ID: 1022411813

View in Genome Browser
Species Human (GRCh38)
Location 7:30144720-30144742
Sequence GAGCAGTATTTTAAGTCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 434
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 409}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022411812_1022411813 0 Left 1022411812 7:30144697-30144719 CCTAGTTATTCTCATTTGGATCT 0: 1
1: 0
2: 0
3: 15
4: 234
Right 1022411813 7:30144720-30144742 GAGCAGTATTTTAAGTCTGTAGG 0: 1
1: 0
2: 1
3: 23
4: 409

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022411813 Original CRISPR GAGCAGTATTTTAAGTCTGT AGG Intronic
904774140 1:32896378-32896400 GAGTAGAATTTTAAATCTCTGGG + Intronic
905524958 1:38629910-38629932 GAGCATTTTTTCATGTCTGTTGG + Intergenic
906065474 1:42977465-42977487 CAACAGTATTCTAAGTCAGTAGG + Intergenic
906974522 1:50555490-50555512 GAGCATTATTTCATGTTTGTTGG - Intronic
907104551 1:51870370-51870392 AAGCAGTAGTTTAAATCTATAGG - Intronic
908619124 1:65956265-65956287 GAGCAGTATTTTTAGTTCCTTGG + Intronic
908665082 1:66481225-66481247 GCGCCGTTTTTTAAGCCTGTCGG - Intergenic
910072082 1:83229066-83229088 AAGAAGTATTTTAAGGCTATAGG + Intergenic
910380870 1:86625400-86625422 GAGCAGTTTTTCATGTTTGTTGG - Intergenic
910915582 1:92284848-92284870 GAGCATTTTTTCATGTCTGTTGG - Intronic
911595605 1:99795357-99795379 GAGCATTTTTTCATGTCTGTTGG + Intergenic
911813433 1:102312626-102312648 GTGCCGTTTTTTAAGCCTGTTGG + Intergenic
911903276 1:103531605-103531627 GAGCAGTTTTTCATGTTTGTTGG + Intronic
912737196 1:112160505-112160527 GCGCCGTTTTTTAAGCCTGTCGG + Intergenic
913339315 1:117742107-117742129 GAGCATTTTTTTATGTTTGTTGG + Intergenic
915690707 1:157687168-157687190 GAGCATTTTTTTATGTTTGTTGG - Intronic
915761719 1:158320362-158320384 GTGCCGTTTTTTAAGTCCGTTGG + Intergenic
916987752 1:170209376-170209398 GAGGACCATTTTAAGTATGTTGG + Intergenic
917048579 1:170891689-170891711 GTGCTGTATTTTAATTCTTTGGG + Intergenic
917718243 1:177759706-177759728 GTGCTGTTTTTTAAGCCTGTCGG - Intergenic
918351257 1:183658370-183658392 GCGCCGTTTTTTAAGCCTGTTGG - Intronic
918712696 1:187750595-187750617 GTGCAATATTTTAGGTCTATGGG + Intergenic
919023544 1:192139225-192139247 AATCAGGATTTTAAGTCTCTGGG + Intergenic
919253534 1:195092462-195092484 CACCAGAATTTTATGTCTGTTGG - Intergenic
921259467 1:213372632-213372654 GAGCAGTTTATTTGGTCTGTAGG + Intergenic
922672057 1:227517636-227517658 GGGCAGTATTTTTAGTTGGTAGG + Intergenic
923755859 1:236790722-236790744 GAGCTGAATTTTGAATCTGTGGG - Intergenic
924246057 1:242086355-242086377 CAGCATTCTTTTAAGTCAGTGGG + Exonic
1063464889 10:6236731-6236753 GAGCAGTCTTTTAATTTTCTGGG - Intergenic
1064123715 10:12641260-12641282 GAACTGTATTTTAAGGCTGGGGG - Intronic
1064520473 10:16195734-16195756 GAAGAGTATTTTAAGACTGGGGG + Intergenic
1064922206 10:20531521-20531543 GGGCCGTTTTTTAAGCCTGTCGG + Intergenic
1065054905 10:21834637-21834659 GTGCCGTTTTTTAAGTCCGTTGG - Intronic
1066145997 10:32558979-32559001 GCGCTGTTTTTTAAGCCTGTTGG - Intronic
1066546340 10:36504326-36504348 GAGCATTATTTCATGTTTGTTGG - Intergenic
1066982892 10:42435682-42435704 GCGCTGTTTTTTAAGCCTGTCGG - Intergenic
1068115795 10:52736205-52736227 GTGCCGTTTTTTAAGCCTGTCGG + Intergenic
1068404987 10:56576033-56576055 GAGGAGAATTTTTAGGCTGTAGG - Intergenic
1068943387 10:62703873-62703895 GAGCATTTTTTCATGTCTGTTGG - Intergenic
1069110663 10:64442199-64442221 GTGCCGTTTTTTAAGCCTGTTGG + Intergenic
1069148368 10:64924534-64924556 GCGCAGTTTTTTAAGCCCGTCGG - Intergenic
1070883691 10:79871328-79871350 GAGCGGTCTTTTATGCCTGTAGG - Intergenic
1070908645 10:80098032-80098054 GAGCATTTTTTCATGTCTGTTGG - Intergenic
1072855049 10:98937398-98937420 GCGCCGTTTTTTAAGCCTGTCGG - Intronic
1073987282 10:109223912-109223934 GCGCCGTTTTTTAAGCCTGTCGG - Intergenic
1074612127 10:115031821-115031843 GAGCATTGTTTTATGTTTGTTGG + Intergenic
1077456352 11:2683592-2683614 GAGCAGTATTTGAAATGAGTTGG - Intronic
1077788528 11:5412603-5412625 GGGCAGTTTTTTAAGCCCGTTGG - Intronic
1078695663 11:13628920-13628942 GTGCCGTTTTTTAAGTCCGTTGG + Intergenic
1078800014 11:14633842-14633864 GCGCCGTTTTTTAAGTCCGTCGG + Intronic
1078847568 11:15133879-15133901 GAGAAGTATTTAAAGTATCTGGG + Intronic
1079848692 11:25501816-25501838 GCGCTGTTTTTTAAGCCTGTGGG + Intergenic
1079859556 11:25649475-25649497 GCGCCGTTTTTTAAGCCTGTGGG + Intergenic
1080565895 11:33509165-33509187 GAGCTGTCTTTAAAGACTGTGGG - Intergenic
1081086773 11:38811479-38811501 GTGCCGTTTTTTAAGCCTGTTGG - Intergenic
1081161480 11:39755342-39755364 GTGCCGTTTTTTAAGCCTGTTGG - Intergenic
1082077738 11:47987417-47987439 GATCAGTTTCTTAAGTCTGGGGG + Intronic
1082117816 11:48346281-48346303 GTGCCGTTTTTTAAGCCTGTTGG - Intergenic
1082602758 11:55180049-55180071 GAGCAGTTTTTAAAGTCTTTTGG - Intergenic
1083135844 11:60676382-60676404 GGGCAGTATTTTAACTCTTTAGG - Intergenic
1083165795 11:60886441-60886463 GAGCATTTTTTCATGTCTGTTGG - Intergenic
1084109151 11:67002311-67002333 GAGTATTATTTTGATTCTGTGGG + Intergenic
1084989085 11:72906189-72906211 GAGCATTTTTTCATGTCTGTTGG + Intronic
1085003883 11:73066715-73066737 GAGCATTTTTTCATGTCTGTTGG - Intronic
1085244015 11:75083280-75083302 GAGCATTTTTTCATGTCTGTTGG - Intergenic
1086481779 11:87247684-87247706 GCGCCGTTTTTTAAGCCTGTCGG + Intronic
1086512014 11:87569150-87569172 GAGCATTGTTTTATGTTTGTTGG - Intergenic
1087670983 11:101106447-101106469 GAGCATTTTTTCATGTCTGTCGG - Intronic
1087827783 11:102786009-102786031 GAGCATTATTTTATGTGTTTAGG - Intergenic
1088158433 11:106838739-106838761 GAGCATTTTTTCATGTCTGTTGG + Intronic
1088450411 11:109975794-109975816 GAGAAGTATTTTCAGTCAGAAGG - Intergenic
1090752123 11:129756151-129756173 GAGCATTTTTTCATGTCTGTGGG - Intergenic
1093047073 12:14459000-14459022 GAGAAGTATTTTAAGGATTTAGG + Intronic
1093404246 12:18785514-18785536 GTGCCGTTTTTTAAGCCTGTTGG - Intergenic
1093426631 12:19035300-19035322 AAACAGTATCTTAAGTGTGTAGG + Intergenic
1093629825 12:21395310-21395332 GCGCCGTTTTTTAAGCCTGTTGG - Exonic
1093979195 12:25456215-25456237 GAGCATTATTTCATGTTTGTTGG - Intronic
1094157608 12:27353800-27353822 GAGCATTTTTTCATGTCTGTTGG - Intronic
1094785977 12:33848430-33848452 GCGCCGTATTTTAAGCCTGTTGG - Intergenic
1095383770 12:41626554-41626576 GAACGGTATTTTAATTTTGTAGG - Intergenic
1095591280 12:43906783-43906805 GCGCCGTTTTTTAAGCCTGTCGG - Intronic
1095677011 12:44932000-44932022 GCGCCGTTTTTTAAGCCTGTCGG - Intergenic
1096433834 12:51571476-51571498 GCGCCGTTTTTTAAGCCTGTCGG + Intergenic
1097097630 12:56562197-56562219 CAACAGGATTTTAAGTCTTTGGG + Intronic
1098665242 12:73153322-73153344 GCGCCGTTTTTTAAGCCTGTTGG + Intergenic
1098993421 12:77091235-77091257 GAGCATTTTTTCATGTCTGTTGG + Intergenic
1099267109 12:80462176-80462198 GTGCCGTTTTTTAAGCCTGTCGG - Intronic
1099548228 12:84011607-84011629 GCGCCGTTTTTTAAGCCTGTCGG + Intergenic
1100035453 12:90245628-90245650 GAACAGTATTTTAAGAATTTTGG + Intergenic
1100174475 12:92013763-92013785 GAGCATTTTTTCATGTCTGTTGG + Intronic
1104088805 12:125497200-125497222 AAGCAGTACTTTAAGTGTCTAGG + Intronic
1105311555 13:19216553-19216575 GTGCTGTTTTTTAAGCCTGTCGG + Intergenic
1106686975 13:32070475-32070497 GAGCATTTTTTCACGTCTGTTGG + Intronic
1106691886 13:32126404-32126426 GAGCAATATTCTAAGCTTGTAGG + Intronic
1107233612 13:38141297-38141319 TAGAAGTATTTTTAGTATGTGGG + Intergenic
1107550980 13:41475112-41475134 GAGCATTTTTTCATGTCTGTTGG + Intergenic
1107820947 13:44285220-44285242 GAGCAGAATTTTGAGGATGTGGG - Intergenic
1107973765 13:45669897-45669919 GCGCCGTTTTTTAAGCCTGTCGG + Intergenic
1109312297 13:60710054-60710076 GCGCTGTTTTTTAAGCCTGTCGG - Intergenic
1109651120 13:65327777-65327799 AAGCAGCACTTTAAGTCTGTTGG + Intergenic
1109883191 13:68508579-68508601 GAGCATTTTTTTATGTTTGTTGG + Intergenic
1110986285 13:81973883-81973905 GAGCAGGATCTTGAATCTGTGGG - Intergenic
1110991245 13:82045651-82045673 GCGCCGTTTTTTAAGCCTGTCGG - Intergenic
1111004357 13:82229312-82229334 GCGCTGTTTTTTAAGCCTGTCGG - Intergenic
1111547327 13:89757829-89757851 GAGCACTAATTTAAATCTGCAGG + Intergenic
1112066684 13:95800334-95800356 GAGTAGTATTTTAACTCTATGGG + Intergenic
1113282507 13:108804620-108804642 GAGCATTATTTTGAGTCTACTGG - Intronic
1113863300 13:113505064-113505086 CAGCATTTTTTTATGTCTGTTGG + Intronic
1114848409 14:26352299-26352321 GAGCATTTTTTTATGTTTGTTGG + Intergenic
1115349622 14:32379755-32379777 GAACATTATTTTTAGTCTCTAGG + Intronic
1115507325 14:34104871-34104893 GTGCAGTATTTTAGGGCAGTAGG - Intronic
1115719856 14:36148367-36148389 GCGCCGTTTTTTAAGCCTGTCGG + Intergenic
1116027009 14:39527135-39527157 GCGCCGTTTTTTAAGCCTGTCGG + Intergenic
1116322810 14:43492477-43492499 GCGCCGTTTTTTAAGCCTGTCGG - Intergenic
1116582669 14:46662177-46662199 GAGCTTTCTTTTAAGTCTTTTGG - Intergenic
1116783364 14:49261440-49261462 GAGCAGTTTTTCATGTTTGTTGG + Intergenic
1117280317 14:54234180-54234202 GCGCCGTTTTTTAAGCCTGTCGG - Intergenic
1117452122 14:55861925-55861947 GCGCCGTTTTTTAAGCCTGTTGG - Intergenic
1117952117 14:61093028-61093050 GAGCATTTTTTCATGTCTGTTGG + Intergenic
1118955240 14:70475504-70475526 GCGCCGTTTTTTAAGCCTGTCGG - Intergenic
1119526670 14:75328174-75328196 GAGCAGTAATGTATGTATGTAGG + Intergenic
1119985428 14:79131882-79131904 GTGCCGTTTTTTAAGCCTGTCGG + Intronic
1122266397 14:100548899-100548921 GAGCAGTATTTAAGGGCTGGTGG - Intronic
1123452895 15:20383937-20383959 GAGCATTTTTTCATGTCTGTTGG - Intergenic
1123585329 15:21755209-21755231 GAGCATTTTTTCATGTCTGTTGG + Intergenic
1123621976 15:22197816-22197838 GAGCATTTTTTCATGTCTGTTGG + Intergenic
1125226818 15:37405154-37405176 GAGCGGTTTTTTAAGCCGGTCGG + Intergenic
1125228730 15:37427458-37427480 GAGCGGTTTTTTAAGCCCGTCGG - Intergenic
1125289666 15:38131702-38131724 GAGCTGGATTTTAGGTCTGTAGG + Intergenic
1125358425 15:38840769-38840791 GCGCTGTTTTTTAAGCCTGTCGG + Intergenic
1127571095 15:60242536-60242558 GAGCATTTTTTTGTGTCTGTTGG - Intergenic
1127970715 15:63958115-63958137 GAGCATTTTTTCATGTCTGTTGG + Intronic
1129825586 15:78632994-78633016 GAGCAAGATTTTTATTCTGTAGG - Intronic
1130692305 15:86093455-86093477 GTGCAGTATTTTCAGTTTCTGGG - Intergenic
1130806905 15:87333094-87333116 GTGCTGTTTTTTAAGCCTGTCGG + Intergenic
1130818252 15:87464029-87464051 GCGCTGTTTTTTAAGCCTGTGGG - Intergenic
1131128254 15:89874898-89874920 GAGTCGTATTTTAAGTTGGTGGG + Intronic
1131929104 15:97419152-97419174 GCGCCGTTTTTTAAGCCTGTAGG + Intergenic
1132509198 16:328857-328879 GAGCAGCAGCTTCAGTCTGTGGG - Intronic
1133201846 16:4208592-4208614 GAGCAGTATTAAAAGCCTGCTGG - Intronic
1134255633 16:12609017-12609039 GAGCATTTTTTCATGTCTGTTGG - Intergenic
1135779241 16:25285029-25285051 GAGCATTTTTTTACGTCTGTTGG - Intergenic
1136678461 16:31937852-31937874 GCGCAGATTTTTAAGCCTGTCGG - Intergenic
1141119852 16:81344983-81345005 GAGCATTTTTTCATGTCTGTTGG - Intronic
1143643169 17:8211232-8211254 GGGCAGCATTTAAATTCTGTTGG - Intergenic
1144634415 17:16895736-16895758 GAGCAGTATATTAAGACACTAGG - Intergenic
1146103634 17:30010565-30010587 GAGCATTTTTTCATGTCTGTTGG + Intronic
1149408599 17:56380597-56380619 GCGCTGTTTTTTAAGCCTGTCGG - Intronic
1150818374 17:68413818-68413840 GCGCCGTTTTTTAAGCCTGTCGG + Intronic
1150945062 17:69736282-69736304 GAGCATTTTTTTATGTTTGTTGG + Intergenic
1153105567 18:1521918-1521940 GGGCTGTTTTTTAAGCCTGTCGG + Intergenic
1153156839 18:2159473-2159495 AAGCAGTCTTATAATTCTGTGGG - Intergenic
1153444156 18:5153538-5153560 GGACAGTATTTTCAGTCTTTAGG + Intronic
1153550796 18:6259476-6259498 GAGCATTTTTTTATGTTTGTTGG + Intronic
1153967293 18:10193322-10193344 GAGCAATATTTTAATTTTCTGGG + Intergenic
1155597948 18:27510310-27510332 GGGCCGTTTTTTAAGCCTGTCGG - Intergenic
1157097136 18:44696226-44696248 CAGCAGTATTGTGAGTCTCTTGG - Intronic
1157135864 18:45054527-45054549 GAGGAGTGTTTTAAGTCTGGGGG - Intronic
1158286837 18:55893116-55893138 GCGCCGTTTTTTAAGCCTGTCGG + Intergenic
1159708693 18:71726127-71726149 GAGCATTTTTTCAAGTTTGTTGG - Intergenic
1160095192 18:75865569-75865591 GAGCAGTATCTGTAGCCTGTTGG + Intergenic
1161828873 19:6588486-6588508 GTGCAGTAATTTTAGTCTCTGGG + Intronic
1165298836 19:34954243-34954265 GAGCTCCATTTTAATTCTGTTGG - Intergenic
925963245 2:9038630-9038652 GTGCCGTTTTTTAAGCCTGTTGG - Intergenic
926013751 2:9429723-9429745 GAGCTATATTTTAAATTTGTTGG + Intronic
926403782 2:12527453-12527475 GCGCCGTTTTTTAAGCCTGTCGG + Intergenic
926595879 2:14789161-14789183 GTGCCGTTTTTTAAGCCTGTAGG + Intergenic
928816070 2:35295905-35295927 GAGCATTTTTTCATGTCTGTTGG - Intergenic
929654435 2:43716324-43716346 GAAAAGTATCTTAAGTTTGTAGG + Intronic
930888657 2:56357585-56357607 GTTCAGTATCTTAAGTCTTTAGG + Intronic
931317361 2:61145141-61145163 GAGCAGGATTTTAAGACTCTCGG - Intronic
931633085 2:64318735-64318757 CAGTAGTATTTTAAGTCTCCAGG - Intergenic
931750997 2:65329827-65329849 GAGCACTATAGGAAGTCTGTTGG + Intronic
931754981 2:65365165-65365187 GAACAGTATTTGAAATATGTGGG - Intronic
931843358 2:66177472-66177494 GTGCCGTTTTTTAAGCCTGTAGG - Intergenic
931846202 2:66206619-66206641 GCGCCGTTTTTTAAGCCTGTCGG - Intergenic
931885278 2:66610403-66610425 GAGCATTTTTTCATGTCTGTTGG + Intergenic
932649876 2:73543747-73543769 GAGCATTTTTTCATGTCTGTTGG - Intronic
933113808 2:78440465-78440487 GAGCAGTTTTTCATGTCTGTTGG - Intergenic
935983392 2:108649207-108649229 GAGCTGTTTTTCATGTCTGTTGG - Intronic
936447791 2:112609462-112609484 GAGCATTTTTTCATGTCTGTTGG + Intergenic
936807756 2:116357739-116357761 GAGCTGTTTTTCAAGTTTGTTGG + Intergenic
938659437 2:133470715-133470737 GCGCCGTTTTTTAAGCCTGTCGG + Intronic
938810892 2:134851874-134851896 GAGCATTTTTTCATGTCTGTTGG + Intronic
938857130 2:135324840-135324862 GAGCATTTTTTCATGTCTGTTGG + Intronic
939837795 2:147151093-147151115 GTGCCGTTTTTTAAGCCTGTTGG - Intergenic
939976389 2:148721298-148721320 GTGCAGAATTTTAGGTTTGTAGG + Intronic
940917466 2:159272658-159272680 AAGCATTTTTTTAAGTCTTTTGG - Intronic
942520305 2:176796720-176796742 GCGCCGTTTTTTAAGCCTGTGGG - Intergenic
943882934 2:193171006-193171028 GCGCCGTTTTTTAAGCCTGTCGG - Intergenic
945657376 2:212641856-212641878 GAGCAGTTTTTCATGTTTGTTGG + Intergenic
947266264 2:228285390-228285412 GAGCATTTTTTTACGTGTGTTGG + Intergenic
1170281599 20:14654713-14654735 AAGCAGAATTTTAAATGTGTAGG + Intronic
1171434564 20:25110627-25110649 GAGCATTTTTTCATGTCTGTTGG - Intergenic
1171791087 20:29526193-29526215 GTGCCGTTTTTTAAGTCCGTCGG - Intergenic
1173774600 20:45693657-45693679 GCGCCGTTTTTTAAGCCTGTCGG + Intronic
1176340576 21:5691183-5691205 GAGCAATTTTTCATGTCTGTTGG - Intergenic
1176472830 21:7123336-7123358 GAGCAATTTTTCATGTCTGTTGG - Intergenic
1176504251 21:7633273-7633295 GAGCAATTTTTCATGTCTGTTGG + Intergenic
1177799698 21:25816273-25816295 GTTCTGTATTTTAAGTGTGTTGG + Intergenic
1178160187 21:29903514-29903536 GAGCATTTTTTCATGTCTGTTGG - Intronic
1181326381 22:22051722-22051744 GAGCATTTTTTCATGTCTGTTGG + Intergenic
1185261843 22:49870585-49870607 GAGCATTTTTTCACGTCTGTTGG + Intronic
1203239839 22_KI270733v1_random:5641-5663 GAGCAATTTTTCATGTCTGTTGG - Intergenic
949999232 3:9643599-9643621 GAGCATTTTTTCATGTCTGTTGG - Intergenic
951438561 3:22694541-22694563 GAGCATTTTTTTATGTTTGTTGG + Intergenic
951615974 3:24544546-24544568 TAGCTGCATTTTATGTCTGTGGG + Intergenic
952250268 3:31646750-31646772 GACCATTATTTTAACTTTGTGGG - Intergenic
952602659 3:35104213-35104235 GGGCCGTTTTTTAAGCCTGTGGG - Intergenic
952630035 3:35454912-35454934 GCGCCGTTTTTTAAGCCTGTTGG - Intergenic
952936886 3:38405696-38405718 GCGCCGTTTTTTAAGCCTGTCGG - Intronic
954548127 3:51456223-51456245 GTGCCGTTTTTTAAGCCTGTTGG - Intronic
955248343 3:57250761-57250783 AAGCAGTATTTTAATTGAGTGGG - Intronic
957489912 3:80910359-80910381 GAGCATTTTTTCATGTCTGTTGG - Intergenic
958030256 3:88100205-88100227 GAGCATTTTTTCATGTCTGTTGG - Intronic
958707923 3:97679365-97679387 GAGTAGCATTTGAAGTGTGTGGG + Intronic
959345360 3:105187550-105187572 GAGCATTTTTTTATGTTTGTTGG + Intergenic
959638604 3:108605342-108605364 GGGCAGTATTTAAAGTCAGTTGG + Exonic
960667952 3:120129334-120129356 GGGCATCATTTTAAGACTGTTGG + Intergenic
961956021 3:130804931-130804953 GTGCTGTTTTTTAAGCCTGTTGG - Intergenic
962104507 3:132376944-132376966 GCGCCGTGTTTTAAGCCTGTCGG + Intergenic
962424504 3:135257917-135257939 GCGCCGTGTTTTAAGCCTGTCGG + Intronic
963929765 3:150991650-150991672 GATCAGTAATTGAACTCTGTGGG + Intergenic
964447653 3:156777067-156777089 AAACAGTTTTTTAAGTCTCTAGG + Intergenic
964541182 3:157781716-157781738 GATGAGTATTTTAAGTGTGTAGG - Intergenic
965981147 3:174692567-174692589 AAGCTGTATTTTAAGTCTTTTGG + Intronic
965998446 3:174916100-174916122 GAGCATTTTTTTATGTTTGTTGG - Intronic
966503779 3:180676375-180676397 GAGCATTTTTTCATGTCTGTTGG - Intronic
967368629 3:188717168-188717190 GAAAAGAATTTAAAGTCTGTAGG - Intronic
967397348 3:189022931-189022953 GCGCAGTTTTTTAAGCCCGTCGG + Intronic
967853681 3:194100717-194100739 GAGCAGTCTTTAAAGATTGTTGG - Intergenic
968244145 3:197124827-197124849 GAGAGGTATCTTAAGACTGTAGG + Intronic
968272009 3:197410216-197410238 GTGCTGTTTTTTAAGCCTGTTGG - Intergenic
969222092 4:5767604-5767626 GAGCCGTTTTTTAAGCCCGTCGG + Intronic
970084840 4:12334846-12334868 GTGCCGTTTTTTAAGCCTGTCGG - Intergenic
970611487 4:17729064-17729086 GTGCCGTTTTTTAAGCCTGTTGG - Intronic
971656436 4:29352135-29352157 GAGCATTTTTTTATGTTTGTTGG + Intergenic
971672837 4:29585965-29585987 GAGCATTTTTTCATGTCTGTTGG + Intergenic
971705774 4:30040968-30040990 GAGCATAAATGTAAGTCTGTTGG - Intergenic
972178311 4:36434847-36434869 GAGCATTTTTTCATGTCTGTTGG + Intergenic
972894694 4:43605805-43605827 GAGCATTTTTTCATGTCTGTTGG - Intergenic
973183315 4:47294419-47294441 GCGCCGTTTTTTAAGCCTGTCGG - Intronic
973530888 4:51835926-51835948 GGCCAGTATTTTAAGGCAGTGGG - Intergenic
973537388 4:51896986-51897008 TGGCTGTCTTTTAAGTCTGTTGG + Intronic
973569528 4:52224055-52224077 GCGCCATATTTTAAGCCTGTCGG + Intergenic
974143597 4:57919349-57919371 GCGCCGTTTTTTAAGCCTGTTGG + Intergenic
974237988 4:59206754-59206776 GCGCCGTTTTTTAAGCCTGTCGG - Intergenic
974532286 4:63124401-63124423 CAGCAGTTTTATAAGGCTGTGGG - Intergenic
976354539 4:84101791-84101813 GAGCATTTTTTCATGTCTGTTGG - Intergenic
977489674 4:97696762-97696784 GAGCATTATTTAATGTCTGTTGG - Intronic
977703718 4:100049160-100049182 GCGCCGTTTTTTAAGCCTGTCGG + Intergenic
978418406 4:108503425-108503447 GCGCCGTTTTTTAAGTCTGTTGG - Intergenic
979352659 4:119663402-119663424 GAAAAGTATTTTTTGTCTGTTGG - Intergenic
979750217 4:124270129-124270151 GAGCATTTTTTCATGTCTGTTGG + Intergenic
979878461 4:125924203-125924225 GAGCTGCATTTTGAGTCTGCTGG + Intergenic
980336447 4:131480505-131480527 GAGCATTTTTTCATGTCTGTTGG - Intergenic
981059981 4:140413644-140413666 GCGCCGTTTTTTAAGCCTGTTGG - Intronic
981899736 4:149848506-149848528 GCGCCGTTTTTTAAGCCTGTTGG - Intergenic
982150797 4:152454510-152454532 GAGAAGTACTTTAAGTCTATTGG + Intronic
982581189 4:157180594-157180616 GCGCCGTTTTTTAAGCCTGTTGG + Intergenic
984044333 4:174778759-174778781 GCGCCGTTTTTTAAGCCTGTCGG - Intronic
984063435 4:175020041-175020063 GCGCCGTTTTTTAAGCCTGTCGG - Intergenic
985237023 4:187886231-187886253 GAGCAGTTTTTCATGTTTGTTGG + Intergenic
986379627 5:7170850-7170872 GCGCCGTTTTTTAAGCCTGTCGG - Intergenic
987618071 5:20302879-20302901 GAGCATTCTTTGAAGTCTCTGGG - Intronic
987994782 5:25262994-25263016 CAGCATCATTTGAAGTCTGTTGG - Intergenic
989302483 5:39910478-39910500 GAGCATTTTTTTCTGTCTGTTGG - Intergenic
989867253 5:46530094-46530116 GAGCAGTTTTGAAAGTCTTTTGG + Intergenic
989867896 5:46541358-46541380 GAGCAGTTTTGAAAGTCTTTTGG + Intergenic
990745119 5:58951162-58951184 AAGCTGTATCTTCAGTCTGTTGG - Intergenic
991572026 5:68065071-68065093 GAGCATTTTTTCATGTCTGTTGG - Intergenic
992926382 5:81592151-81592173 GTGCTGTTTTTTAAGCCTGTTGG - Intronic
993528229 5:88993008-88993030 GAGCAGTTTCTCATGTCTGTTGG - Intergenic
993555569 5:89332367-89332389 GAGCATTTTTTCATGTCTGTTGG - Intergenic
993925226 5:93857614-93857636 GCGCCGTATTTTAAGCCCGTCGG + Intronic
994623222 5:102187856-102187878 GAGCATTTTTGTATGTCTGTTGG + Intergenic
995302898 5:110605139-110605161 AACAAGTATTTTAAGTCTTTTGG - Exonic
995413172 5:111881138-111881160 GCGCCGTTTTTTAAGCCTGTCGG - Intronic
995642494 5:114273612-114273634 GAGCATTTTTTCATGTCTGTTGG + Intergenic
996419111 5:123242312-123242334 GCGCCGTTTTTTAAGCCTGTCGG + Intergenic
996751750 5:126896013-126896035 GCGCCGTTTTTTAAGCCTGTCGG + Intronic
996813349 5:127544709-127544731 GCGCTGTTTTTTAAGCCTGTTGG + Intronic
996989459 5:129611048-129611070 GAGCATTTTTTCACGTCTGTTGG + Intronic
997062628 5:130525360-130525382 GAGCATTTTTTCATGTCTGTTGG - Intergenic
997066592 5:130567245-130567267 GAGCATTTTTTCATGTCTGTTGG - Intergenic
997078026 5:130704308-130704330 GAGCATTTTTTCATGTCTGTTGG - Intergenic
997941944 5:138165856-138165878 GAGCTGGATTTTGAGACTGTTGG - Exonic
999555340 5:152736063-152736085 GAACATTTTTTTATGTCTGTTGG + Intergenic
1000362021 5:160456530-160456552 GAGCAGGCTTCTAAGTCTCTTGG - Intergenic
1000793594 5:165636890-165636912 GAGAAGTTTCTTAGGTCTGTTGG - Intergenic
1000952938 5:167506967-167506989 GAAAAGTTGTTTAAGTCTGTTGG - Intronic
1001592722 5:172877345-172877367 CAGCAGTATTTTCAGTATATGGG + Intronic
1003457877 6:6300446-6300468 GCGCCGTTTTTTAAGCCTGTCGG + Intronic
1004303628 6:14480274-14480296 GCGCAGTTTTTTAAGCCTGTCGG - Intergenic
1005259974 6:24048414-24048436 GAGCAGCATTTTAAGTCGGTAGG - Intergenic
1006168577 6:32080174-32080196 AAGCACTATTCTAAGTGTGTGGG + Intronic
1007056906 6:38895336-38895358 GAGCATTTTTTTAAGACAGTGGG - Intronic
1007292503 6:40798228-40798250 GAGCAGGCTTTTAACTCTGCAGG + Intergenic
1008039283 6:46778985-46779007 GAGCATTCTTTCAAGTCTGTTGG - Intergenic
1008349878 6:50477827-50477849 GTGCCGTTTGTTAAGTCTGTTGG - Intergenic
1008687559 6:53942416-53942438 GTGCAGTATACTTAGTCTGTGGG - Intronic
1008968080 6:57335149-57335171 GCGCCGTTTTTTAAGCCTGTCGG - Intronic
1009709148 6:67295344-67295366 GAGCATTTTTTCATGTCTGTTGG + Intergenic
1009784656 6:68319225-68319247 GAGCATTTTTTTATGTTTGTGGG + Intergenic
1010183081 6:73110869-73110891 GAGCTGGATTTTAAATCTGAGGG - Intronic
1010652093 6:78467507-78467529 GTGCAGTTTTTTAAGCCCGTGGG - Intergenic
1011318022 6:86057636-86057658 GCGCAATTTTTTAAGCCTGTCGG + Intergenic
1012882289 6:104805087-104805109 GAGCATTTTTTCATGTCTGTTGG - Intronic
1013868437 6:114726430-114726452 GCGCCGTTTTTTAAGCCTGTCGG + Intergenic
1013898371 6:115121552-115121574 GTGCTGTTTTTTAAGCCTGTCGG - Intergenic
1014185211 6:118427108-118427130 GCGCTGTTTTTTAAGCCTGTCGG - Intergenic
1014381503 6:120748653-120748675 GCGCCGTTTTTTAAGCCTGTCGG - Intergenic
1014605782 6:123472369-123472391 GCGCCGTTTTTTAAGCCTGTCGG - Intronic
1015069544 6:129074976-129074998 AAGCAGTGTTCTAAGCCTGTAGG + Intronic
1015240593 6:131018799-131018821 GAGCAGTGTTATAAATCAGTAGG - Intronic
1015385546 6:132618754-132618776 GAGCTGTATCTTACGTGTGTAGG + Intronic
1015389605 6:132666415-132666437 CTGCAGTATATTTAGTCTGTGGG - Intergenic
1018168837 6:161127491-161127513 TTTCAGTAATTTAAGTCTGTAGG + Intergenic
1018916907 6:168138689-168138711 GAGGAGCATTTGATGTCTGTGGG - Intergenic
1019752906 7:2743839-2743861 GTGCCGTTTTTTAAGCCTGTTGG - Intronic
1020881311 7:13765944-13765966 GCGCCGTTTTTTAAGCCTGTCGG - Intergenic
1021306890 7:19043285-19043307 GAGCATTTTTTTATGTTTGTTGG + Intronic
1021373888 7:19883472-19883494 GAGCCGTTTTTTAAGCCCGTGGG + Intergenic
1022142794 7:27507877-27507899 GCGCCGTTTTTTAAGCCTGTCGG + Intergenic
1022188310 7:27991127-27991149 GAGGAGTGTTTTTAGTCTCTTGG - Intronic
1022237554 7:28476729-28476751 GAGCAATCTTTTAATTCTTTCGG - Intronic
1022244850 7:28549275-28549297 CAGCAGTATTTGACATCTGTTGG - Intronic
1022411813 7:30144720-30144742 GAGCAGTATTTTAAGTCTGTAGG + Intronic
1022652232 7:32287801-32287823 AATTAGTATTTAAAGTCTGTAGG - Intronic
1023147772 7:37169169-37169191 GCGCCGTTTTTTAAGCCTGTTGG + Intronic
1023385994 7:39658390-39658412 AAGTAGTATGTTCAGTCTGTTGG + Intronic
1023709720 7:42979087-42979109 GAGCATTTTTTTATGTTTGTTGG - Intergenic
1023794271 7:43778983-43779005 GTGCTGTTTTTTAAGCCTGTTGG + Intronic
1027331546 7:77100754-77100776 GAGCAGTTTTTCATGTTTGTTGG + Intergenic
1027989235 7:85335421-85335443 GCGCCGTTTTTTAAGCCTGTTGG + Intergenic
1028236694 7:88371546-88371568 GAGCATTTTTTCATGTCTGTTGG + Intergenic
1028412529 7:90546158-90546180 GAGCATTTTTTCATGTCTGTTGG + Intronic
1028499812 7:91507039-91507061 GCGCCGTTTTTTAAGCCTGTAGG - Intergenic
1028817324 7:95161284-95161306 GAGCATTGTTTTATGTTTGTTGG + Intronic
1028944138 7:96557895-96557917 GAGCCGTTTTTTAAGGCCGTTGG + Intronic
1029036999 7:97532862-97532884 GAGCCGTTTTTTAAGCCTGTCGG - Intergenic
1029855338 7:103509871-103509893 GAGCATTTTTTCAAGTTTGTTGG - Intronic
1030345215 7:108425439-108425461 GTGCAGTATTTTAAATCAGTGGG + Intronic
1031617119 7:123894799-123894821 GCGCCGTTTTTTAAGCCTGTCGG - Intergenic
1031639705 7:124146238-124146260 CAGCAATATTTCAAGTTTGTAGG + Intergenic
1031729322 7:125278417-125278439 GAGCAATATTCTGAGACTGTAGG - Intergenic
1032628548 7:133621510-133621532 GTGCAGTATCTTACGTGTGTTGG - Intronic
1032904573 7:136349403-136349425 AAGCAGTGCTTTATGTCTGTAGG + Intergenic
1032972519 7:137181910-137181932 GCGCCGTTTTTTAAGCCTGTCGG - Intergenic
1033839200 7:145353499-145353521 GAGCATTTTTTCACGTCTGTTGG + Intergenic
1034382117 7:150706539-150706561 GCGCTGTTTTTTAAGCCTGTTGG - Intergenic
1036129098 8:6091611-6091633 GCGCCGTTTTTTAAGCCTGTTGG + Intergenic
1037544971 8:19910762-19910784 GAGCATTTTTTCATGTCTGTTGG + Intronic
1038470421 8:27812702-27812724 GAGCATTTTTTCATGTCTGTTGG - Intronic
1040754714 8:50759070-50759092 GAGCATTTTTTCATGTCTGTTGG + Intronic
1040785842 8:51161071-51161093 GAGCAGTATTATATGTAAGTGGG + Intergenic
1040865707 8:52047164-52047186 GTGCCGTTTTTTAAGCCTGTTGG + Intergenic
1041022760 8:53655074-53655096 GAGAACTCTTTTAAGTCTTTGGG - Intergenic
1041301412 8:56415523-56415545 GCGCCGTTTTTTAAGCCTGTCGG - Intergenic
1043241520 8:77940811-77940833 GAGCCGTTTTTTAAGCCCGTCGG - Intergenic
1044279243 8:90337300-90337322 GAGCAGAATTTTAAGGGAGTAGG - Intergenic
1044853186 8:96448889-96448911 GAGGGGTCTTTTAGGTCTGTAGG - Intergenic
1045293419 8:100852624-100852646 GTGCCGTTTTTTAAGCCTGTTGG - Intergenic
1045381694 8:101634077-101634099 GTGCAGACTTTTCAGTCTGTTGG + Intronic
1045878005 8:107005096-107005118 GAGCATTTTTTCATGTCTGTTGG - Intergenic
1046396910 8:113651654-113651676 GATCAGAATTTTAAATCTTTGGG + Intergenic
1048640790 8:136358301-136358323 GAGCATTTTTTTATGTTTGTTGG + Intergenic
1050048553 9:1574724-1574746 GCGCCGTTTTTTAAGCCTGTCGG + Intergenic
1051005077 9:12334294-12334316 GCGCCGTTTTTTAAGCCTGTCGG - Intergenic
1051174570 9:14349178-14349200 GAGCAGTCTTTGTAGCCTGTTGG + Intronic
1051598005 9:18844867-18844889 GTGCCGTTTTTTAAGCCTGTCGG + Intronic
1051926241 9:22330170-22330192 GAGCATTTTTTCATGTCTGTTGG + Intergenic
1051996469 9:23223695-23223717 GAGCATTTTTTCATGTCTGTTGG + Intergenic
1052089007 9:24304071-24304093 GACCAGTATTTTAAATCTCCTGG + Intergenic
1052174557 9:25442564-25442586 GAGCAGTTTTCAAAGTTTGTGGG + Intergenic
1052239069 9:26250072-26250094 GAGCTGTTTTTTAAGCCTGTCGG - Intergenic
1052400047 9:27988605-27988627 GAGCATTTTTTCATGTCTGTCGG + Intronic
1053038825 9:34851430-34851452 GCGCCGTTTTTTAAGCCTGTTGG + Intergenic
1055860836 9:80747370-80747392 GAGCCGTTTTTTAAGCCCGTCGG + Intergenic
1056417909 9:86395351-86395373 GAGCATTTTTTCATGTCTGTTGG - Intergenic
1056504044 9:87239816-87239838 GAGCAGCATTTTATGTCCATTGG + Intergenic
1058104205 9:100951682-100951704 GAGCATTTTTTTATGTTTGTTGG + Intergenic
1058215165 9:102223611-102223633 GCGCCGTTTTTTAAGCCTGTCGG + Intergenic
1058444040 9:105038346-105038368 GAGCGGTTTTATAAATCTGTTGG - Intergenic
1059973434 9:119691145-119691167 GAGCAGTATTCTAGGTATATGGG + Intergenic
1060324109 9:122595847-122595869 GTGCCGTTTTTTAAGGCTGTCGG + Intergenic
1062296994 9:135836027-135836049 AAGCTGTTTTTTGAGTCTGTTGG - Intronic
1203422491 Un_GL000195v1:6810-6832 GAGCAATTTTTCATGTCTGTTGG + Intergenic
1203408667 Un_KI270538v1:72594-72616 GAGCAGTTTTGAAAGTCTTTTGG - Intergenic
1203408974 Un_KI270538v1:78392-78414 GAGCAGTTTTGAAAGTCTTTTGG - Intergenic
1185942504 X:4337392-4337414 GAGCAGCATTTTAAGTGAATTGG - Intergenic
1186001315 X:5014626-5014648 CAGAAGTACTTTAAGTTTGTAGG - Intergenic
1186243349 X:7593432-7593454 GCGCCGTTTTTTAAGCCTGTCGG + Intergenic
1186592078 X:10941371-10941393 GAGCATTTTTTCATGTCTGTTGG + Intergenic
1187105401 X:16236532-16236554 ACGCCGTTTTTTAAGTCTGTCGG + Intergenic
1188998252 X:36912859-36912881 GAGCATTTTTTCATGTCTGTTGG - Intergenic
1189542275 X:42004599-42004621 GTGCCGTTTTTTAAGCCTGTCGG - Intergenic
1190593231 X:52026268-52026290 GCGCCGTTTTTTAAGCCTGTCGG + Intergenic
1190965645 X:55298413-55298435 GAGCATTTTTTCATGTCTGTTGG + Intergenic
1191266206 X:58396912-58396934 GTGCCGTTTTTTAAGCCTGTTGG + Intergenic
1191728764 X:64311259-64311281 GAGCATTTTTTCATGTCTGTTGG + Intronic
1191993567 X:67065816-67065838 GTGCCGTTTGTTAAGTCTGTTGG + Intergenic
1192024596 X:67435778-67435800 GGGCAGGATTTTCAGTCTGGGGG + Intergenic
1192843187 X:74878693-74878715 GCGCCGTTTTTTAAGCCTGTTGG + Intronic
1192866602 X:75140203-75140225 GAGGAGTAATGTAAGTGTGTTGG + Intronic
1193015298 X:76725735-76725757 GTGCCGTTTTTTAAGCCTGTCGG + Intergenic
1193141775 X:78035191-78035213 GAGCGGTAGTGGAAGTCTGTGGG - Intronic
1193445989 X:81603209-81603231 GAGCATTTTTTTATGTTTGTTGG - Intergenic
1193765979 X:85529508-85529530 GTGCAGTTTTTTAAGCCCGTCGG - Intergenic
1193776373 X:85647718-85647740 GAGCATTTTTTTATGTTTGTTGG - Intergenic
1194074539 X:89372287-89372309 GAGCATTTTTTCATGTCTGTTGG - Intergenic
1194359642 X:92933990-92934012 GAGCATTTTTTCATGTCTGTTGG - Intergenic
1195233718 X:102877003-102877025 GTGCCGTTTTTTAAGCCTGTTGG + Intergenic
1195338400 X:103879440-103879462 AAGGAGTATGTTTAGTCTGTGGG + Intergenic
1196350762 X:114726219-114726241 GCGCCGTTTTTTAAGCCTGTTGG + Intronic
1196355973 X:114793200-114793222 GAAAAGTATTATATGTCTGTAGG - Intronic
1196561085 X:117149256-117149278 AAGCAGTTTTTTATGTTTGTTGG + Intergenic
1197410518 X:126109827-126109849 GTGCCGTTTTTTAAGCCTGTCGG + Intergenic
1197648995 X:129044519-129044541 GCGCCGTTTTTTAAGCCTGTCGG - Intergenic
1197880139 X:131157973-131157995 GCGCAGTTTTTTAAGCCCGTCGG + Intergenic
1198418565 X:136445978-136446000 GCGCCGTTTTTTAAGCCTGTCGG + Intergenic
1198643194 X:138778604-138778626 GTGCCGTTTTTTAAGCCTGTCGG - Intronic
1199064708 X:143401363-143401385 AAGCAATATATTAAGTTTGTAGG - Intergenic
1199379180 X:147147843-147147865 GTGCCGTTTTTTAAGCCTGTCGG + Intergenic
1199933098 X:152544820-152544842 GTGCCGTTTTTTAAGCCTGTCGG - Intergenic
1199985847 X:152949537-152949559 GGGCAGCATTTAGAGTCTGTGGG + Intronic
1200667837 Y:6049813-6049835 GAGCAGTTTTTCATGTCTGTTGG - Intergenic
1200729934 Y:6723813-6723835 GAGCATTTTTTCATGTCTGTTGG - Intergenic
1201415638 Y:13746420-13746442 GTGCTGTTTTTTAAGCCTGTCGG + Intergenic
1201447002 Y:14068225-14068247 GAGTCTTATTTTAAGTCTGTTGG - Intergenic
1201614820 Y:15885735-15885757 GAGCCGTTTTTTAAGCCCGTCGG - Intergenic
1201954934 Y:19613292-19613314 GCGCTGTTTTTTAAGCCTGTTGG - Intergenic
1202072973 Y:21011616-21011638 GCGCCGTTTTTTAAGCCTGTCGG + Intergenic
1202077673 Y:21053470-21053492 GCGCCGTTTTTTAAGCCTGTCGG + Intergenic