ID: 1022414833

View in Genome Browser
Species Human (GRCh38)
Location 7:30168962-30168984
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022414833_1022414840 6 Left 1022414833 7:30168962-30168984 CCCTAATTTGACCCCATACCTCT No data
Right 1022414840 7:30168991-30169013 TGGAAGAACACAGACACAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022414833 Original CRISPR AGAGGTATGGGGTCAAATTA GGG (reversed) Intergenic
No off target data available for this crispr