ID: 1022427692

View in Genome Browser
Species Human (GRCh38)
Location 7:30284645-30284667
Sequence GAGGTTCCCCGGCCCCGCGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 105}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022427692_1022427699 8 Left 1022427692 7:30284645-30284667 CCGGCGCGGGGCCGGGGAACCTC 0: 1
1: 0
2: 2
3: 11
4: 105
Right 1022427699 7:30284676-30284698 CTGCGCACCCCCCGCCTTCGCGG 0: 1
1: 0
2: 1
3: 2
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022427692 Original CRISPR GAGGTTCCCCGGCCCCGCGC CGG (reversed) Exonic
900148827 1:1169526-1169548 GAGGTTCCCGGGGCCAGCCCTGG + Intergenic
900290479 1:1921619-1921641 GAGGTTCCCGGGGCCTGCCCTGG + Intergenic
900514969 1:3077333-3077355 CAGGGTCCCCAGCCCCACGCTGG + Intronic
900529531 1:3145921-3145943 GAGGTCCCCCGGCGCCCCCCGGG + Intronic
903455553 1:23484385-23484407 CCGCTTCCCCGGCCCCTCGCCGG + Intronic
906719772 1:47996800-47996822 GAGGGTCCCCCGCGCCCCGCGGG - Exonic
909392894 1:75136313-75136335 TCGGTTCCCCGCCCCCCCGCCGG - Intronic
910384540 1:86666464-86666486 GAGCTCCCCCAGCCCCGCGCAGG - Intergenic
912798736 1:112707556-112707578 GAGGTCCCAGGGCCCGGCGCGGG + Intronic
916166274 1:161969692-161969714 GGGGTGCCCCTGCCCAGCGCTGG - Intergenic
920455725 1:206099693-206099715 CAGGTTCCCAGGCCCAGCCCTGG + Exonic
920674607 1:208030403-208030425 GAGCATCCCCGGCCCAGCGCTGG - Intronic
1063148718 10:3318680-3318702 GAGTTTCCCAGGCCCCGGACGGG + Intergenic
1070590388 10:77796644-77796666 GGGGTTCCCCAGCCCCACTCAGG - Intronic
1073136512 10:101223404-101223426 GAGGTCCCCGGGCCGCGCGCAGG + Intergenic
1076981817 11:208784-208806 GCAGTTCGCCGGCCCCGCCCTGG - Exonic
1080459340 11:32439419-32439441 GATGGTTCCCAGCCCCGCGCTGG + Intergenic
1081812520 11:45922037-45922059 GGGGATCCCCGGCCCTGCCCAGG + Intronic
1081973417 11:47215345-47215367 GAGGCTCCCGAGGCCCGCGCAGG + Intronic
1083342384 11:61967250-61967272 GCGGTTCCCGGGGCGCGCGCTGG - Intronic
1083890360 11:65592756-65592778 GAGGTTCCCAGGGCCAGCGGAGG + Intronic
1083927601 11:65818023-65818045 GAGGCGCCCCGACACCGCGCCGG + Intergenic
1084019477 11:66409224-66409246 GGGACTCCCCGGCCCGGCGCGGG - Intergenic
1084524214 11:69685926-69685948 CCGAGTCCCCGGCCCCGCGCGGG + Intergenic
1084980937 11:72828384-72828406 GAGGTGACCCGGCCCTGCACAGG - Exonic
1085310847 11:75515770-75515792 GAGGTTCCCCTGTCCCTGGCAGG + Intronic
1091037214 11:132245116-132245138 GAGGTTCCCCGGCCCCTGCCAGG + Intronic
1096981153 12:55728796-55728818 GAAGTTCCCTGGGCCCGGGCAGG - Intronic
1098602062 12:72343826-72343848 GAGGTTCCCCAGCCCTGAGAAGG - Intronic
1103359114 12:120343046-120343068 GAGGTCTCCCGCCCCCTCGCTGG + Exonic
1104891574 12:132142708-132142730 CAGGTGCCCCAGCCCCGGGCAGG - Exonic
1104912295 12:132245108-132245130 CAGGCTCCCCTGCCCCGCGGAGG + Intronic
1113082729 13:106535199-106535221 GGGGTTCCGGGGCGCCGCGCCGG + Intergenic
1113082875 13:106535731-106535753 GCGGCTCCGCGGCCGCGCGCTGG + Intergenic
1118351049 14:64972483-64972505 AACGTTCCCCCGCCCCGGGCAGG - Intronic
1122707243 14:103629104-103629126 CAGTTTCCCCAGCCCCGGGCGGG + Intronic
1122974987 14:105167421-105167443 GAGGCGCCCCGGTCCCGGGCAGG - Intronic
1123060494 14:105592196-105592218 GAGGGTCCCCGACCACCCGCAGG + Intergenic
1123084972 14:105713167-105713189 GAGGGTCCCCGACCACCCGCAGG + Intergenic
1131466021 15:92655498-92655520 GGTGTTCCCGGGCCCCGGGCCGG + Exonic
1132273208 15:100544502-100544524 GAGGGTCCTCGTCCCCGCGCAGG - Intronic
1132934924 16:2475304-2475326 GGGGATCCCCGGCCACGCGCGGG + Intronic
1134644925 16:15858260-15858282 GCGGGTCCCCGGCCTGGCGCGGG - Intergenic
1135238103 16:20777544-20777566 GAGGTTCCCCCACCCCTCTCTGG - Exonic
1143183543 17:4998039-4998061 GAGCTGCCCCCGCCCCTCGCCGG - Exonic
1144620934 17:16818121-16818143 GAGGCTGCCCAGCCCCGCTCAGG - Intergenic
1147572910 17:41582414-41582436 GAGGCTGCCCAGCCCCGCTCAGG - Exonic
1148650706 17:49248264-49248286 GAGCTTCCCCGGCCCCTGCCTGG - Intergenic
1148936312 17:51166669-51166691 GAGGGACGCCGGCCCTGCGCGGG + Exonic
1152264840 17:79288212-79288234 GAGCTTCCCTGGCCCCGAGAGGG - Intronic
1152321468 17:79610617-79610639 CAGGGACCCCGACCCCGCGCAGG + Intergenic
1157529844 18:48410636-48410658 GAGTTTCCCCGGCCCGTAGCTGG - Intronic
1159241803 18:65751164-65751186 GCGCCTCCCCAGCCCCGCGCAGG - Intronic
1159656229 18:71031997-71032019 GAGGTTGGCGGGCCCCGCACTGG - Intergenic
1160165553 18:76508015-76508037 GAGGCTCCCCCGCCACGAGCAGG + Intergenic
1160914751 19:1491153-1491175 GCGATGCTCCGGCCCCGCGCCGG - Exonic
1161120840 19:2525371-2525393 GACGCCGCCCGGCCCCGCGCTGG + Intronic
1161236156 19:3199161-3199183 AGGGTTCCCCGGGCCAGCGCTGG + Intronic
1162486094 19:10961273-10961295 GCCGTACCCCGGCCCCGCACAGG - Intronic
1162535871 19:11262529-11262551 GAAGGGCCCCGCCCCCGCGCCGG - Intergenic
1165432077 19:35778563-35778585 GAGCTTCCCCCGCCCCCCGAGGG + Exonic
1165918646 19:39277772-39277794 GAGCTTCCCCAGCCCTGCCCTGG + Intergenic
1168658918 19:58150837-58150859 GAGCTTCCCCCGCCCAACGCTGG + Intronic
1168692882 19:58387346-58387368 TAGGATCCCCGGCCCCGCGGCGG - Exonic
934688096 2:96336012-96336034 AAGGTCCGCCCGCCCCGCGCCGG - Intronic
936278616 2:111120381-111120403 GAGGGTCCCTGGCGCCGGGCGGG - Intronic
936713603 2:115161400-115161422 GCGGTTACCCCGCCCCCCGCAGG - Intronic
944159056 2:196639781-196639803 GAGGCTGCCGGGCCCCGGGCTGG + Intronic
945225713 2:207529845-207529867 GAGCGGCCCCGCCCCCGCGCTGG - Intronic
945885904 2:215375237-215375259 GTGGTCCCTCGGCCCCGCCCTGG - Exonic
947156205 2:227164685-227164707 GAGGGTCCCCGGACTCGCCCAGG + Exonic
1171473509 20:25390428-25390450 GAGGTACCGCGGCCCCCTGCGGG + Intronic
1172100633 20:32482772-32482794 GGGGTTCCCCGGCGCGGCGCGGG - Intronic
1173329405 20:42062021-42062043 GAGGTGCCCTGGCCCAGCGCAGG + Intergenic
1173792054 20:45834137-45834159 GGGGTACCCCAGCCCGGCGCAGG - Intronic
1174648459 20:52105060-52105082 GAGGTTCTCCGGACCCGCGCGGG - Intronic
1174898682 20:54476093-54476115 GAGAGTCCCCGGCCGCGCGCCGG + Intronic
1175859577 20:62143171-62143193 CCGCGTCCCCGGCCCCGCGCAGG + Intronic
1176024458 20:62978677-62978699 GAGGTCCCCCCGCCCAGCCCAGG + Intergenic
1176286255 21:5020920-5020942 GAGGTTCCTCGCCCCGGGGCGGG - Intergenic
1179712392 21:43270862-43270884 GAGTTTCCCAGGCACCGCGGCGG - Intergenic
1179870926 21:44242555-44242577 GAGGTTCCTCGCCCCGGGGCGGG + Intergenic
1180091366 21:45535225-45535247 GAGGTTGCCTGGGCCCCCGCTGG - Intronic
1181085488 22:20437702-20437724 CCGGCTCCCCGGCGCCGCGCCGG + Exonic
953861622 3:46549014-46549036 GAGGTTCCCAAGCCCTGGGCTGG - Intronic
968199559 3:196740264-196740286 GCGGCTCCCCGGCCCCGCGCGGG - Intronic
969320354 4:6408671-6408693 CAGATTCCCAGGCCCCGCCCAGG - Intronic
973613587 4:52658972-52658994 GAAGTTCCCGGCCCCCGAGCTGG - Intronic
979547273 4:121951969-121951991 GAGGCTCTCCAGCCCCGCGGCGG + Intergenic
981074700 4:140579364-140579386 GGGGCTCCCCGGACCTGCGCTGG + Intergenic
984701164 4:182819610-182819632 GAGGCTCCCCGGCCTCCCGCAGG + Intergenic
999300202 5:150486154-150486176 GAGCTGCCCCGGCGCAGCGCCGG + Intronic
1000637446 5:163660170-163660192 GAGGTTCCCCGGGCCAGCAATGG + Intergenic
1005522632 6:26613910-26613932 GAGGTCCCGCGGCGCTGCGCAGG - Intergenic
1006337470 6:33428065-33428087 GAGGGGCCCCGCCCCTGCGCGGG - Intronic
1007406376 6:41638335-41638357 GCGGGTCCCCTCCCCCGCGCCGG - Intronic
1007557792 6:42781921-42781943 GCGGCGCCCCGGCCCGGCGCGGG + Intronic
1007589814 6:43014313-43014335 GAGGACCCGCGGCCCCGCCCCGG + Exonic
1007595409 6:43048128-43048150 GAGGTACCCCTGCCCTGCTCTGG - Exonic
1008886220 6:56433346-56433368 GAGCTTCCTGGGCCCGGCGCGGG + Intergenic
1013272949 6:108559950-108559972 GCCGTGCCCCGGGCCCGCGCGGG + Intronic
1013582731 6:111552090-111552112 GAGCCTCCCCGGCACCGAGCAGG - Intergenic
1016010605 6:139134951-139134973 GAGGTGGGCAGGCCCCGCGCGGG + Intergenic
1016928331 6:149376881-149376903 GAGGTTCCCCCCCCCCACTCTGG + Intronic
1018876504 6:167826803-167826825 GAGGTGCGGCGGCGCCGCGCGGG + Intergenic
1019538884 7:1542589-1542611 GTGCTTCCCCGGCCCAGCTCTGG - Exonic
1019706771 7:2500508-2500530 AAGGGTCCCCGGCCCTGCCCTGG + Intergenic
1020094613 7:5361523-5361545 GAGGAGCCCGGGCCCCACGCAGG - Intronic
1020256376 7:6504773-6504795 GGGGTTCCCCGGACCCTCACAGG + Exonic
1022427692 7:30284645-30284667 GAGGTTCCCCGGCCCCGCGCCGG - Exonic
1024281077 7:47720485-47720507 CAGCTTCCCCAGCCCTGCGCTGG - Intronic
1024308867 7:47950823-47950845 GAGGCTGCCCAGCCCAGCGCTGG - Intronic
1025023596 7:55498357-55498379 GAGGTTTCCGGGCCCCTGGCAGG + Intronic
1035018648 7:155787680-155787702 GAGGCTCTCCTGCCCCGCGGAGG + Intergenic
1044692860 8:94896146-94896168 GCCGTTCCCGGGCCCCGCTCCGG - Intronic
1049436434 8:142588264-142588286 GAGGTGCCCAGGCCCTGCTCAGG + Intergenic
1056488893 9:87085842-87085864 GAGGTTCACCCGCCTCGCCCTGG + Intergenic
1060205470 9:121680338-121680360 CAGGTTCCCAGGCCCTGCCCTGG - Intronic
1190308658 X:49101468-49101490 GAGCATGCCGGGCCCCGCGCGGG + Intergenic