ID: 1022411455

View in Genome Browser
Species Human (GRCh38)
Location 7:30141644-30141666
Sequence TGGCAAGTAGCCAGGACTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022411450_1022411455 7 Left 1022411450 7:30141614-30141636 CCTGGGCTGAAGCAGCCTGCTGC 0: 1
1: 1
2: 2
3: 87
4: 680
Right 1022411455 7:30141644-30141666 TGGCAAGTAGCCAGGACTACAGG No data
1022411448_1022411455 22 Left 1022411448 7:30141599-30141621 CCGTAACCTCAAATTCCTGGGCT 0: 5
1: 45
2: 171
3: 562
4: 1532
Right 1022411455 7:30141644-30141666 TGGCAAGTAGCCAGGACTACAGG No data
1022411449_1022411455 16 Left 1022411449 7:30141605-30141627 CCTCAAATTCCTGGGCTGAAGCA 0: 8
1: 341
2: 3057
3: 9484
4: 22018
Right 1022411455 7:30141644-30141666 TGGCAAGTAGCCAGGACTACAGG No data
1022411452_1022411455 -8 Left 1022411452 7:30141629-30141651 CCTGCTGCTTCATCCTGGCAAGT 0: 1
1: 0
2: 4
3: 53
4: 1150
Right 1022411455 7:30141644-30141666 TGGCAAGTAGCCAGGACTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022411455 Original CRISPR TGGCAAGTAGCCAGGACTAC AGG Intronic
No off target data available for this crispr