ID: 1022416724

View in Genome Browser
Species Human (GRCh38)
Location 7:30184741-30184763
Sequence TTGTAAATGAATGAGGGTGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022416724_1022416728 21 Left 1022416724 7:30184741-30184763 CCGTCACCCTCATTCATTTACAA No data
Right 1022416728 7:30184785-30184807 ACTACAACAGCAGAACTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022416724 Original CRISPR TTGTAAATGAATGAGGGTGA CGG (reversed) Intergenic
No off target data available for this crispr