGGCTTGAGCCCAGG - Intronic
922449319 1:225724044-225724066 GCAGAAGGTTGCTTGAGCTCAGG + Intergenic
922528170 1:226322327-226322349 CAAGCAGACTGCTTGAGCCCAGG - Intergenic
923084813 1:230695172-230695194 GCAGCAGGCTGCTGCAGCCCAGG - Intergenic
923180627 1:231515295-231515317 GCAGGAGGCCGCTTGAGCCCAGG - Intergenic
923342299 1:233018249-233018271 GCAAGAGGATGCTTGAGCCCAGG - Intronic
924350798 1:243112821-243112843 GCAGGAGGATGCTTGAGCCCAGG - Intergenic
924429684 1:243986342-243986364 GCAGGTGGATGCTTGAGCCCAGG - Intergenic
924569955 1:245228770-245228792 GTAGCAGGTTGCTTCACCCCTGG + Intronic
924826317 1:247542916-247542938 GCAGCAAGCTGCATGAGACCTGG + Intronic
1063569864 10:7205317-7205339 GCAGGAGAATGCTTGAGCCCAGG - Intronic
1063840490 10:10066077-10066099 GCAGGAGGATGCTTGAGCTCAGG - Intergenic
1064428386 10:15250528-15250550 GAGGCAGGTTGCTTGAGCCCAGG + Intronic
1064544571 10:16437570-16437592 GCAGCAGACTGATTGAGCCCAGG - Intronic
1064869418 10:19920783-19920805 CCAGCAGGTTGCTTGAGGCCAGG - Intronic
1065017273 10:21473753-21473775 GCTGAAGGGTGATTCAGCCCAGG - Intergenic
1065495231 10:26320828-26320850 ACAGGAGACTGCTTGAGCCCAGG + Intergenic
1065958555 10:30714705-30714727 GCAGGAGATTGCTTGAGCCCAGG - Intergenic
1066052172 10:31645871-31645893 CCAGAAGGTTGCTTGAGCCCAGG - Intergenic
1067580842 10:47444461-47444483 GCAGCAGGGGGCTTCAGCACAGG - Intergenic
1068000133 10:51323857-51323879 GCAGAAGATTGCTTGAGCCCAGG + Intronic
1070191713 10:74117558-74117580 GCAGGAGGATCCTTGAGCCCAGG + Intronic
1070440929 10:76442461-76442483 GCAGAAGACTGCTTGAGCCCAGG + Intronic
1070686670 10:78489837-78489859 ACAACAAGATGCTTCAGCCCTGG - Intergenic
1070840315 10:79482097-79482119 GCAGGAGAATGCTTCAACCCGGG + Intergenic
1072112562 10:92337027-92337049 GCAGAGGACTGCTTGAGCCCAGG + Intronic
1072250377 10:93577538-93577560 GCAGGAGGCAGATTCAGGCCTGG + Intronic
1072546160 10:96441167-96441189 GGAGAAGGCTGCCTCAGGCCTGG - Intronic
1073004270 10:100310239-100310261 GCAGGAGGGTGCTTGAGCCCAGG + Intronic
1073443558 10:103567475-103567497 GCAGGAGGATCCTTGAGCCCAGG - Intronic
1073465494 10:103692680-103692702 GCAGCCGGGTCCTTCACCCCCGG - Intronic
1073629435 10:105133711-105133733 GCAGAAGGCTGCTTGAGCCCAGG + Intronic
1074173357 10:110968707-110968729 GCAGGAGGATCCTTGAGCCCAGG + Intronic
1074205705 10:111281066-111281088 GAAGGAGGCTGCTTCAGGCATGG - Intergenic
1075483094 10:122798969-122798991 CCAGGAGCCAGCTTCAGCCCTGG + Intergenic
1075631999 10:124006057-124006079 GCCTCAGGCTGCTTCACGCCTGG - Intergenic
1075695218 10:124429541-124429563 GCAGGAGACTGCTTGAGCTCAGG - Intergenic
1075822612 10:125327700-125327722 GCAGGAGGATGTTTGAGCCCAGG + Intergenic
1075939823 10:126381408-126381430 GCAGGAGGATGCTTGAGCCCAGG + Intronic
1075970190 10:126645338-126645360 TGAGCAGGTTGCTTGAGCCCAGG + Intronic
1076025428 10:127108037-127108059 GCAGCAGCCTGCATCGGCCCTGG - Intronic
1076393373 10:130120477-130120499 CCAGGTGGCTGCTTTAGCCCGGG - Intergenic
1076765699 10:132631712-132631734 GCAGCACCCTGCTTCTGCCGCGG - Intronic
1077315869 11:1919175-1919197 GCCTCAGGCTGCTTCCTCCCCGG + Intergenic
1077323535 11:1953376-1953398 TCAGCAGGCTGCTTCTGAGCAGG + Intronic
1077408355 11:2392513-2392535 ACGGCAGGCTCCTCCAGCCCAGG - Intronic
1077430331 11:2513015-2513037 GAAGGAGGCTGCTCAAGCCCCGG + Intronic
1077490727 11:2859727-2859749 GCAGGAGGCATCTTCAGGCCCGG + Intergenic
1077512705 11:2977937-2977959 GCAGGAAACTGCTTGAGCCCAGG + Intronic
1078131001 11:8614108-8614130 GAAGCAGACTGCTTGAGCCCAGG + Exonic
1078148626 11:8740094-8740116 GCAGGAGGATCCTTGAGCCCAGG + Intronic
1078637482 11:13065608-13065630 GCAGCTGACGGCTTCAGACCTGG + Intergenic
1079116824 11:17645489-17645511 GCAGCAGGATGGGCCAGCCCAGG - Intronic
1080563903 11:33490550-33490572 CCAGCAGACTGCTTGAGCTCAGG - Intergenic
1081566705 11:44264963-44264985 GGAGCAGCCAGCCTCAGCCCAGG - Exonic
1083162161 11:60861260-60861282 GAAGCAGGCTGCCTCACTCCGGG - Intergenic
1083388854 11:62333536-62333558 GCAGGAGGATGCTTGAACCCGGG - Intergenic
1083464378 11:62835380-62835402 CCAGGAGGCTGCTTTATCCCAGG + Intronic
1083797906 11:65028594-65028616 GCAGCAGATTGCTTGAGCTCAGG + Intronic
1084063487 11:66690331-66690353 GCCGCAGCCTGCCTCAGTCCTGG + Intronic
1084275504 11:68049269-68049291 GCAACAGGCTGCTCTACCCCCGG + Exonic
1084338606 11:68476792-68476814 GCAGGAGGATGCTTGAGCCCAGG + Intronic
1084980277 11:72825200-72825222 GCAGCAGGCTGTGTCTGCACAGG + Intronic
1085099833 11:73791111-73791133 GCGGCAGATTGCTTGAGCCCAGG - Intronic
1085132554 11:74053900-74053922 GCAGGAGATTGCTTGAGCCCAGG + Intronic
1085401670 11:76239479-76239501 GCCTCAGGCTGCTTCATCTCAGG - Intergenic
1085504533 11:77049576-77049598 CCGGCAGGCTGCTGTAGCCCTGG - Intergenic
1085676306 11:78522044-78522066 GCAGGAGGGCGCTTAAGCCCAGG - Intronic
1085784930 11:79440513-79440535 GCTGCAGGCTGCTACCGCCGGGG + Exonic
1086344061 11:85877376-85877398 GCAGGAAGATGCTTGAGCCCAGG + Intronic
1086350445 11:85938513-85938535 GCAGAAGATTGCTTGAGCCCAGG + Intergenic
1087946292 11:104164262-104164284 GCAGCAGCGTTCTCCAGCCCCGG + Intronic
1087979827 11:104597814-104597836 GAGGCAGATTGCTTCAGCCCAGG + Intergenic
1088286858 11:108199022-108199044 GCTTCAGTCTGCTTCAGTCCTGG - Intronic
1088286917 11:108199341-108199363 CCAGCAGACTGCTTCTGGCCCGG - Intronic
1088496333 11:110434980-110435002 GCAGGGGACTGCTTGAGCCCAGG - Intronic
1088611865 11:111585144-111585166 GCACCACTGTGCTTCAGCCCAGG + Intergenic
1088826771 11:113502202-113502224 TCAGGAGGCTGCTTGAGCCTGGG + Intergenic
1089744123 11:120605061-120605083 GCGGGAGGTTGCTTGAGCCCAGG - Intronic
1090104228 11:123834942-123834964 GCGGGAGGATGCTTGAGCCCAGG - Intergenic
1090403194 11:126461920-126461942 GCAGGTGGCTGCTTCTGTCCTGG - Intronic
1090816527 11:130301819-130301841 TGGGCAGGCTGCTTGAGCCCAGG + Intronic
1090880497 11:130828121-130828143 GCTGGAGGCTGCTGCAGCTCTGG + Intergenic
1091282787 11:134391448-134391470 GCAGCCTGCTGCTTCTGCCTGGG + Exonic
1202806522 11_KI270721v1_random:8571-8593 TCAGCAGGCTGCTTCTGAGCAGG + Intergenic
1091822537 12:3487073-3487095 GTAGCTGGCTGCTGCAGCCTTGG + Intronic
1091837766 12:3597736-3597758 GAAGCAGGCCACTTCTGCCCAGG - Intergenic
1093250435 12:16796599-16796621 ACAGCAGGCTGTTTCATCTCTGG + Intergenic
1094112464 12:26876157-26876179 GAAGAGGGCTGCTTGAGCCCAGG - Intergenic
1094141783 12:27189015-27189037 GCAGGAGACTGCTTGAACCCTGG - Intergenic
1094188472 12:27671073-27671095 GCAGGAGACTGCTTGAGCCGAGG + Intronic
1094194778 12:27736967-27736989 GCAGGAGACTGCATAAGCCCAGG - Intronic
1094552641 12:31467394-31467416 GCAGAGGACTGCTTGAGCCCAGG + Intronic
1094704473 12:32900747-32900769 GCAGGAGGATGCTTGAGCCCAGG + Intergenic
1095290246 12:40470953-40470975 CCAGCAGACTGCTTGAGCCCAGG + Intronic
1096229178 12:49888013-49888035 ACAGCTGGCTGCTCCAGACCTGG - Intronic
1096304243 12:50460418-50460440 GCAGAAGACTGCTTGGGCCCAGG - Intronic
1096373863 12:51091211-51091233 GCAGGAGGATGCTTGAGCCCAGG + Intergenic
1096378338 12:51133537-51133559 GCGGCAGATTGCTTGAGCCCAGG - Intronic
1096454978 12:51777350-51777372 TGAGAAGGCTGCTTGAGCCCAGG - Intronic
1097069606 12:56345260-56345282 GCAGGAGACTGCTTGAGGCCAGG + Intronic
1097883447 12:64706510-64706532 GCAGCAGGAAGCTGCAGCTCCGG - Intergenic
1097990161 12:65825297-65825319 GCAGCCGTCCACTTCAGCCCAGG + Exonic
1098099008 12:66992883-66992905 CAGGCAGGCTGCTTCAGCTCAGG + Intergenic
1098337168 12:69416059-69416081 GCAGCTGGATCCTTCAGGCCTGG + Intergenic
1099049406 12:77765138-77765160 TCAGAAGTCTCCTTCAGCCCAGG - Intergenic
1100506109 12:95221753-95221775 GCAGAAGATTGCTTGAGCCCAGG + Intronic
1100573224 12:95862483-95862505 GCAGCAGATTGCTTGAGCCCAGG + Intronic
1101770111 12:107741623-107741645 GCAGGAAACTGCTTGAGCCCAGG + Intronic
1101771026 12:107751073-107751095 GCAGGAGGTTGCTTGAGCCCAGG - Intronic
1101841507 12:108330837-108330859 GCTGCAGGCTCCTGCAGCCTAGG + Intronic
1102284685 12:111646191-111646213 GCAGAGGACTGCTTGAGCCCAGG + Intronic
1102367781 12:112354286-112354308 GCAGGAGGATGCTTGAGCCTAGG - Intronic
1102714466 12:114958129-114958151 GTAGGAGGCTGCTTGAGGCCAGG - Intergenic
1103409744 12:120702419-120702441 CCAGCAGATTGCTTGAGCCCAGG + Intergenic
1103837266 12:123832568-123832590 TGAGCAGACTGCTTGAGCCCAGG - Intronic
1103952098 12:124556947-124556969 GCACCAGGCAGCTTCCGCCACGG - Intronic
1104057556 12:125242241-125242263 GCAGGAGGATTCTTGAGCCCAGG - Intronic
1104242722 12:127006213-127006235 GCAGCAGGGTGCTTCTACCTCGG - Intergenic
1105777863 13:23679846-23679868 GCAGGAGGATCCTTGAGCCCAGG + Intergenic
1105877183 13:24567480-24567502 CCAGCAAACTGCTTGAGCCCAGG - Intergenic
1105887602 13:24655424-24655446 GCAGGGGATTGCTTCAGCCCAGG + Intergenic
1106129700 13:26930134-26930156 GCTGGAGGATGCTTCAGCCCAGG + Intergenic
1106474541 13:30087079-30087101 GCAGGAGGATGCTTGAGCCCAGG + Intergenic
1106682991 13:32027541-32027563 GCAGTGGGCTGCTTCTACCCTGG - Intergenic
1107175633 13:37395145-37395167 AAAGCAGGCTGCTGCAGCCATGG - Intergenic
1107993957 13:45842574-45842596 GCAGAAGGATTCTTGAGCCCAGG - Intronic
1108339813 13:49487568-49487590 GCAGGAGGATGCTTGAGGCCAGG - Intronic
1108379980 13:49846265-49846287 GAAGGAGGCTGCCACAGCCCTGG + Intergenic
1108488349 13:50952064-50952086 GCAGAAGGTCGCTTGAGCCCAGG + Intronic
1108576935 13:51798994-51799016 GCGGGAGGCTGCTCTAGCCCTGG + Intronic
1109164795 13:59020599-59020621 CGAGCAGGTTGCTTGAGCCCAGG + Intergenic
1109642720 13:65211336-65211358 TCAGCAGATTGCTTGAGCCCAGG - Intergenic
1110122685 13:71902847-71902869 TCAGCAGGGTGCTGCAGGCCAGG + Intergenic
1110177491 13:72574324-72574346 GCAGATTGCTGCTTGAGCCCAGG + Intergenic
1110630242 13:77698370-77698392 GCAGCAGGCTTCTTCGGCGCGGG + Intronic
1111235712 13:85405423-85405445 CCAACTGGCTGCTTCAGCACAGG + Intergenic
1111965694 13:94859333-94859355 GCAGCAGGCTCCCTCTTCCCTGG - Intergenic
1113729252 13:112627830-112627852 GCAGGAAGCTGCTTGAGGCCAGG - Intergenic
1114255358 14:20996929-20996951 ATACCAGGCAGCTTCAGCCCTGG - Exonic
1114474427 14:22983713-22983735 GCGCCCGGCTGCTTCAGCCAGGG - Intergenic
1115185007 14:30677253-30677275 GCAGGAGGATCCTTGAGCCCAGG - Intronic
1115316738 14:32032834-32032856 GCAGAAGGATCCTTGAGCCCAGG + Intergenic
1115483274 14:33883711-33883733 GCAGGAGGATGCTTGAACCCAGG - Intergenic
1115560761 14:34580750-34580772 GCAGGAGGATGCTTGAGCTCAGG - Intronic
1115590050 14:34855663-34855685 CTAGCAGACTGCTTGAGCCCAGG + Intronic
1115625309 14:35186212-35186234 ACAGCAGGCAACTTAAGCCCAGG - Intronic
1117030976 14:51670166-51670188 GCAGAGGACTGCTTGAGCCCAGG - Intronic
1117129183 14:52667488-52667510 GGGGCAGACTGCTTGAGCCCAGG + Intronic
1117709395 14:58509125-58509147 GCAGCAGATTGCTTGTGCCCGGG + Intronic
1118044498 14:61952014-61952036 GCAGAAGGACGCTTGAGCCCAGG - Intergenic
1118585061 14:67344786-67344808 GCGGGAGACTGCTTGAGCCCAGG + Intronic
1118651069 14:67895000-67895022 TGGGCAGACTGCTTCAGCCCAGG - Intronic
1118717341 14:68569761-68569783 GATGCAGGCTGCTTCAGGCCCGG - Intronic
1118871707 14:69748467-69748489 CCAGGAGACTGCTTGAGCCCAGG - Intronic
1119269920 14:73294297-73294319 GCGGGAGGATGCTTGAGCCCTGG - Intronic
1119296158 14:73534870-73534892 GCAGGAGATTGCTTGAGCCCAGG - Intronic
1119300095 14:73564793-73564815 GCAGGAGATTGCTTGAGCCCAGG - Intergenic
1119759598 14:77141335-77141357 TCGGCAGGCAGCCTCAGCCCTGG + Intronic
1120192325 14:81450453-81450475 GCAGCTGACTGCCTCACCCCTGG + Intergenic
1120989446 14:90362259-90362281 GCAGGAGGATCCTTAAGCCCAGG + Intergenic
1121206553 14:92173768-92173790 GCAGCAGGATCACTCAGCCCAGG - Intergenic
1121629118 14:95409788-95409810 CCTGCAGGCTGCTTCAGCAGAGG - Intronic
1121947517 14:98137236-98137258 CCAGCAGGATGCTGCAGCCTCGG - Intergenic
1122131570 14:99606864-99606886 TCAGGACGCTGTTTCAGCCCTGG - Intergenic
1122414145 14:101540788-101540810 GCCACAGGCTGGTTCAGCTCAGG + Intergenic
1122469955 14:101959735-101959757 GCAGGAGGCTCCTTGAGCCCAGG + Intergenic
1122471746 14:101972507-101972529 GTAGAATGCTGCTTCAGCTCAGG - Intronic
1122627076 14:103090252-103090274 GGAGGAGGCTGGTTCTGCCCTGG - Intergenic
1123195245 14:106610009-106610031 GCCCCAGGCTGCTTCACCTCAGG + Intergenic
1124604626 15:31161135-31161157 GCCGGAGGCTGGTTCAGCCTAGG + Exonic
1125595460 15:40882712-40882734 GCAGGAGGATTCTTGAGCCCAGG - Intergenic
1125836556 15:42756802-42756824 GCAGAAGATTGCTTGAGCCCAGG + Intronic
1126111846 15:45179817-45179839 CCAGCTGGCTCCTACAGCCCTGG - Intronic
1126126643 15:45300019-45300041 ACAGGAGGTTGCTTGAGCCCAGG - Intergenic
1126220491 15:46207649-46207671 GGATAAGTCTGCTTCAGCCCTGG - Intergenic
1126443105 15:48713006-48713028 GCAGGAGGATACTTGAGCCCAGG - Intronic
1126666928 15:51083793-51083815 GCAGAAGGCTGGATCACCCCAGG + Intronic
1127425377 15:58850812-58850834 CAGGCAGGCTGCTTGAGCCCAGG - Intronic
1128100485 15:64994849-64994871 GCAGGAGGATACTTGAGCCCAGG + Intergenic
1128306598 15:66603091-66603113 GCAGAAGATTGCTTGAGCCCAGG + Intronic
1128880340 15:71236739-71236761 GCTGCAGGCTCCTTCAGGGCAGG - Intronic
1129092381 15:73165019-73165041 GCAGGAGACTGCTTGAGCCCAGG - Intronic
1129269192 15:74410581-74410603 GCCTCAGGCTTCTGCAGCCCAGG - Exonic
1129968128 15:79754969-79754991 GCGGCAGATTGCTTGAGCCCAGG + Intergenic
1130139434 15:81211613-81211635 GCGGCAGATTGCTTAAGCCCAGG - Intronic
1130330569 15:82919003-82919025 TCAGCAGGCTACTTCTTCCCAGG - Intronic
1130980464 15:88808754-88808776 GCAGCAGGGTGTCTCAGCCTTGG - Intronic
1131568330 15:93506475-93506497 GCAGCAGGAAGCATCATCCCAGG - Intergenic
1132175513 15:99711088-99711110 GCAGTAGGCAGCTTCATCACTGG - Intronic
1132380420 15:101362353-101362375 GCAGGAGGCTGCTGCAGAGCAGG + Intronic
1132488087 16:207443-207465 GGGGCAGACTGCTTGAGCCCAGG - Intronic
1132538871 16:498214-498236 GCACCACGGTACTTCAGCCCAGG - Intronic
1132782361 16:1634572-1634594 ACAGCAGGCTCCTACAGCCTTGG + Intronic
1133776260 16:8897632-8897654 GCAGAAGGATGCTTGAGCCCAGG + Intronic
1133906242 16:10025393-10025415 GCAGGAGGATGCCTGAGCCCAGG - Intronic
1133933412 16:10250343-10250365 GCAGGAGGCTGCAGCTGCCCTGG - Intergenic
1133943208 16:10327603-10327625 GCAGGAGGATCCTTAAGCCCAGG - Intronic
1134088757 16:11378162-11378184 CCAGGAGACTGCTTGAGCCCAGG - Intronic
1134413513 16:14023208-14023230 GCAGGAGGTTGCTTGAGCCCAGG + Intergenic
1134543373 16:15088246-15088268 GGAGGAGACTGCTTGAGCCCAGG + Intronic
1135051827 16:19199510-19199532 GCAGGAGGATGCTTGAGGCCAGG + Intronic
1135686659 16:24503284-24503306 GCAGGAGGCTGACTGAGCCCAGG - Intergenic
1136522725 16:30807457-30807479 GCAGAAGATTGCTTGAGCCCAGG - Intergenic
1137308373 16:47228596-47228618 GCAGAAGACTGCCTGAGCCCAGG - Intronic
1137600995 16:49756205-49756227 GGGGCAGCCTGCATCAGCCCAGG + Intronic
1137651426 16:50123966-50123988 GCAGCAGCTTGCTTCAGGCCAGG + Intergenic
1138018606 16:53455939-53455961 GCAGAAGACTGCCTGAGCCCAGG + Intronic
1138225570 16:55291605-55291627 GCAGGAGGATTCTTGAGCCCTGG - Intergenic
1138359225 16:56412764-56412786 GGAGGAGACTGCTTGAGCCCAGG + Intronic
1138763095 16:59567609-59567631 CCACCCGGCTGCTCCAGCCCAGG + Intergenic
1139495781 16:67316265-67316287 GCAGGAGGATTCTTGAGCCCAGG - Intronic
1139614212 16:68079285-68079307 ACGGCTGGCTGCTTCAGCCTTGG + Exonic
1139766403 16:69234101-69234123 GCAGCAGATTGCTTGAGCCTAGG + Intronic
1139771764 16:69283035-69283057 GTAGAAGGTTGCTTGAGCCCAGG - Intronic
1139843022 16:69897328-69897350 GGAGCAGATTGCTTGAGCCCAGG - Intronic
1140453706 16:75092069-75092091 GCAGGAGACTGTTTGAGCCCAGG + Intronic
1140673657 16:77304366-77304388 GCAGGGGGCTGCTTGAGCTCAGG + Intronic
1140907516 16:79421727-79421749 ACAGGAGGATGCTTGAGCCCAGG - Intergenic
1141930400 16:87198405-87198427 GCCACAGGATGCTTCTGCCCAGG - Intronic
1141958179 16:87386166-87386188 ACAGGAGGCTGGTTCAGTCCAGG + Intronic
1142294893 16:89214239-89214261 GCAGGAGGATGATTGAGCCCAGG + Intergenic
1142302016 16:89264384-89264406 GCAGGAGGATGCTTGAGCCCAGG - Intergenic
1142404839 16:89882442-89882464 GCAGGAGGATGCTTGAACCCAGG + Intronic
1143405730 17:6676222-6676244 ACTGCACACTGCTTCAGCCCCGG + Intergenic
1143649016 17:8251512-8251534 GCAGTGGACTGCTTGAGCCCAGG - Intronic
1143736859 17:8916969-8916991 GAAGCAGGCTGGGTCAGCCCAGG - Intronic
1143863594 17:9908414-9908436 GTACCAGGCTGCTTCCGACCTGG - Intergenic
1144451915 17:15388315-15388337 GGACCAGGATGCTTCAGCCCTGG - Intergenic
1146078759 17:29757951-29757973 CAAGAAGGCTGCTTGAGCCCAGG + Intronic
1146338494 17:31997220-31997242 GAAACAGGCTGCTGCAACCCTGG + Intronic
1146339893 17:32009499-32009521 GCAGCAGATCGCTTGAGCCCAGG - Intronic
1146414163 17:32616399-32616421 GCAGAGGACTGCTTGAGCCCAGG - Intronic
1146783601 17:35698539-35698561 GCAGAAGACTGCTTGAGCCCAGG - Intronic
1147360732 17:39927988-39928010 GCACCTGGCTGCCTCCGCCCTGG + Intergenic
1147437584 17:40426946-40426968 GCAGGAGGATCCTTGAGCCCAGG - Intergenic
1147724699 17:42559478-42559500 GCAGAGGACTGCTTGAGCCCAGG + Intergenic
1148273161 17:46279721-46279743 GCAGGAGGATGCTTGAGCCCAGG - Intronic
1149232788 17:54554718-54554740 ACAGGGGACTGCTTCAGCCCAGG + Intergenic
1149251088 17:54770192-54770214 GCAGCAGTCTGCTTGTGCACAGG + Intergenic
1149479421 17:56990725-56990747 GCAGGAGGATACTTGAGCCCAGG - Intronic
1149602239 17:57900362-57900384 GCAGCAGGCTGTTTCTGCAGAGG - Intronic
1149916699 17:60615917-60615939 GCAGGAGGATGCTTGAGCCCAGG - Intronic
1150183679 17:63156785-63156807 GCAGAAGGTTGCTTGAGCCCAGG - Intronic
1150196551 17:63305068-63305090 ACAGCAGGCAGCTGCAGCCGTGG + Intronic
1150421215 17:65037702-65037724 GAGGCAGACTGCTTGAGCCCAGG + Intronic
1150438641 17:65173637-65173659 GCAGCAGGCACTTTCTGCCCTGG - Intronic
1150504233 17:65681905-65681927 CAAGCAGGCTGCTTGAGCCCAGG - Intronic
1150620145 17:66801991-66802013 CCAGCAGATTGCTTGAGCCCAGG + Intronic
1150762942 17:67978946-67978968 GCAAGAGGATGCTTGAGCCCAGG + Intronic
1151137273 17:71958907-71958929 GGAGAAGACTGCTTGAGCCCAGG + Intergenic
1151229121 17:72669764-72669786 GGGGCAGACTGCTTGAGCCCAGG + Intronic
1151605841 17:75135070-75135092 GCAAGAGGATGCTTGAGCCCAGG - Intergenic
1152076556 17:78163636-78163658 GCAGAAGATTGCTTGAGCCCAGG + Intronic
1152082643 17:78197887-78197909 GCAGGAGGACGCTTGAGCCCAGG + Intronic
1152097113 17:78278747-78278769 TCAGCAGGCTGCACCAACCCTGG - Intergenic
1152159933 17:78661540-78661562 ACCGCAGGCTGCTTCATGCCAGG - Intergenic
1152229108 17:79105871-79105893 GCAGCTGGGTGGCTCAGCCCAGG - Intronic
1152348051 17:79766540-79766562 GCAGGAAGATGCTTGAGCCCAGG - Intergenic
1152576408 17:81143226-81143248 GCTGCAGGCGGCTTCCGCCTGGG - Intronic
1152905919 17:82970894-82970916 GCCTCAGGCTGCTTTAACCCGGG + Intronic
1152930344 17:83106128-83106150 GCAGCCTGCATCTTCAGCCCTGG + Intergenic
1153266090 18:3270897-3270919 CCAGAAGACTGCTTGAGCCCAGG - Intronic
1153786789 18:8542901-8542923 GCAGGTGATTGCTTCAGCCCAGG + Intergenic
1154211381 18:12381604-12381626 GCAGTAGGCTGCTTGAGACCAGG - Intergenic
1154233825 18:12583695-12583717 TGAGCAGACTGCTTGAGCCCAGG + Intronic
1154306345 18:13233584-13233606 CCAGCAGGCTGCATCACCCAGGG - Intronic
1154339633 18:13492444-13492466 GGAGCAGGCAGATTCAGACCCGG - Intronic
1154343978 18:13527432-13527454 GCAACAGGCTCCCTCGGCCCAGG - Intronic
1155121008 18:22818562-22818584 GCAGCAGACTGCTTGATGCCTGG + Intronic
1155208472 18:23580794-23580816 GCAGCAGGCAGCTTAATCTCTGG - Intronic
1156997796 18:43489191-43489213 GCAGGAGATTGCTTGAGCCCAGG + Intergenic
1157165796 18:45357381-45357403 GCAGGAGGATACTTGAGCCCAGG + Intronic
1157786222 18:50485458-50485480 GCAGCATGCAGCTTAAGCCAAGG + Intergenic
1158814053 18:61073488-61073510 GCAGCTGGCTGCTACAGCAATGG - Intergenic
1158938753 18:62388020-62388042 GCAGGAGGATGCTTGAGTCCAGG + Exonic
1158979767 18:62748472-62748494 CCGGCAGACTGCTTGAGCCCAGG - Intronic
1160662152 19:306198-306220 GCCGCGGGCTGCCCCAGCCCTGG - Exonic
1160937457 19:1603764-1603786 GGAGCAGGCTTCCTCATCCCAGG + Intronic
1161426482 19:4206386-4206408 GCGGCAGATTGCTTGAGCCCAGG + Intronic
1161948884 19:7456208-7456230 GCAGCATGATGCTTCTGCCTGGG - Intronic
1162154285 19:8666310-8666332 GCAGGAGGTTGCTTGAGCCCAGG - Intergenic
1162172531 19:8802740-8802762 GCAGGAGATTGCTTGAGCCCAGG - Intergenic
1162401871 19:10451320-10451342 ACACCAGGCTCCTCCAGCCCTGG - Intronic
1162458681 19:10801523-10801545 GCAGGGGGTTGCTTGAGCCCAGG + Intronic
1162470521 19:10870101-10870123 GCAGGGGGTTGCTTGAGCCCAGG + Intergenic
1162491924 19:10997693-10997715 GCAGGAGGATGCCTGAGCCCAGG - Intronic
1162613016 19:11770814-11770836 TCAGCAGACTGCTTGAGCCCAGG - Intronic
1163293802 19:16398887-16398909 GCAGGAGGATCCTTGAGCCCGGG - Intronic
1163563338 19:18034219-18034241 GCAGGAGGATCCTTGAGCCCAGG + Intergenic
1163694302 19:18755828-18755850 GCAGAGGACTGCTTGAGCCCAGG - Intronic
1163804868 19:19389601-19389623 GCAGGAGGCTGCTGCAGACTTGG + Intronic
1164928546 19:32152467-32152489 GCAGGAGGTTGCTTGAACCCAGG - Intergenic
1165242379 19:34479233-34479255 GCGGGAGGATGCTTGAGCCCAGG - Intergenic
1165400296 19:35595343-35595365 GCAGGAGGTTGTTTGAGCCCAGG + Intergenic
1166101333 19:40573078-40573100 GCAGGAGACTGCTTGAGCCCAGG + Intronic
1166174696 19:41059049-41059071 GCTGGAGGTTGCTTGAGCCCAGG - Intergenic
1166208735 19:41291522-41291544 GCAGGAGGATGCTTGAGGCCAGG - Intronic
1168014037 19:53557045-53557067 GCAGCAGATTGCTTGAGCTCAGG - Intronic
1168030336 19:53674623-53674645 GCAGGAGGATGCTTGAGCCCCGG - Intergenic
1168216453 19:54929657-54929679 GCAGCATGCTGCTGAAGTCCAGG + Intronic
1168315737 19:55484068-55484090 GCAGGCGGCTCCGTCAGCCCAGG - Exonic
1168474425 19:56665558-56665580 GCAGGTGGTTGCTTGAGCCCAGG + Intronic
1168541473 19:57214578-57214600 CAAGCAGGTTGCTTGAGCCCAGG - Exonic
1202647156 1_KI270706v1_random:152999-153021 GCAGAAGGCGGCTGCAGCTCGGG + Intergenic
925527498 2:4819108-4819130 GTAGGAGGATGCTTGAGCCCTGG - Intergenic
925605512 2:5655924-5655946 GGAGCTGCCTGCTTGAGCCCTGG + Intergenic
925987826 2:9230529-9230551 GCAGGAGGCTGAGTCTGCCCAGG - Intronic
926326914 2:11792897-11792919 CCAGCAGGCTGCTCCTGCTCTGG + Intronic
927526265 2:23743852-23743874 GCAGAAGGATCCTTGAGCCCAGG - Intergenic
927934738 2:27070085-27070107 GTTGCAGGCTGCCTCAGGCCAGG + Exonic
928500103 2:31882223-31882245 GCAGGAGATTGCTTAAGCCCAGG + Intronic
928567531 2:32568397-32568419 GCAGGAGGATCCTTGAGCCCAGG + Intronic
928589271 2:32797403-32797425 CGGGCAGGCTGCTTGAGCCCAGG - Intronic
929685108 2:44026686-44026708 GCAGCAGATTGCTTGAGCTCAGG + Intergenic
929800026 2:45092071-45092093 GCAGCGGATTGCTTGAGCCCAGG - Intergenic
930515493 2:52402243-52402265 CCAGCTGGCTGCTTCAGCACTGG - Intergenic
930771242 2:55132582-55132604 GAGGCAGGCTGCTTGAGCCCAGG + Intergenic
931409591 2:62016435-62016457 GCAGTGGCTTGCTTCAGCCCAGG - Intronic
931422768 2:62143371-62143393 GCAGGAGGATCCTTGAGCCCAGG + Intronic
931465173 2:62479656-62479678 CCAGCAGACTGCTTGAGCCCAGG + Intergenic
931696213 2:64872656-64872678 ACAGGAGGATGCTTGAGCCCGGG - Intergenic
931875268 2:66505184-66505206 GCAGGAGGTTGCTTGAGGCCAGG + Intronic
932164161 2:69491028-69491050 GCAGGAGGATCCTTGAGCCCAGG - Intronic
932717848 2:74115784-74115806 TGGGCAGACTGCTTCAGCCCAGG + Intergenic
933794021 2:85905948-85905970 GCATGAGGCTGCATCAGCCAGGG - Intergenic
933905841 2:86891578-86891600 CAAGCAGGTTGCTTGAGCCCAGG - Intergenic
934124398 2:88872563-88872585 GCAGGAGGAAGCTTGAGCCCAGG + Intergenic
934164179 2:89279361-89279383 GCAGCAGAATCCTCCAGCCCAGG - Intergenic
934203095 2:89903166-89903188 GCAGCAGAATCCTCCAGCCCAGG + Intergenic
934515835 2:94985855-94985877 GCCTCAGGCTTCCTCAGCCCTGG + Intergenic
934704672 2:96468638-96468660 GCAGGAGGATGCTTGAGCTCAGG - Intergenic
934934689 2:98456425-98456447 GCAGGAGGATGCTTGAGCCCAGG - Intronic
935766684 2:106374739-106374761 CAAGCAGGTTGCTTGAGCCCAGG - Intergenic
935867478 2:107406069-107406091 GCAGGATGATGCTTGAGCCCAGG - Intergenic
936082946 2:109447243-109447265 ACAGCAGGCTGCCTAAGTCCCGG + Intronic
936151968 2:110026991-110027013 GCACCAGGCTCCTTCTGCCTTGG - Intergenic
936192710 2:110344422-110344444 GCACCAGGCTCCTTCTGCCTTGG + Intergenic
936366321 2:111860068-111860090 CAAGCAGGTTGCTTGAGCCCAGG + Intronic
936822716 2:116542572-116542594 GCAGAAGTCTGCTTCAGGGCTGG - Intergenic
938081511 2:128372821-128372843 GCGGCAGGCAGCTGCAGCCCAGG - Intergenic
938496673 2:131801581-131801603 GCAGCAGCCTGTCTCAGCCGCGG - Exonic
939635003 2:144571354-144571376 GAAGCAGGCTTCTGCAGCCTGGG - Intergenic
940481157 2:154232945-154232967 GTAGAAGGATGCTTGAGCCCAGG + Intronic
941752567 2:169148533-169148555 GCAGGGGACTGCTTGAGCCCAGG + Intronic
942011016 2:171762357-171762379 GCTGCAGGCTGGTTCTCCCCTGG - Intergenic
942514365 2:176736723-176736745 GCAGCAGAATGCTTGAACCCGGG - Intergenic
943216559 2:185044550-185044572 ACAGCAGTCAGCTACAGCCCAGG + Intergenic
943638044 2:190327480-190327502 GCAGCAGGTGGTCTCAGCCCTGG - Intronic
944071285 2:195672356-195672378 GCAGGAGGATGGTTGAGCCCAGG - Intronic
944221846 2:197310892-197310914 GCAGGAGGCAGCGTCGGCCCAGG - Intronic
944773032 2:202933102-202933124 GCAGGATACTGCTTCAGCTCTGG + Intronic
945410021 2:209497008-209497030 GCAGAAGACTGCTTGAGGCCAGG - Intronic
946018826 2:216625589-216625611 GTAGGAGGATGCTTGAGCCCAGG - Intergenic
947223922 2:227821905-227821927 GCAGGAGGATGCTTGAGCCCAGG - Intergenic
947979732 2:234398744-234398766 GGTGCAGGCAGCTGCAGCCCAGG + Intergenic
948463578 2:238141775-238141797 GCTGCAGGCTCCTTCAGGACAGG - Intronic
948684969 2:239664593-239664615 CCATCATGATGCTTCAGCCCTGG - Intergenic
948956662 2:241298135-241298157 GCAGGAGGCTGCCTGAGCTCAGG + Intronic
1168856746 20:1014050-1014072 GCAGGAGGCTGCGGCAGACCTGG - Intergenic
1169120749 20:3094221-3094243 GCAGGAGGATGCTTGAGCCCAGG + Intergenic
1169452692 20:5725759-5725781 GCAGGAGACTGCTTAAGTCCAGG + Intergenic
1170567016 20:17613240-17613262 GCAGTGGGCTGCTCCAGCCCTGG + Intergenic
1170653450 20:18264077-18264099 GCATCAGACTACTGCAGCCCTGG + Intergenic
1170892987 20:20391709-20391731 TCAGAAGGCTTCTTCAGGCCTGG + Intronic
1171207299 20:23290927-23290949 ATAGGAGGCTGCTACAGCCCAGG - Intergenic
1171263946 20:23755193-23755215 GCTGCTGGCTGCTGCAGCCAGGG + Intergenic
1171273141 20:23832039-23832061 GCTGCTGGCTGCTGCAGCCAGGG + Intergenic
1172555640 20:35838758-35838780 GCAGGAGGATACTTGAGCCCAGG + Intronic
1172742841 20:37182621-37182643 GCAGGCGGATGCTTGAGCCCAGG - Intronic
1173211359 20:41035117-41035139 TGGGCAGGCTGCTTGAGCCCAGG - Intronic
1174663936 20:52239579-52239601 GCTGTAGCCTGCTACAGCCCAGG + Intergenic
1174666970 20:52267500-52267522 GCAGGAGGATCCTTGAGCCCAGG + Intergenic
1175185390 20:57176465-57176487 ACGGCAGTCTGCTTGAGCCCAGG + Intronic
1175813162 20:61869746-61869768 GCAGCAGGCCCCTTCCGCCGAGG + Intronic
1176226098 20:64000412-64000434 GCACCATGCTGCTCCAGCCTGGG + Intronic
1176248218 20:64107507-64107529 CCTGCTGGCTGCCTCAGCCCCGG + Intergenic
1176604714 21:8819775-8819797 GCAGAAGGCGGCTGCAGCTCGGG - Intergenic
1176692905 21:9938932-9938954 GCAGGAGGATACTTGAGCCCAGG - Intergenic
1176949626 21:15029721-15029743 GCAGGAGATTGCTTGAGCCCAGG + Intronic
1177280609 21:18977366-18977388 GTAGGAGGATGCTTGAGCCCAGG + Intergenic
1178696060 21:34793229-34793251 TCAGGAGGCTGCTACTGCCCAGG + Intronic
1179631256 21:42680061-42680083 GCTGCAGGCTGCGAGAGCCCAGG - Intronic
1179998632 21:44985227-44985249 GTAGCAGGCAGCTTCCGGCCAGG + Intergenic
1180004635 21:45014642-45014664 GAAGCTGGCAGGTTCAGCCCGGG + Intergenic
1180053996 21:45347795-45347817 GCAGGAGGCTGCCTCGGCTCAGG - Intergenic
1180060249 21:45381384-45381406 CCTGGAGGCTGCTTCAGTCCAGG - Intergenic
1180347004 22:11711380-11711402 GCAGAAGGCGGCTGCAGCTCGGG - Intergenic
1180354751 22:11829470-11829492 GCAGAAGGCGGCTGCAGCTCGGG - Intergenic
1181097961 22:20519079-20519101 GCAGCAGATCGCTTGAGCCCAGG - Intronic
1181154484 22:20910403-20910425 ACAGCAGACTGCTTGAGCCCAGG + Intergenic
1181746572 22:24958886-24958908 GCAGCAGACTGCTTGAACCTGGG + Intronic
1182041479 22:27241943-27241965 GCAGGAGGCAGCTGGAGCCCTGG - Intergenic
1182475972 22:30576549-30576571 GCTGCAGGCTGGGCCAGCCCTGG - Intergenic
1182635045 22:31719317-31719339 GCAGGAGGATGCTTGAGCCCAGG + Intronic
1182635622 22:31724492-31724514 GCAGAAGGATACTTGAGCCCTGG - Intronic
1183148025 22:36013178-36013200 GCAGAGGACTGCTTGAGCCCAGG + Intronic
1183316934 22:37142014-37142036 GGAGCTGGATGCTCCAGCCCTGG - Intronic
1183513430 22:38249240-38249262 GCAGGAGGATTCTTGAGCCCGGG - Intronic
1183907538 22:41053397-41053419 GCAGGTGGTTGCTTTAGCCCAGG - Intergenic
1183914557 22:41106822-41106844 AAGGCAGGCTGCTTGAGCCCAGG - Intronic
1183992343 22:41606132-41606154 GCAGTAGATTGCTTGAGCCCAGG + Intronic
1184463520 22:44655049-44655071 GCAGCAGATTGCTTGAGCCCAGG + Intergenic
1184786561 22:46674795-46674817 GCAGGAGGCTGCCTAGGCCCTGG + Intronic
1185340249 22:50287802-50287824 GCAGGGGGCGGCCTCAGCCCAGG + Intronic
950005441 3:9688303-9688325 GCAGAAGTCTGCTTCCGGCCTGG + Intronic
950393601 3:12716394-12716416 GCAGAAGATTGCTTGAGCCCAGG - Intergenic
951777561 3:26326257-26326279 ACAGAAAGCTGCTTCAGCCAAGG + Intergenic
952858668 3:37794215-37794237 CCAGCAGGCTCCTTCACTCCCGG - Intronic
952962620 3:38602272-38602294 GAACCAGGCAGGTTCAGCCCTGG - Intronic
953443828 3:42944928-42944950 GCAGGAGGTTGCTTGAGCTCAGG + Intronic
953953412 3:47211082-47211104 GCAAGAGACTGCTTGAGCCCAGG + Intergenic
954981891 3:54753477-54753499 GCAGCAGCCTTCATCAGCCTGGG + Intronic
955201758 3:56858013-56858035 GTGGCAGACTGCTTGAGCCCAGG + Intronic
956990140 3:74752492-74752514 GCAGCAGGGAGGTGCAGCCCAGG - Intergenic
958513038 3:95073554-95073576 GCAGGAGGAGGCTTGAGCCCAGG + Intergenic
958793335 3:98678838-98678860 CCAGCAGATTGCTTGAGCCCAGG - Intergenic
959109593 3:102105893-102105915 GCAAGAGGTTGCTTCAACCCAGG - Intronic
959219398 3:103497089-103497111 GCATCAGGCTTCTGCAGCACAGG + Intergenic
959992438 3:112644302-112644324 GCAGGGTGCTGCTGCAGCCCAGG + Intronic
960049866 3:113229047-113229069 GCAGCAGGCAGCTTCATTCCTGG + Intronic
960110685 3:113841738-113841760 GCACCATTGTGCTTCAGCCCAGG - Intronic
960993375 3:123325835-123325857 GCAGCTGGGTGCGTCAGCTCAGG - Intronic
961506223 3:127372113-127372135 ACAGCAGGGTGCTTCAGCGAGGG - Intergenic
961507014 3:127376768-127376790 CCAGAAGGCTGCTCCAGCTCTGG - Intergenic
961645183 3:128389077-128389099 ACCGCAGGCTGCCTCGGCCCAGG - Intronic
963067350 3:141274240-141274262 GCTGCAGGCCGCCTCTGCCCTGG - Intronic
963333284 3:143940871-143940893 GCAGCAAGATGCTTGAGGCCAGG + Intergenic
963437452 3:145289333-145289355 GCAGAATGCTGCTTCAACTCTGG + Intergenic
963650142 3:147968988-147969010 GCAGCAAATTGCTTGAGCCCAGG + Intergenic
963946565 3:151152190-151152212 TCAGAAGGCCGCTTGAGCCCAGG - Intronic
967885191 3:194328817-194328839 GCAGCACGCTACTCCAGCACAGG - Intergenic
968154404 3:196367539-196367561 TGAGAAGGCTGCTTCAGCCCAGG + Intronic
968485880 4:861360-861382 GAAGGAGGGTGCTTGAGCCCAGG + Intronic
968764096 4:2459128-2459150 GCAGGGGGCTGCTGCAGCGCAGG + Exonic
968813890 4:2812026-2812048 GCAGCAGGGAGCTTCCTCCCAGG + Intronic
969274104 4:6123590-6123612 GCAGGAGGATGGTTGAGCCCAGG + Intronic
969413061 4:7042464-7042486 GGAAGAGGCTGCTGCAGCCCCGG - Exonic
969534582 4:7747932-7747954 GAAGCAGGGGGCTGCAGCCCTGG + Intergenic
969656024 4:8499066-8499088 GCAGCAGTGGCCTTCAGCCCAGG + Intergenic
969657501 4:8506698-8506720 CCAGCAGCCTCCTTCCGCCCAGG - Intergenic
970129466 4:12851177-12851199 GCAGGAGGATTCTTGAGCCCAGG + Intergenic
972249740 4:37287297-37287319 GCAGCAGGCAGCTACAGCTGTGG - Intronic
973373410 4:49271162-49271184 GCAGAAGGCGGCTGCAGCTCGGG + Intergenic
973695147 4:53483537-53483559 TCAGCTGGCTACTTCAGCCTAGG - Intronic
973990284 4:56398878-56398900 GTAGGAGGTTGCTTGAGCCCAGG - Intronic
974038538 4:56838259-56838281 GCAGGAGGATGCTTGAGGCCAGG + Intergenic
974517484 4:62936263-62936285 GCAGCAGTTTGCTTCAGGGCTGG + Intergenic
976381824 4:84408201-84408223 GCAGCATGCTGCCTCACTCCAGG + Intergenic
977612606 4:99051616-99051638 TGAGCAGACTGCTTGAGCCCAGG - Intronic
977672954 4:99716739-99716761 CTAGCTGGCTGCTTCAGCGCTGG - Intergenic
978504807 4:109445150-109445172 GCAGCAGACTGCTTGAGTCCAGG - Intronic
979629653 4:122886146-122886168 GCAGGAGGATTCTTGAGCCCAGG - Intronic
980344855 4:131600912-131600934 GCAGGAGGATGCCTGAGCCCAGG + Intergenic
980365505 4:131799132-131799154 GCAGGAGGATACTTGAGCCCAGG - Intergenic
980774964 4:137425813-137425835 GGAGAAGGGTGCTTCAGGCCAGG - Intergenic
980854203 4:138419725-138419747 GCTGGAGGGTGCTTGAGCCCAGG - Intergenic
981828309 4:148970722-148970744 GAGGCAGACTGCTTGAGCCCAGG - Intergenic
981938248 4:150256265-150256287 GAAGCCGCCTGCTGCAGCCCAGG + Exonic
981950220 4:150397369-150397391 GCAGAAGGATGCTTGAGCCTGGG - Intronic
982188523 4:152827900-152827922 GCAGTGGATTGCTTCAGCCCAGG - Intronic
982244680 4:153339850-153339872 GCAGGAGATTGCTTGAGCCCAGG - Intergenic
982663216 4:158229985-158230007 GCAGCAGGCAGCTGCAGCTGTGG + Intronic
983572974 4:169230110-169230132 GCAGGAGACTGCTTGAACCCAGG + Intronic
983578523 4:169284757-169284779 GCAGTAGGATGCTTGATCCCAGG - Intergenic
983583468 4:169331641-169331663 CGAGCAGATTGCTTCAGCCCAGG - Intergenic
983909030 4:173215879-173215901 GCGGCAGATTGCTTGAGCCCAGG + Intronic
983939510 4:173525359-173525381 GCAGCAGGCCGAATCAGACCCGG - Intronic
984395022 4:179186653-179186675 TGAGCAGACTGCTTGAGCCCAGG + Intergenic
984767917 4:183413706-183413728 GCAGCAGCCTGGTTCTGCGCAGG + Intergenic
984785858 4:183566646-183566668 GCAGGTGGATGCTTGAGCCCAGG + Intergenic
984896078 4:184541234-184541256 GAGGCAGGCTGCTTGAGGCCAGG + Intergenic
985489462 5:170971-170993 ACAGCAGGCTCCCGCAGCCCGGG - Intronic
985707408 5:1409474-1409496 GAAGGAGGCAGCTTCAGCCTGGG + Intronic
985853903 5:2410449-2410471 GCAGCTGGCAGCTGCAGCCCTGG - Intergenic
985885746 5:2676368-2676390 GCAGGAGGCTGAGTCTGCCCAGG + Intergenic
986356524 5:6933668-6933690 TCAGTAGGCAGCTTCAGTCCTGG + Intergenic
987318416 5:16745593-16745615 GCAGGAGATTGCTTGAGCCCAGG + Intronic
988018459 5:25592313-25592335 GCAGGAGGACGCTTGAGCCCAGG + Intergenic
990448250 5:55912872-55912894 GCAGGAGGTTGCTTGAGCCCAGG + Intronic
991902871 5:71477845-71477867 GCGGCAGATTGCTTGAGCCCAGG - Intronic
992036820 5:72787798-72787820 GCAGCATGCTGCTTCAGTGGAGG - Intergenic
992261924 5:74979194-74979216 TGAGCAGACTGCTTGAGCCCAGG + Intergenic
992276050 5:75120165-75120187 GCAGGAAACTGCTTGAGCCCAGG + Intronic
992458354 5:76937526-76937548 TGAGCAGATTGCTTCAGCCCAGG + Intergenic
992821113 5:80497196-80497218 GCAGCAGATTGCTTGAGGCCAGG + Intronic
992867427 5:80971795-80971817 GGAGCAGATTGCTTGAGCCCAGG - Intronic
993966782 5:94368938-94368960 CAAGCAGACTGCTTGAGCCCAGG + Intronic
994676380 5:102828109-102828131 CCAGCAGATTGCTTCAGCTCTGG + Intronic
995111180 5:108429881-108429903 GCAGTAGGATGCTTGAGCCTAGG + Intergenic
996850356 5:127944370-127944392 GCAGGAGGATGCTTGAGGCCAGG - Intergenic
997268012 5:132508893-132508915 CCAGGTAGCTGCTTCAGCCCTGG - Intergenic
997642639 5:135459332-135459354 GGATCAGGCTGCTTCTTCCCAGG + Intergenic
997936873 5:138120027-138120049 GCCAGAGGATGCTTCAGCCCAGG - Intronic
998195338 5:140064621-140064643 GCAGGAGGATCCTTCAGCCTGGG + Intergenic
999161967 5:149509018-149509040 GGGGCAGGATGCTTGAGCCCAGG - Intronic
999466294 5:151809081-151809103 GCAGGAGATTGCTTGAGCCCAGG + Exonic
1000101535 5:158021710-158021732 GCTGTAGGCTGCTTGAGCCCAGG - Intergenic
1000210141 5:159100737-159100759 GCAGGACGCGGCATCAGCCCTGG - Intergenic
1001083064 5:168680921-168680943 TGGGCAGACTGCTTCAGCCCAGG + Intronic
1001269479 5:170300798-170300820 GAAGCATGTTGCTTCAGGCCTGG + Intergenic
1001311949 5:170617438-170617460 GCAGCAGGCAGCAGCAGCCAGGG - Intronic
1001454718 5:171851894-171851916 GCAGGAGGATGCTTTAGGCCAGG + Intergenic
1001511020 5:172321867-172321889 GCAGCCAGCTGCATCAGGCCAGG - Intergenic
1002535709 5:179874318-179874340 TCAGCCTGCTGCCTCAGCCCAGG - Intronic
1002560710 5:180080173-180080195 GCCTCAGGCTTCCTCAGCCCAGG - Intergenic
1002656665 5:180753910-180753932 GTGGCATGCTGCTTCAGCTCAGG - Intergenic
1002954334 6:1847147-1847169 GCAGGAGGATACTTGAGCCCAGG - Intronic
1003007817 6:2398069-2398091 CCAGCAGCCTGCTTGAGCTCAGG - Intergenic
1003248711 6:4405783-4405805 GCAGCAGGCAGCTGCAGCTGTGG - Intergenic
1003292230 6:4789301-4789323 GGAGCAGATTGCTTGAGCCCAGG - Intronic
1003493543 6:6644180-6644202 TCAGCAGGCTGCATCTGCGCTGG + Intronic
1003837425 6:10086874-10086896 GCAGGAGACTGCTTGAGCTCAGG + Intronic
1004242107 6:13933430-13933452 GCAGGAGGATGCTTGAGCTCAGG + Intronic
1004347281 6:14860262-14860284 GCAGGAGGATACTTGAGCCCAGG + Intergenic
1004541861 6:16558206-16558228 GCAGGAGGCTGCTTGAGCCCAGG + Intronic
1004679655 6:17880725-17880747 TCGGGAGGCTGCTTGAGCCCAGG - Intronic
1005164947 6:22908977-22908999 GCAGGAGGATTCTTAAGCCCAGG - Intergenic
1005630244 6:27700437-27700459 GTGGAAGGTTGCTTCAGCCCAGG + Intergenic
1005939797 6:30552527-30552549 GCAGCAGACTGATTCAGCAATGG - Exonic
1006026150 6:31148439-31148461 GCAGCAGACAGCCTCAGCCGAGG - Exonic
1006048053 6:31316213-31316235 GCAGGAGGTTCCTTCAGCCCAGG - Intronic
1006410011 6:33867763-33867785 CCAGCATGCTGCTTGAGGCCTGG + Intergenic
1006481169 6:34295426-34295448 GCAGAAGACTGCTTGAGCCCAGG + Intronic
1006616132 6:35328353-35328375 GAAGATTGCTGCTTCAGCCCAGG + Intergenic
1006729435 6:36225262-36225284 GCAGCAGGAGGCTTCTGCCTGGG - Exonic
1006758120 6:36435467-36435489 GCAGGAGGATACTTGAGCCCAGG + Intronic
1006875958 6:37296575-37296597 GCAGGAGGATGCTTGAGCTCAGG - Intronic
1007058830 6:38917442-38917464 GCATCAGGCGTCCTCAGCCCAGG + Intronic
1007801622 6:44399044-44399066 GCAGAGGACTGCTTGAGCCCAGG - Intronic
1007918662 6:45586414-45586436 GCAGCAGGCTGTTTCTGCAACGG - Intronic
1008021334 6:46581315-46581337 GCAGGAGGATGCTTGAGCACAGG + Intronic
1008605896 6:53139431-53139453 GCAGAAGGTTGCTTGAGCTCGGG + Intronic
1009654526 6:66523902-66523924 CCAGCAGGTTGCTTGATCCCAGG + Intergenic
1011280810 6:85675599-85675621 CCAGCACTCTGCTTGAGCCCAGG - Intergenic
1011707265 6:90013870-90013892 GCAGGAGATTGCTTGAGCCCAGG - Intronic
1012268014 6:97170777-97170799 CAGGCAGGCTGCTTGAGCCCAGG + Intronic
1013206122 6:107947477-107947499 GCAGAAGGATGGCTCAGCCCAGG + Intronic
1015969205 6:138727566-138727588 GCAGTTGGATGCTTAAGCCCAGG + Intergenic
1016001026 6:139041355-139041377 GCAGAGGGCTGTTTGAGCCCAGG - Intronic
1017332684 6:153217982-153218004 AAAGCAGGCTGCTTTAGCCAAGG + Intergenic
1018170680 6:161140742-161140764 CCTGCAGGCAGCTTCTGCCCTGG - Intronic
1019692012 7:2420690-2420712 TCAGGAGGCTGCTTGAGCCCAGG + Intronic
1019868670 7:3737485-3737507 CCAGCAGTCTGGCTCAGCCCTGG - Intronic
1020094873 7:5362623-5362645 GCGGCTGGCTGCTTCCTCCCTGG - Intronic
1020102269 7:5400812-5400834 GCAGCAGATCACTTCAGCCCAGG + Intronic
1020111369 7:5449984-5450006 GCAGAAGGTTGCTTCAGGCCAGG - Intronic
1021457410 7:20844675-20844697 GCAGGAAGATGCTTGAGCCCAGG + Intergenic
1022151557 7:27612852-27612874 GCAGAAGACTGCTTGAACCCAGG + Intronic
1022411450 7:30141614-30141636 GCAGCAGGCTGCTTCAGCCCAGG - Intronic
1023073687 7:36462291-36462313 GCAGGAGGATCCTTGAGCCCAGG - Intergenic
1023627192 7:42127778-42127800 GCAGCAGATTGCTTGAGCTCAGG + Intronic
1023860123 7:44213477-44213499 GCAACAGGCTGGAGCAGCCCAGG + Exonic
1024100680 7:46029572-46029594 CCAGAAGGCTGCCACAGCCCTGG + Intergenic
1025069441 7:55886252-55886274 GCGGGAGGATGCTTGAGCCCAGG + Intergenic
1025619696 7:63157335-63157357 CCAGCAGATTGCTTGAGCCCAGG + Intergenic
1026916772 7:74124883-74124905 CCAGGAGACTGCTTGAGCCCAGG - Intergenic
1027127034 7:75563983-75564005 GCAGAAGACTGCTTGAGCCCAGG - Intronic
1027874965 7:83756995-83757017 GCAGAAGGATGCTTGAGGCCAGG - Intergenic
1028813603 7:95118741-95118763 GCAGGAGATTGCTTGAGCCCAGG + Intronic
1028828645 7:95303165-95303187 GCAGCTGTCTGCTTATGCCCTGG - Intronic
1028867974 7:95735858-95735880 GGAGCAGATTGCTTGAGCCCAGG - Intergenic
1028980875 7:96967000-96967022 GCAGCAGATTGCTTGAGCCCAGG - Intergenic
1029341442 7:99947955-99947977 GCAGGAGGATGCTTGAGGCCAGG + Intergenic
1029405278 7:100371187-100371209 TCAGCAAATTGCTTCAGCCCAGG + Intronic
1029818507 7:103122166-103122188 GAAGCAGATCGCTTCAGCCCAGG - Intronic
1029837616 7:103329967-103329989 AAAGCAGGCTGCTTCACCCCTGG + Intronic
1030124069 7:106138026-106138048 GCAGCAGCCTGCTCCAGACAGGG + Intergenic
1030241387 7:107329800-107329822 GCAGGAGACTGCTTTAGCTCAGG + Intronic
1030356195 7:108544884-108544906 CTAGCAGACTGCTTGAGCCCAGG - Intronic
1031996401 7:128234681-128234703 GCAACAAGCTGCCTCGGCCCTGG + Intergenic
1032012995 7:128359266-128359288 GTAGGAGGCAGCTTCAGCCTGGG - Intronic
1032060058 7:128716748-128716770 GCTGCAGTCTGTTTCAGCCCAGG - Intronic
1032518203 7:132522542-132522564 GCAGACTGCTGCTTGAGCCCAGG + Intronic
1032797711 7:135290877-135290899 CCAGCTGGCTGCTTCAGTACCGG - Intergenic
1032825465 7:135563893-135563915 GCAGGAGGTTGCTTGAGCCCAGG + Intronic
1033350913 7:140561101-140561123 GAAGCAGGTTGCTTGAGCCCAGG - Intronic
1033571693 7:142635747-142635769 GCAGGAGACTGCTTGAACCCGGG + Intergenic
1033641547 7:143266886-143266908 GCAGGAGATTGCTTCAGCCCAGG - Intronic
1034023519 7:147671130-147671152 CCAACTGGCTGCTTCAGCGCAGG - Intronic
1034193420 7:149227801-149227823 GCAAGAGACTGCTTGAGCCCAGG - Intergenic
1034645151 7:152639560-152639582 GCAGGAGGATGCTTGAGTCCAGG - Intergenic
1035094296 7:156341009-156341031 GCAGCAGGATGCTCCTGGCCTGG - Intergenic
1035378356 7:158422611-158422633 GAAGCCGGCAGCGTCAGCCCAGG - Intronic
1035419944 7:158719148-158719170 ACAGGAGGTTGCTTGAGCCCAGG + Intergenic
1035772288 8:2157116-2157138 CCAGCAGATGGCTTCAGCCCAGG - Intronic
1036280513 8:7396219-7396241 GCAGCAGGTGTCCTCAGCCCTGG + Intergenic
1036283563 8:7422643-7422665 GCAGCAGGTGTCCTCAGCCCTGG + Intergenic
1036337907 8:7888878-7888900 GCAGCAGGTGTCCTCAGCCCTGG - Intergenic
1036340957 8:7915351-7915373 GCAGCAGGTGTCCTCAGCCCTGG - Intergenic
1036360332 8:8072623-8072645 CCAGCAGATTGCTTGAGCCCAGG - Intergenic
1036631416 8:10518537-10518559 GCAAGAGGATGCTTGAGCCCAGG + Intergenic
1036720662 8:11172141-11172163 CCAGCAGATTGCTTGAGCCCAGG + Intronic
1036890638 8:12594344-12594366 CCAGCAGATTGCTTGAGCCCAGG + Intergenic
1037171002 8:15891893-15891915 GCAGAAGATTGCTTGAGCCCAGG + Intergenic
1037506724 8:19538087-19538109 GCAGGAGGATGCTTGAGGCCAGG + Intronic
1037542651 8:19887410-19887432 GCAGGAGGATGGTTGAGCCCAGG - Intergenic
1037599357 8:20380910-20380932 GCTTCAGGCTGCTCCAGCCCTGG - Intergenic
1037824753 8:22154688-22154710 CCAGCCCGCTGCCTCAGCCCTGG + Intronic
1037965697 8:23132140-23132162 GAAGCAGGAAGCTTGAGCCCAGG + Intergenic
1038152699 8:24956701-24956723 GCAGCGCGCTGCTGCAGCCAAGG + Exonic
1038189769 8:25309275-25309297 GTAGGAGGATGCTTGAGCCCAGG - Intronic
1038301579 8:26355469-26355491 GGGGCAGACTGCTTGAGCCCAGG - Intronic
1038916610 8:32031342-32031364 GCAGCTGCCTGCATCATCCCAGG - Intronic
1039067480 8:33621624-33621646 GCAGGAGGACGCTTGAGCCCAGG - Intergenic
1039321193 8:36433781-36433803 GCAGGAGGATGCTTGAGTCCAGG - Intergenic
1039451689 8:37679991-37680013 GCAGGAGGATGCTTAAGGCCAGG + Intergenic
1039502537 8:38029553-38029575 GCTGGAGGATGCTTGAGCCCAGG - Intergenic
1039547608 8:38421151-38421173 GCTGCAGGCTCCTTCCTCCCTGG + Intronic
1039885023 8:41649765-41649787 CCAGCTGGCTTCTGCAGCCCAGG - Intronic
1040021545 8:42745561-42745583 GCAGGTGGGTGCTTGAGCCCAGG - Intergenic
1040453079 8:47567876-47567898 GCAGGAGGATGCTTGAGCCCAGG - Intronic
1040913001 8:52540640-52540662 GCAGGAGGATCCTTGAGCCCAGG + Intronic
1040959725 8:53019067-53019089 GCAGCAGGCAGCTTCAGCTGTGG - Intergenic
1040973462 8:53163560-53163582 ACAGCAGGCAGCTTCAGACTTGG + Intergenic
1042029778 8:64463472-64463494 GCAGGAGAATGCTTGAGCCCAGG + Intergenic
1042915800 8:73874833-73874855 GCAGGTGACTGCTTGAGCCCAGG + Intronic
1044325501 8:90853222-90853244 CCAGCTGGCTGCTTCTGCACTGG - Intronic
1044575330 8:93762549-93762571 GCAGTAGATTGCTTAAGCCCAGG - Intronic
1045845883 8:106635670-106635692 GCAGCAGATTGCTTGAGCTCAGG - Intronic
1047746393 8:127848321-127848343 GCAGGGGGTTGCTTGAGCCCAGG + Intergenic
1047931106 8:129728822-129728844 GCAGCGGGCTACCTCAGCTCAGG - Intergenic
1048317042 8:133370126-133370148 TCAGCAGCCTGCTTTGGCCCTGG - Intergenic
1049252864 8:141598486-141598508 GCTGCAGGCTGCATGAGCCTGGG + Intergenic
1049453360 8:142674790-142674812 ACAGCAGCCTGCTTCTGCACTGG + Intronic
1049560848 8:143309546-143309568 GCGGGAGGCAGCATCAGCCCAGG + Intronic
1049621170 8:143598932-143598954 GCTGCAGGCAGCTTCGGCGCAGG - Exonic
1049750666 8:144282177-144282199 GCAGGAGGCAGCTTCCTCCCTGG + Intronic
1049945871 9:595184-595206 CCAGCAGATTGCTTGAGCCCAGG + Intronic
1050506190 9:6351874-6351896 GAAGAAGGTTGCTTGAGCCCAGG + Intergenic
1050927218 9:11279393-11279415 CAAGCACACTGCTTCAGCCCAGG - Intergenic
1053076376 9:35138214-35138236 GCAGGAGGATGCTTGAGCCCAGG - Intergenic
1053441181 9:38117746-38117768 GAAACAGGCTCCTTCATCCCAGG + Intergenic
1053482307 9:38424542-38424564 GCAGACCGCTGCTCCAGCCCGGG + Intergenic
1053543334 9:38997328-38997350 GCAGAAGGCTGCTTCATGCCTGG + Intergenic
1053629854 9:39925006-39925028 GCAGGAGGATACTTGAGCCCAGG - Intergenic
1053684167 9:40506034-40506056 GCACCATTGTGCTTCAGCCCGGG + Intergenic
1053775916 9:41538530-41538552 GCAGGAGGATACTTGAGCCCAGG + Intergenic
1053807766 9:41820835-41820857 GCAGAAGGCTGCTTCATGCCTGG + Intergenic
1054214033 9:62325696-62325718 GCAGGAGGATACTTGAGCCCAGG + Intergenic
1054279556 9:63118919-63118941 GCACCATTGTGCTTCAGCCCGGG - Intergenic
1054297261 9:63341498-63341520 GCACCATTGTGCTTCAGCCCGGG + Intergenic
1054365818 9:64339951-64339973 GCAGGAGGATACTTGAGCCCAGG - Intergenic
1054395281 9:64646006-64646028 GCACCATTGTGCTTCAGCCCGGG + Intergenic
1054429928 9:65151206-65151228 GCACCATTGTGCTTCAGCCCGGG + Intergenic
1054500456 9:65870326-65870348 GCACCATTGTGCTTCAGCCCGGG - Intergenic
1054622826 9:67366593-67366615 GCAGAAGGCTGCTTCATGCCTGG - Intergenic
1054673446 9:67829660-67829682 GCAGGAGGATACTTGAGCCCAGG - Intergenic
1056356872 9:85809227-85809249 GCAGCAGATTGCTTGAGCCCGGG - Intergenic
1056406464 9:86280720-86280742 GCAGTGGACTGCTTGAGCCCAGG + Intronic
1057152780 9:92809228-92809250 GCAGGGGGCTGCTGCAGCTCGGG - Intergenic
1057170050 9:92956929-92956951 GCAGGAGACTGCTTGAGCCCCGG - Intronic
1057582742 9:96302113-96302135 TCAACAGACTGTTTCAGCCCTGG + Exonic
1058226648 9:102372148-102372170 GCACCAGGCTGCCACTGCCCGGG + Intergenic
1058736772 9:107900813-107900835 GCTGGAGGATGCTTGAGCCCTGG + Intergenic
1059243666 9:112831042-112831064 GCAGGAGGTAGCTTGAGCCCAGG + Intronic
1059641475 9:116220790-116220812 GCAGGAGAATGCTTGAGCCCAGG + Intronic
1060725225 9:126001919-126001941 GCAGGAGGAGGCCTCAGCCCCGG - Intergenic
1061074257 9:128331635-128331657 ACAGGAGGATGCTTGAGCCCAGG - Intronic
1061375550 9:130222378-130222400 TGAGCAGACTGCTTGAGCCCAGG - Intronic
1061381030 9:130257750-130257772 GCAGGAGGATGCTTGAGCCCAGG + Intergenic
1061415913 9:130446674-130446696 GCAGCAGGCTGTTTTGGGCCTGG - Intronic
1061856486 9:133444532-133444554 TGAGCAGACTGCTTGAGCCCGGG - Intronic
1061968304 9:134028904-134028926 GCAGGAGGCTGCTGCCGACCAGG - Intergenic
1061995904 9:134185633-134185655 GCAGGAGGATCCCTCAGCCCAGG + Intergenic
1062309038 9:135926016-135926038 GCGGGAGGATGCTTGAGCCCAGG + Intergenic
1203697119 Un_GL000214v1:109165-109187 GCAGAAGGCGGCTGCAGCTCGGG + Intergenic
1203552093 Un_KI270743v1:171864-171886 GCAGAAGGCGGCTGCAGCTCGGG - Intergenic
1185818454 X:3179246-3179268 GCAGGAGGATCCTTGAGCCCAGG + Intergenic
1185876572 X:3706755-3706777 GCAGCACGCTGCCTCCTCCCCGG - Intronic
1185952440 X:4451794-4451816 GCAGCAGGCAGCTGCAGCTCTGG - Intergenic
1187725982 X:22202700-22202722 GCAGCAGGGATATTCAGCCCAGG - Intronic
1188801539 X:34537446-34537468 GCAGGAGGCTGCTTGGGCCCAGG - Intergenic
1189230816 X:39451140-39451162 CCAGCTCCCTGCTTCAGCCCGGG + Intergenic
1189782146 X:44525625-44525647 CAGGCAGGCTGCTTGAGCCCAGG + Intronic
1189966958 X:46383238-46383260 GCAGAAGGATGCTTGAGCCCAGG + Intergenic
1189972180 X:46429129-46429151 GCAGAAGGTTGCTTGAGCCGAGG + Intergenic
1190691648 X:52917693-52917715 GCTGGAGGATGCTTGAGCCCAGG + Intergenic
1190694335 X:52938099-52938121 GCTGGAGGATGCTTGAGCCCAGG - Intronic
1190765594 X:53473284-53473306 ACAGCTGGCTCCTTCAGCTCAGG - Intergenic
1190789805 X:53687703-53687725 GCAGGAGGATCCTTGAGCCCAGG - Intergenic
1191053513 X:56219587-56219609 TCAGCAGGCATCTTCAGCACTGG - Intergenic
1192670517 X:73135577-73135599 TCATCATGCTGCCTCAGCCCTGG - Intergenic
1192968663 X:76207078-76207100 GCACCATGCTGCTGCTGCCCAGG + Intergenic
1193378331 X:80788202-80788224 GCAGGTGATTGCTTCAGCCCAGG + Intronic
1195041748 X:101021066-101021088 GCAGCATGCAGATTCTGCCCTGG + Intronic
1195050988 X:101096753-101096775 CAAGCAGACTGCTTGAGCCCAGG - Intergenic
1198510178 X:137342470-137342492 GCAGGAGGATTCTTGAGCCCAGG + Intergenic
1200122827 X:153799207-153799229 ACAGCAGTGTGCTCCAGCCCGGG + Intergenic
1200183814 X:154168768-154168790 GCCGCAGGTTGCTTATGCCCTGG - Intergenic
1200189468 X:154205896-154205918 GCCGCAGGTTGCTTATGCCCTGG - Intergenic
1200195221 X:154243705-154243727 GCCGCAGGTTGCTTATGCCCTGG - Intergenic
1200200873 X:154280826-154280848 GCCGCAGGTTGCTTATGCCCTGG - Intronic
1200205953 X:154316469-154316491 GCAGGAGGATGCTTGATCCCAGG + Intronic
1200788826 Y:7281945-7281967 GCAGCACGCTGCCTCCTCCCTGG + Intergenic
1201153372 Y:11107437-11107459 GCAGAAGGCGGCTGCAGCTCGGG - Intergenic
1201243067 Y:11977307-11977329 GCAGGAGGATGCTTGAGCCCAGG - Intergenic
1201787475 Y:17801508-17801530 CAGGCAGCCTGCTTCAGCCCGGG + Intergenic
1201814078 Y:18104480-18104502 CAGGCAGCCTGCTTCAGCCCGGG - Intergenic