ID: 1022414840

View in Genome Browser
Species Human (GRCh38)
Location 7:30168991-30169013
Sequence TGGAAGAACACAGACACAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022414831_1022414840 25 Left 1022414831 7:30168943-30168965 CCCTGGGGTGCTTTTCAAACCCT No data
Right 1022414840 7:30168991-30169013 TGGAAGAACACAGACACAATTGG No data
1022414838_1022414840 -7 Left 1022414838 7:30168975-30168997 CCATACCTCTAAACTGTGGAAGA No data
Right 1022414840 7:30168991-30169013 TGGAAGAACACAGACACAATTGG No data
1022414836_1022414840 -5 Left 1022414836 7:30168973-30168995 CCCCATACCTCTAAACTGTGGAA No data
Right 1022414840 7:30168991-30169013 TGGAAGAACACAGACACAATTGG No data
1022414832_1022414840 24 Left 1022414832 7:30168944-30168966 CCTGGGGTGCTTTTCAAACCCTA No data
Right 1022414840 7:30168991-30169013 TGGAAGAACACAGACACAATTGG No data
1022414834_1022414840 5 Left 1022414834 7:30168963-30168985 CCTAATTTGACCCCATACCTCTA No data
Right 1022414840 7:30168991-30169013 TGGAAGAACACAGACACAATTGG No data
1022414833_1022414840 6 Left 1022414833 7:30168962-30168984 CCCTAATTTGACCCCATACCTCT No data
Right 1022414840 7:30168991-30169013 TGGAAGAACACAGACACAATTGG No data
1022414837_1022414840 -6 Left 1022414837 7:30168974-30168996 CCCATACCTCTAAACTGTGGAAG No data
Right 1022414840 7:30168991-30169013 TGGAAGAACACAGACACAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022414840 Original CRISPR TGGAAGAACACAGACACAAT TGG Intergenic
No off target data available for this crispr