ID: 1022414835

View in Genome Browser
Species Human (GRCh38)
Location 7:30168971-30168993
Sequence GACCCCATACCTCTAAACTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022414832_1022414835 4 Left 1022414832 7:30168944-30168966 CCTGGGGTGCTTTTCAAACCCTA No data
Right 1022414835 7:30168971-30168993 GACCCCATACCTCTAAACTGTGG No data
1022414831_1022414835 5 Left 1022414831 7:30168943-30168965 CCCTGGGGTGCTTTTCAAACCCT No data
Right 1022414835 7:30168971-30168993 GACCCCATACCTCTAAACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022414835 Original CRISPR GACCCCATACCTCTAAACTG TGG Intergenic