ID: 1022414013

View in Genome Browser
Species Human (GRCh38)
Location 7:30162746-30162768
Sequence AAGAGCCTTTCAAACTCTGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 205}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022414011_1022414013 -6 Left 1022414011 7:30162729-30162751 CCATTCGCTTGCTATTAAAGAGC 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1022414013 7:30162746-30162768 AAGAGCCTTTCAAACTCTGGTGG 0: 1
1: 0
2: 2
3: 17
4: 205
1022414010_1022414013 5 Left 1022414010 7:30162718-30162740 CCATGTAATTACCATTCGCTTGC 0: 1
1: 0
2: 0
3: 5
4: 51
Right 1022414013 7:30162746-30162768 AAGAGCCTTTCAAACTCTGGTGG 0: 1
1: 0
2: 2
3: 17
4: 205
1022414006_1022414013 30 Left 1022414006 7:30162693-30162715 CCCTGAGAGTGAGGACCTCATCC 0: 1
1: 0
2: 5
3: 20
4: 220
Right 1022414013 7:30162746-30162768 AAGAGCCTTTCAAACTCTGGTGG 0: 1
1: 0
2: 2
3: 17
4: 205
1022414009_1022414013 9 Left 1022414009 7:30162714-30162736 CCGACCATGTAATTACCATTCGC 0: 1
1: 0
2: 0
3: 2
4: 53
Right 1022414013 7:30162746-30162768 AAGAGCCTTTCAAACTCTGGTGG 0: 1
1: 0
2: 2
3: 17
4: 205
1022414008_1022414013 15 Left 1022414008 7:30162708-30162730 CCTCATCCGACCATGTAATTACC 0: 1
1: 0
2: 0
3: 4
4: 61
Right 1022414013 7:30162746-30162768 AAGAGCCTTTCAAACTCTGGTGG 0: 1
1: 0
2: 2
3: 17
4: 205
1022414007_1022414013 29 Left 1022414007 7:30162694-30162716 CCTGAGAGTGAGGACCTCATCCG 0: 1
1: 0
2: 0
3: 7
4: 82
Right 1022414013 7:30162746-30162768 AAGAGCCTTTCAAACTCTGGTGG 0: 1
1: 0
2: 2
3: 17
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022414013 Original CRISPR AAGAGCCTTTCAAACTCTGG TGG Exonic
902712165 1:18247867-18247889 AAGTGGGATTCAAACTCTGGTGG + Intronic
902871827 1:19318287-19318309 ACGAGACTGTCAAAGTCTGGAGG - Intronic
903459794 1:23512733-23512755 AAGAGCCATTCAGAGTGTGGTGG - Intronic
904356694 1:29944914-29944936 AAGACCCTCTGAGACTCTGGGGG + Intergenic
905518943 1:38582682-38582704 AAGAGCTTTCCAAGCTATGGGGG - Intergenic
907011039 1:50963251-50963273 AAGAAACTTTCAACCTTTGGGGG - Intronic
907576340 1:55529220-55529242 AAGGTCTCTTCAAACTCTGGTGG - Intergenic
908132820 1:61092486-61092508 AAGATCCTTTCAATCACTGAAGG + Intronic
910293115 1:85617643-85617665 AAGGGCCTTTCTCACTCTGAAGG - Intergenic
911526629 1:98995474-98995496 AAGAGACTTTCAAGCTATGTGGG + Intronic
912654177 1:111470779-111470801 AACACCCTGTCAAGCTCTGGAGG - Intergenic
918647189 1:186918346-186918368 AAGGGCCTGTTAAACTCTGGGGG - Intronic
919312088 1:195924151-195924173 ATGTGCCTTTAAAACTTTGGAGG - Intergenic
924202814 1:241677574-241677596 AGCAGCCTTTCATACTCTTGTGG - Intronic
1062938738 10:1406569-1406591 ATGGGTCTTTCAAACTTTGGTGG + Intronic
1063952329 10:11234836-11234858 AAGTGCCTTTTTAACTCTGCAGG - Intronic
1064257091 10:13751548-13751570 CACAGCCTTGCAAGCTCTGGGGG - Intronic
1064397222 10:14991668-14991690 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1064400119 10:15014138-15014160 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1065609141 10:27453563-27453585 ATGAGCCATTTTAACTCTGGTGG + Intergenic
1066390402 10:34973491-34973513 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1068265062 10:54636992-54637014 AAAAGCCTTTCAAACTTTTATGG + Intronic
1070360496 10:75683944-75683966 AAAAACCTATAAAACTCTGGTGG - Intronic
1071282221 10:84113206-84113228 AAAGGCCTGTTAAACTCTGGAGG + Intergenic
1072617849 10:97061346-97061368 AAGAGCCTTTGAAAAAATGGAGG + Intronic
1074211297 10:111337718-111337740 AACAGCATTTCCAACTCTGGGGG + Intergenic
1076447014 10:130522722-130522744 CAGATCCTATCAAACTCTGATGG + Intergenic
1077584811 11:3443182-3443204 AAGTGACTTCCAAACTTTGGAGG - Intergenic
1077589034 11:3477521-3477543 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1084244729 11:67849144-67849166 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1084827955 11:71745412-71745434 AAGAGCCTATTGAACTCTGGGGG + Intergenic
1084847464 11:71911683-71911705 AAGGGCCTATTGAACTCTGGGGG + Intronic
1085521886 11:77143929-77143951 AAGGGTCTTGCAAACTCTGAGGG - Intronic
1087540410 11:99510313-99510335 AAGAGACTCTCAAACACTGTTGG + Intronic
1089879644 11:121761388-121761410 GAGAGCTTATCAAACCCTGGAGG - Intergenic
1091372796 11:135074805-135074827 TAGAGCCTGTCACTCTCTGGTGG + Intergenic
1092415293 12:8286289-8286311 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1092432376 12:8419890-8419912 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1093289298 12:17301616-17301638 AAAGGCCTGTTAAACTCTGGGGG + Intergenic
1098318027 12:69212602-69212624 AAAAGCATTTCAAACTATTGTGG + Intergenic
1098748643 12:74269065-74269087 AAGGGCCTGTTAAACTCTGGGGG + Intergenic
1098752407 12:74311779-74311801 GAGAGTCTTTCAAACTCTGGAGG - Intergenic
1101610097 12:106283427-106283449 AACAGCATTCCTAACTCTGGCGG - Intronic
1103799843 12:123531093-123531115 AAGAGCCTTTGAGACTCTGCAGG + Intronic
1104594756 12:130113544-130113566 AGAATCCTTCCAAACTCTGGGGG - Intergenic
1106218186 13:27721737-27721759 AAGAGTCCTTCAAACTGTGATGG + Intergenic
1106605324 13:31223576-31223598 AAGATACTTACAAACTATGGCGG - Intronic
1107544157 13:41421456-41421478 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1108510258 13:51149017-51149039 ATCAGCCTTTCAAACTGTGTGGG - Intergenic
1108905315 13:55463423-55463445 ATGAGCTTTCCAAACTCTGAGGG - Intergenic
1109779966 13:67096739-67096761 AAAAGTCTGTAAAACTCTGGTGG + Intronic
1109803003 13:67401929-67401951 AAGGGCCTGTTAAACTCTGGGGG + Intergenic
1111572456 13:90105306-90105328 TAGAGCCTCTCAAACTTTGCAGG - Intergenic
1111913279 13:94335263-94335285 AAAAGCCTTTCAAATTAAGGTGG + Intronic
1113526461 13:110981945-110981967 AAAGTACTTTCAAACTCTGGAGG + Intergenic
1115645252 14:35364814-35364836 AAGAGTCGTTTGAACTCTGGAGG + Intergenic
1116757481 14:48965968-48965990 ATGAGCCTCTCAGATTCTGGGGG + Intergenic
1117038795 14:51751683-51751705 AAGGGCCTATCGAACTCTGGGGG + Intergenic
1117383848 14:55191878-55191900 AAAAGCCTTGCGAGCTCTGGGGG - Intergenic
1120655555 14:87185795-87185817 AGATGCCTTTCAAACTTTGGAGG - Intergenic
1121134182 14:91479992-91480014 AAGAGCTTTTCTAATTTTGGGGG + Intronic
1121367724 14:93330160-93330182 GAGAGCCTTTGAAAGTTTGGAGG - Intronic
1121700168 14:95946911-95946933 CAGAGCCTTCCAGACTCTGAAGG - Intergenic
1123480457 15:20626780-20626802 ATGATGCTTTCATACTCTGGAGG - Intergenic
1123637551 15:22373587-22373609 ATGATGCTTTCATACTCTGGAGG + Intergenic
1127096303 15:55515089-55515111 AAGGGCCGGTTAAACTCTGGGGG - Intergenic
1127338533 15:58015623-58015645 TAGAGACTGTCAGACTCTGGAGG - Intronic
1128224653 15:65993528-65993550 AAGAGCCTTTCAAAGGCAGCTGG + Intronic
1129770769 15:78201977-78201999 AAGTGGCTTCCAAACTCTGCAGG - Intronic
1131417126 15:92270003-92270025 AAGAGCCTTTTGAAATCTGAGGG - Intergenic
1131504948 15:93009299-93009321 AGGAGCACATCAAACTCTGGAGG + Exonic
1131581765 15:93650026-93650048 AACAGCCAGTCAAAATCTGGAGG - Intergenic
1136185640 16:28587295-28587317 AAGTGGCTTTCAAACCTTGGTGG - Intronic
1137936270 16:52638163-52638185 AATAGCCTTACACACTCTGAAGG - Intergenic
1140407864 16:74722953-74722975 AATAGCCTTTGAAGTTCTGGTGG - Intronic
1145864846 17:28234496-28234518 AAGCGCCTATTGAACTCTGGGGG - Intergenic
1148330766 17:46812547-46812569 AAGAGTCTGGCAGACTCTGGGGG + Intronic
1148342938 17:46884174-46884196 TAGAGCCTGTCAGGCTCTGGTGG - Intronic
1150582516 17:66487703-66487725 AATAGCCATTCTAACTGTGGTGG + Intronic
1150887761 17:69107419-69107441 AAGAGCCTTTCACAGCCTGAAGG + Intronic
1153696235 18:7645822-7645844 AAGATCCTTGCAAACTCCTGAGG - Intronic
1156014353 18:32531326-32531348 AAGAACCTTTCAAAGTATTGTGG + Intergenic
1158268309 18:55684180-55684202 CAGACCCTTTCAAAGTGTGGAGG - Intergenic
1160047329 18:75399133-75399155 AAGAGCCTTTCTGGCTCAGGAGG - Intergenic
1162284204 19:9726110-9726132 AAGGGCCTGTTAAACTCTGGGGG - Intergenic
1163023657 19:14496674-14496696 AAGATGCATTCAATCTCTGGGGG + Intergenic
1163943208 19:20513824-20513846 AAGGGCCTGTTAAACTCTGGGGG - Intergenic
1163966372 19:20750816-20750838 AAGGGCCTATTGAACTCTGGGGG - Intronic
1166536837 19:43580034-43580056 AAGAGACTTTCAATCACAGGAGG + Intronic
1168021660 19:53613237-53613259 AAGCGCCTGTCAAACTCTTGTGG + Intergenic
925822723 2:7816201-7816223 AAAATCCTTGCAAAGTCTGGAGG + Intergenic
926789280 2:16553942-16553964 AAGAGCCTTCCAGAGTCTGTGGG - Intronic
926892018 2:17646998-17647020 AAGAGCCTTCAAATTTCTGGAGG - Intronic
928849452 2:35726813-35726835 AAGAACTTTTCAATCTCTTGGGG + Intergenic
929024507 2:37586740-37586762 AAGAGCTTTTCAAAATCATGAGG + Intergenic
929347126 2:40898027-40898049 AAGAGACATTCAAATTCTTGTGG + Intergenic
930525281 2:52521364-52521386 AAGGGTCTTTTATACTCTGGTGG + Intergenic
931589330 2:63864687-63864709 AAGTTTCTTTCAAACACTGGTGG - Intronic
932349946 2:71023607-71023629 AAGGGCCTATTGAACTCTGGGGG + Intergenic
932658490 2:73631082-73631104 AATAGCCTTTTTAACTCTGAGGG - Intergenic
932665103 2:73691089-73691111 AATAGCCTTTTTAACTCTGAGGG - Intergenic
932893029 2:75612366-75612388 AAGAGCCTTTGTAGGTCTGGAGG - Intergenic
933865099 2:86508941-86508963 AATAGCCCTTCACACTCTGGAGG + Intronic
933989880 2:87626581-87626603 AAGAGCCCTTCGATCTGTGGTGG + Intergenic
935312063 2:101794052-101794074 AAGAGCCTTTCAAAATCCTAAGG - Intronic
935873185 2:107474317-107474339 AAGAGCCTTTTAAAGTTTCGAGG + Intergenic
937360158 2:121224100-121224122 AGGAACCATTCAAAATCTGGAGG + Exonic
939233252 2:139458350-139458372 AACAGCATTTCATACTCTGGAGG - Intergenic
940345437 2:152623524-152623546 AATGGCCTTTGTAACTCTGGAGG + Intronic
940869526 2:158848384-158848406 AAGGGCCTATTGAACTCTGGGGG + Intronic
940872202 2:158869382-158869404 AAGGGCCTATTGAACTCTGGGGG + Intergenic
940874409 2:158885370-158885392 AAGGGCCTATTGAACTCTGGGGG + Intergenic
947595003 2:231405528-231405550 AAGGGCCTATTGAACTCTGGGGG + Intergenic
948655609 2:239475249-239475271 CAGAGCCTGCCATACTCTGGAGG - Intergenic
1169747106 20:8953640-8953662 AAGTACCTTTCAAACCCTGAGGG - Intronic
1170091852 20:12597818-12597840 AAGAGCCTCTGGAACACTGGGGG + Intergenic
1171408547 20:24930246-24930268 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1172211173 20:33199571-33199593 AAGAGCCTTTCCAACTCTGATGG + Intergenic
1172834970 20:37867548-37867570 AAGAGCATTTGAAAATGTGGGGG + Intronic
1174343528 20:49913261-49913283 CTGACCCTTTCAAACTCTGTTGG - Intronic
1178447716 21:32660793-32660815 AAGGGCCTGTTAAACTCTAGGGG + Intronic
1178966302 21:37122014-37122036 AATTCCCTTTCAAACTTTGGAGG + Intronic
1183682193 22:39338669-39338691 GAGAAACTTTCAAACTCTGCTGG - Intergenic
1184249293 22:43251082-43251104 AAGTCCCTTGCAAACTCTAGAGG + Intronic
1184284629 22:43463047-43463069 AAATGCCTTCCAAACTCTAGGGG - Intronic
949980979 3:9501531-9501553 AAAAGACTTTCAGGCTCTGGAGG - Exonic
950354398 3:12392971-12392993 AAGAGACTTGAAAAATCTGGGGG + Intronic
951166009 3:19485884-19485906 AAGGGCCTGTTAAACCCTGGGGG - Intronic
951272343 3:20641509-20641531 AAGAGCATTTTCAACTCTTGGGG - Intergenic
951920703 3:27851598-27851620 GAGAGCCTTTCAATGTGTGGAGG + Intergenic
954634142 3:52062480-52062502 ATGAGCATTTAAAACTCTGCTGG + Intergenic
956389979 3:68761485-68761507 AAAAGCCTTGCAAAATCTGAGGG + Intronic
957076184 3:75604895-75604917 AAGGGCCTATTGAACTCTGGGGG - Intergenic
959111296 3:102125746-102125768 AAGACCCTTTCAAAGCCTTGAGG + Intronic
959597298 3:108142535-108142557 GAGAGCCTTCCAAACAGTGGGGG - Intergenic
959974840 3:112447176-112447198 AAGAATTTTTAAAACTCTGGTGG + Intergenic
963324022 3:143841616-143841638 ATTAGCCTTTCAAACACTGAGGG + Intronic
964042694 3:152281730-152281752 AAGAGCATTTGAAACTCTTTTGG - Intronic
964522395 3:157583191-157583213 AAGGGCCTGTTAAACTCTGGGGG - Intronic
966642558 3:182206777-182206799 AAGAGCCTTTCTTTCTTTGGAGG - Intergenic
969729477 4:8945570-8945592 AAGCGCCTATTGAACTCTGGGGG + Intergenic
969734217 4:8976213-8976235 AAGGGCCTCTTGAACTCTGGGGG + Intergenic
969789067 4:9479509-9479531 AAGGGCCTATTGAACTCTGGGGG + Intergenic
969793804 4:9510277-9510299 AAGGGCCTATTGAACTCTGGGGG + Intergenic
970358037 4:15277421-15277443 CTGAGACTTTAAAACTCTGGAGG + Intergenic
971745530 4:30574901-30574923 AAGAGCTTTTCAGAGTTTGGGGG - Intergenic
973706595 4:53587417-53587439 AAAAGCCTTTGATACTTTGGAGG + Intronic
977400561 4:96525881-96525903 AAGACCCTTGGAATCTCTGGAGG - Intergenic
979227420 4:118303860-118303882 TAGAGGCTTTCAAACTTTGGAGG - Intronic
979663793 4:123288730-123288752 AAGAGCCTTTGAAGGACTGGAGG + Intronic
980780151 4:137483063-137483085 AAGGGCCTGTTAAACTCTGGGGG + Intergenic
984108326 4:175577869-175577891 AAGAGCTATTCCAACTCTGTAGG + Intergenic
984462536 4:180056635-180056657 AAGAGTTGTTCAAACTATGGTGG + Intergenic
986755701 5:10834033-10834055 AAAATCCTTTCTAGCTCTGGTGG - Intergenic
987041277 5:14065042-14065064 AAGTGCCTTTGAAATTCTTGTGG - Intergenic
987829252 5:23074736-23074758 AAGGGACCTTCAAACTCTGAGGG + Intergenic
988316340 5:29634689-29634711 AGGAGACTGTAAAACTCTGGTGG + Intergenic
993563545 5:89443656-89443678 AAGAGCCTTTGTCAGTCTGGAGG + Intergenic
994744813 5:103665255-103665277 AATAACAGTTCAAACTCTGGGGG + Intergenic
995473833 5:112528659-112528681 AAGGTCCTGTTAAACTCTGGGGG + Intergenic
997173574 5:131750700-131750722 AAGAGTCTCTCAAGCTCAGGAGG - Intronic
998494066 5:142571661-142571683 AAGAAGCTTTCACACTCTGCAGG + Intergenic
1002883118 6:1270390-1270412 CAGTGGCTTTCAAATTCTGGAGG - Intergenic
1004340933 6:14806817-14806839 AAGAGCCTTGAACACTCTGATGG + Intergenic
1005509233 6:26497478-26497500 AGGAGCCTTTCAAACTAGGAAGG + Intergenic
1006289405 6:33122979-33123001 AATTGCCTTTCTAATTCTGGGGG + Intergenic
1006542621 6:34752934-34752956 AAGGGCATTTCAAGCTCAGGTGG + Intergenic
1007266767 6:40602204-40602226 AACAGGCTTTCCAACTTTGGTGG + Intergenic
1007285193 6:40742591-40742613 AAGAGCCTGGAAGACTCTGGGGG - Intergenic
1007397624 6:41586639-41586661 ATGAGCCTGTCAGATTCTGGGGG - Intronic
1008142523 6:47848091-47848113 AAGAGCTTTTCACTCTCTGGTGG + Intergenic
1010145756 6:72667920-72667942 AAGAGACTATCACACACTGGAGG + Intronic
1016420652 6:143879079-143879101 AAGAGACTGTCAAAATATGGAGG - Intronic
1017212807 6:151875843-151875865 AAGAGCTTTGCAAACTGTGAAGG + Intronic
1019921806 7:4167982-4168004 AAGAGGCTCTCCAACTCCGGAGG - Intronic
1020307021 7:6843222-6843244 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020311497 7:6872066-6872088 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020323065 7:6954404-6954426 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020415497 7:7941184-7941206 AAGAGCATTTCAAACTCAACGGG + Intronic
1020780432 7:12510594-12510616 AATAGCCATTCTAACTGTGGTGG + Intergenic
1022414013 7:30162746-30162768 AAGAGCCTTTCAAACTCTGGTGG + Exonic
1025773316 7:64534230-64534252 AAGATCCTTTCCCACTCTGTGGG - Intronic
1026748840 7:73033890-73033912 AAGAGCCCTTCATGCCCTGGAGG + Intergenic
1026752488 7:73062035-73062057 AAGAGCCCTTCATGCCCTGGAGG + Intergenic
1026756139 7:73090166-73090188 AAGAGCCCTTCATGCCCTGGAGG + Intergenic
1027035037 7:74919185-74919207 AAGAGCCCTTCATGCCCTGGAGG + Intergenic
1027091266 7:75303258-75303280 AAGAGCCCTTCATGCCCTGGAGG - Intergenic
1027094910 7:75331231-75331253 AAGAGCCCTTCATGCCCTGGAGG - Intergenic
1027324429 7:77036454-77036476 AAGAGCCCTTCATGCCCTGGAGG + Intergenic
1029078175 7:97952166-97952188 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1029395020 7:100301954-100301976 AAGAGCCCTTCATGCCCTGGAGG - Intergenic
1029849056 7:103443951-103443973 AGGACTCTTTCAAAATCTGGAGG - Intronic
1030746201 7:113169702-113169724 AAATGCCTTTGAAATTCTGGAGG - Intergenic
1030952524 7:115809299-115809321 AACAGCCTTCCAAATTCTGTGGG + Intergenic
1031317004 7:120271372-120271394 TAGAGCCTTTAAAACTGTGTGGG - Intergenic
1031368076 7:120927604-120927626 ATGAGCCTTTAAACCTGTGGAGG + Intergenic
1031510661 7:122644582-122644604 AAGAACCTTTCAAATACAGGTGG - Intronic
1032918608 7:136520304-136520326 AAGTTTCTTTCAAAATCTGGAGG - Intergenic
1035226897 7:157438653-157438675 AAGAGCCTTCCACACCTTGGAGG + Intergenic
1035371043 7:158379129-158379151 ATGAGCCTTCCCCACTCTGGGGG - Intronic
1035610824 8:962828-962850 AAGAGCCTTGGAAACCCTGATGG + Intergenic
1036082478 8:5572780-5572802 AAAGGGCTTTAAAACTCTGGGGG + Intergenic
1036239833 8:7072337-7072359 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1036903500 8:12689228-12689250 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1038799128 8:30733386-30733408 AAGGGCCTATTGAACTCTGGGGG + Intronic
1039278388 8:35956286-35956308 AAAGGCCTATTAAACTCTGGGGG + Intergenic
1039755456 8:40517585-40517607 AACAAGCTTGCAAACTCTGGTGG - Intergenic
1041008988 8:53523228-53523250 AAGGGCCTGTTGAACTCTGGGGG - Intergenic
1047119293 8:121882592-121882614 AAGAGACTTCTAAACTCTGCTGG + Intergenic
1049690838 8:143958174-143958196 GAGAGCCTTCCATGCTCTGGAGG + Intronic
1053405067 9:37866615-37866637 AAGAGCTGGACAAACTCTGGGGG + Intronic
1056069893 9:82975286-82975308 AAAAGTCTCTCAATCTCTGGAGG + Intergenic
1056917169 9:90756062-90756084 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1058538321 9:105986319-105986341 AATAGGCCTTCAAACTCTGCTGG + Intergenic
1061334721 9:129925033-129925055 AACAGCCTTTCAAATTCCAGAGG - Exonic
1062224082 9:135439214-135439236 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1185751699 X:2615528-2615550 CAGGGCCTCTCAAATTCTGGAGG + Intergenic
1185909967 X:3972196-3972218 AAGGGCCTGTTAAACTCTGGGGG + Intergenic
1187936003 X:24336467-24336489 ACGAGCTTTTAAAACTTTGGAGG - Intergenic
1192484126 X:71510485-71510507 AAAAGCTTTTCAAATTCTGAGGG + Intronic
1193292034 X:79786181-79786203 CACAGCCTTCCAAAATCTGGAGG + Intergenic
1197018380 X:121655343-121655365 CAGTGCATTTCAAGCTCTGGAGG - Intergenic
1200394075 X:155972905-155972927 AAGGGCCTGTTAAACTCTAGGGG - Intergenic
1200948291 Y:8867426-8867448 AAGGGCCTATAGAACTCTGGGGG + Intergenic
1201555107 Y:15259043-15259065 AAGGGTCTGTTAAACTCTGGGGG + Intergenic