ID: 1022414835 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:30168971-30168993 |
Sequence | GACCCCATACCTCTAAACTG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1022414832_1022414835 | 4 | Left | 1022414832 | 7:30168944-30168966 | CCTGGGGTGCTTTTCAAACCCTA | No data | ||
Right | 1022414835 | 7:30168971-30168993 | GACCCCATACCTCTAAACTGTGG | No data | ||||
1022414831_1022414835 | 5 | Left | 1022414831 | 7:30168943-30168965 | CCCTGGGGTGCTTTTCAAACCCT | No data | ||
Right | 1022414835 | 7:30168971-30168993 | GACCCCATACCTCTAAACTGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1022414835 | Original CRISPR | GACCCCATACCTCTAAACTG TGG | Intergenic | ||