ID: 1022414831

View in Genome Browser
Species Human (GRCh38)
Location 7:30168943-30168965
Sequence AGGGTTTGAAAAGCACCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022414831_1022414835 5 Left 1022414831 7:30168943-30168965 CCCTGGGGTGCTTTTCAAACCCT No data
Right 1022414835 7:30168971-30168993 GACCCCATACCTCTAAACTGTGG No data
1022414831_1022414840 25 Left 1022414831 7:30168943-30168965 CCCTGGGGTGCTTTTCAAACCCT No data
Right 1022414840 7:30168991-30169013 TGGAAGAACACAGACACAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022414831 Original CRISPR AGGGTTTGAAAAGCACCCCA GGG (reversed) Intergenic