ID: 1022414837

View in Genome Browser
Species Human (GRCh38)
Location 7:30168974-30168996
Sequence CTTCCACAGTTTAGAGGTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022414837_1022414840 -6 Left 1022414837 7:30168974-30168996 CCCATACCTCTAAACTGTGGAAG No data
Right 1022414840 7:30168991-30169013 TGGAAGAACACAGACACAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022414837 Original CRISPR CTTCCACAGTTTAGAGGTAT GGG (reversed) Intergenic
No off target data available for this crispr