ID: 1022411451

View in Genome Browser
Species Human (GRCh38)
Location 7:30141624-30141646
Sequence AGCAGCCTGCTGCTTCATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022411448_1022411451 2 Left 1022411448 7:30141599-30141621 CCGTAACCTCAAATTCCTGGGCT 0: 5
1: 45
2: 171
3: 562
4: 1532
Right 1022411451 7:30141624-30141646 AGCAGCCTGCTGCTTCATCCTGG No data
1022411449_1022411451 -4 Left 1022411449 7:30141605-30141627 CCTCAAATTCCTGGGCTGAAGCA 0: 8
1: 341
2: 3057
3: 9484
4: 22018
Right 1022411451 7:30141624-30141646 AGCAGCCTGCTGCTTCATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022411451 Original CRISPR AGCAGCCTGCTGCTTCATCC TGG Intronic
No off target data available for this crispr