ID: 1022411453

View in Genome Browser
Species Human (GRCh38)
Location 7:30141636-30141658
Sequence CTTCATCCTGGCAAGTAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 9939
Summary {0: 1, 1: 1, 2: 2, 3: 310, 4: 9625}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022411448_1022411453 14 Left 1022411448 7:30141599-30141621 CCGTAACCTCAAATTCCTGGGCT 0: 5
1: 45
2: 171
3: 562
4: 1532
Right 1022411453 7:30141636-30141658 CTTCATCCTGGCAAGTAGCCAGG 0: 1
1: 1
2: 2
3: 310
4: 9625
1022411449_1022411453 8 Left 1022411449 7:30141605-30141627 CCTCAAATTCCTGGGCTGAAGCA 0: 8
1: 341
2: 3057
3: 9484
4: 22018
Right 1022411453 7:30141636-30141658 CTTCATCCTGGCAAGTAGCCAGG 0: 1
1: 1
2: 2
3: 310
4: 9625
1022411450_1022411453 -1 Left 1022411450 7:30141614-30141636 CCTGGGCTGAAGCAGCCTGCTGC 0: 1
1: 1
2: 2
3: 87
4: 680
Right 1022411453 7:30141636-30141658 CTTCATCCTGGCAAGTAGCCAGG 0: 1
1: 1
2: 2
3: 310
4: 9625

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022411453 Original CRISPR CTTCATCCTGGCAAGTAGCC AGG Intronic
Too many off-targets to display for this crispr