ID: 1022426708

View in Genome Browser
Species Human (GRCh38)
Location 7:30276205-30276227
Sequence GCATCTACTGCCCCCCAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022426708_1022426714 28 Left 1022426708 7:30276205-30276227 CCCTCTTGGGGGGCAGTAGATGC No data
Right 1022426714 7:30276256-30276278 ATAGCTTCAGTTGGAGCCTTTGG No data
1022426708_1022426713 19 Left 1022426708 7:30276205-30276227 CCCTCTTGGGGGGCAGTAGATGC No data
Right 1022426713 7:30276247-30276269 CTGCTGCAAATAGCTTCAGTTGG No data
1022426708_1022426710 -10 Left 1022426708 7:30276205-30276227 CCCTCTTGGGGGGCAGTAGATGC No data
Right 1022426710 7:30276218-30276240 CAGTAGATGCATCAGAATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022426708 Original CRISPR GCATCTACTGCCCCCCAAGA GGG (reversed) Intergenic
No off target data available for this crispr