ID: 1022429970

View in Genome Browser
Species Human (GRCh38)
Location 7:30308499-30308521
Sequence CCAGAGATTCTGATTGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 252}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022429970_1022429979 -9 Left 1022429970 7:30308499-30308521 CCACCCTCAATCAGAATCTCTGG 0: 1
1: 0
2: 3
3: 41
4: 252
Right 1022429979 7:30308513-30308535 AATCTCTGGGGATGGGGTCTAGG No data
1022429970_1022429981 29 Left 1022429970 7:30308499-30308521 CCACCCTCAATCAGAATCTCTGG 0: 1
1: 0
2: 3
3: 41
4: 252
Right 1022429981 7:30308551-30308573 CTCCACATGAATGACTCTTAAGG 0: 1
1: 0
2: 1
3: 10
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022429970 Original CRISPR CCAGAGATTCTGATTGAGGG TGG (reversed) Intronic
900174249 1:1284857-1284879 CCAGGGCTTCTGAGTGAGGCAGG - Intronic
900231989 1:1563914-1563936 CCAGAGATGCTGGTCAAGGGCGG + Intronic
900799095 1:4726676-4726698 CCAGAAATCCTGATTCAGGCAGG + Intronic
901934724 1:12619337-12619359 CCAGAGATTCTGATTCAGCAGGG + Intergenic
902262416 1:15236651-15236673 ACAGAGATTCTGTCTGAGGTTGG + Intergenic
902790791 1:18766452-18766474 CCAGAGGTTCTGATTTAACGGGG - Intergenic
904120746 1:28196159-28196181 CTGAAGATTCTGATTCAGGGTGG - Intergenic
905849342 1:41261829-41261851 CCAGAGATTCCGATTCAGTGGGG + Intergenic
907972386 1:59396084-59396106 CAAGAGTTTCTGATTGAGTAGGG - Intronic
908074609 1:60502233-60502255 CTAGAGATTGGGATTGAGGGAGG + Intergenic
910053609 1:83005747-83005769 CTGGAGATGCTGATTGAGGTTGG + Intergenic
910963414 1:92784966-92784988 CCTGAGCTTCTGAGTGAGCGTGG - Intronic
913386947 1:118268515-118268537 CCAGACATTCAGATTGAGCAAGG + Intergenic
917451581 1:175151764-175151786 CCAGAAATTGTGATTGAGGAAGG + Intergenic
917640988 1:176982968-176982990 CCACAGATGATGATTGAGGGGGG + Intronic
920431110 1:205919788-205919810 ACAGAGTTTCTGATTGGGAGAGG + Intronic
921963995 1:221068229-221068251 GCAGAGATACTTTTTGAGGGAGG + Intergenic
921997673 1:221439215-221439237 CCAGGGATTATGGTGGAGGGAGG + Intergenic
922068815 1:222170593-222170615 ACAGAGATTCTGATGCAGAGAGG + Intergenic
922167442 1:223127957-223127979 CCAGAGCTTCTGATTCAGCGGGG - Intronic
922190608 1:223315497-223315519 CCAGGGAGTCTGCTTGTGGGTGG - Intronic
922301785 1:224308087-224308109 CCAAAGATTCTGAAGGAGGATGG - Exonic
924442484 1:244097811-244097833 CCTGAGATCCTGTTTGAGGTGGG + Intergenic
1062779515 10:188868-188890 CTAGAGTGTGTGATTGAGGGAGG + Intronic
1063550831 10:7031151-7031173 CCAGAGAATCTGATGGATGCAGG + Intergenic
1066434431 10:35384073-35384095 CCATAAATTCTGATTAAAGGAGG + Intronic
1071253864 10:83849273-83849295 CCAAACATTTTGATTGAGTGGGG - Intergenic
1071264553 10:83953395-83953417 GCAGAGATTCTGATTTAGGAGGG - Intergenic
1072040057 10:91598376-91598398 CCAGAGATTGTGATTCAGTGTGG - Intergenic
1072296641 10:94014829-94014851 CAAGAGATTTTGATTCAGGAAGG - Intronic
1074340775 10:112627170-112627192 CCAGAGATTCTGAATAGGGTTGG - Intronic
1075397421 10:122137728-122137750 TCCCAGAGTCTGATTGAGGGGGG + Intronic
1075429433 10:122368239-122368261 CCAGAGATTCAGATTGGGCTGGG + Intergenic
1077549938 11:3195718-3195740 CCCGGGACTCTGATTGAGCGGGG + Intergenic
1078468490 11:11568490-11568512 CCAGTGACTCTGGTTAAGGGGGG + Intronic
1079527121 11:21404011-21404033 CCAGTGGTTTTGATTGCGGGGGG - Intronic
1079867124 11:25750334-25750356 CCAGAGGTTCTGGGGGAGGGAGG - Intergenic
1080824777 11:35838569-35838591 CCAGAGCTTATGTTTGAGAGTGG - Intergenic
1081114427 11:39181843-39181865 CAATAGCTTCTGTTTGAGGGAGG + Intergenic
1083205334 11:61145424-61145446 CCTGAGATGCTGTATGAGGGCGG - Intronic
1085799200 11:79572482-79572504 CCAGAGTTTCTGATTCAGTAGGG + Intergenic
1086521488 11:87673190-87673212 TCAGAGGTTGTGATGGAGGGAGG - Intergenic
1086867805 11:92001406-92001428 GCAGAGATTCTGATTAAAGAAGG - Intergenic
1090997062 11:131876379-131876401 CCAGAGAGTCTGAATGTGGTGGG - Intronic
1091822665 12:3487915-3487937 CCAGAGAGTATGATTTAGTGAGG - Intronic
1092674517 12:10901027-10901049 GCAGAGATTTTGATGCAGGGAGG + Intronic
1097750639 12:63348741-63348763 CAAGAAATTCACATTGAGGGCGG - Intergenic
1099990550 12:89716465-89716487 CCAGAGCTTCTGATGGAGTCTGG + Intergenic
1101587403 12:106096934-106096956 TCAGTGATTCTGAATGATGGAGG - Intronic
1101750565 12:107579895-107579917 CCTGGGATTCTGATTTAGGTGGG - Intronic
1101777256 12:107806218-107806240 GCAGGGATTCAGATTGGGGGTGG - Intergenic
1102421337 12:112805355-112805377 CCAGAAATTCTGATTCAGAAGGG + Intronic
1102965639 12:117123380-117123402 CCGGAGCTTCTGATTCAGTGGGG + Intergenic
1103019098 12:117519416-117519438 GCAGAGGTTCTGATTCAGCGGGG + Intronic
1104275207 12:127320718-127320740 CCAGAGAGGCTGTTTCAGGGTGG - Intergenic
1106404896 13:29464847-29464869 CCAGAGTTTCTGATTCAGCAGGG - Intronic
1108204982 13:48079385-48079407 CTAAAGATTCTCCTTGAGGGAGG - Intronic
1110171845 13:72510611-72510633 CCGGAGCTTCAGATTGAGGTGGG - Intergenic
1111927698 13:94480694-94480716 TCAGAGATTCTGATTCAGTAGGG - Intergenic
1112192624 13:97192701-97192723 GTAGAGATTCTGACTTAGGGTGG + Intergenic
1113275732 13:108727467-108727489 GCAGAAATTCTGATTGACAGAGG + Exonic
1113840072 13:113354191-113354213 CCAGAAACGCTGATTCAGGGTGG - Intronic
1115097183 14:29650553-29650575 CCAGAGAGACTGAATGGGGGGGG + Intronic
1115565990 14:34625838-34625860 TAAGAGATTCTGATTTAGTGAGG + Intronic
1116190131 14:41654234-41654256 GGAGATATTCTGAGTGAGGGTGG + Intronic
1117345363 14:54826831-54826853 CCCCAAATTCTGATTGTGGGTGG + Intergenic
1117772889 14:59152247-59152269 AGAGAGATTCTGATTCAGTGGGG - Intergenic
1117987840 14:61406023-61406045 CCAGAGATTCTCATTCAGACTGG - Intronic
1118870503 14:69737253-69737275 CCAGACATGCTGAGTGAGGGAGG - Intronic
1120097559 14:80405108-80405130 CCAAAGATTCTGAATGAGATGGG - Intergenic
1121702191 14:95962872-95962894 CCAGAGATGCTCCTTGAGGCTGG - Intergenic
1122712105 14:103666421-103666443 CCAGAGTTTCTGATTCAGCAGGG + Intronic
1122731397 14:103801418-103801440 CCATTGATGCTGATGGAGGGAGG - Intronic
1124070153 15:26384102-26384124 CCAGAGATGCTGATTGAGAATGG + Intergenic
1124686847 15:31790249-31790271 CCAGAGACTCTGATTCAGTGGGG + Intronic
1127717596 15:61664737-61664759 CCTGAGATTCTGATTCAGTGGGG + Intergenic
1127914580 15:63444914-63444936 CCAGAGATTCTGACTGAATTAGG + Intergenic
1128128905 15:65212416-65212438 CCAGAGTTTCTGATTCAGTGGGG + Intergenic
1129186701 15:73911672-73911694 AGAGAGAACCTGATTGAGGGAGG - Intergenic
1130050899 15:80482807-80482829 CCAGAGCTTCTGATTCAGTGGGG - Intronic
1131072613 15:89475604-89475626 CCAGAGGTTCTGATTCAGTAGGG - Intronic
1131482366 15:92793045-92793067 CCAGAGATTCTGATTCAGTAGGG - Intronic
1131843962 15:96469164-96469186 CCTGAGATTCAGAAAGAGGGTGG + Intergenic
1132085886 15:98907955-98907977 CCAGAGCTTCTGATTCAGCTGGG - Intronic
1132697049 16:1206689-1206711 CCAGAGAGGCTGAATGAGGCAGG + Intronic
1133230139 16:4362480-4362502 CCAGTGAGTCTGGGTGAGGGGGG + Intronic
1133562566 16:6963637-6963659 CCAGAGATTATGTGGGAGGGAGG + Intronic
1133576646 16:7097762-7097784 CCAGAGATTCTGATGAAAAGAGG + Intronic
1135623708 16:23977402-23977424 CCAGAGATTCTGATTTAATGGGG - Intronic
1136027140 16:27475794-27475816 CAAGATATTCTGGTTGTGGGAGG - Intronic
1139248506 16:65472079-65472101 CCAGAGTTTCTGATTCAGTGGGG - Intergenic
1140945664 16:79765963-79765985 CCAGAAATTCTGATAGGGGCTGG + Intergenic
1141994311 16:87627083-87627105 CCAGAGACACTGATTCAGCGGGG - Intronic
1143833820 17:9674036-9674058 CCAGAGATTCTGTTTCAAGGTGG - Intronic
1144151986 17:12457155-12457177 GCAGAGATCATGATTGAGGCTGG - Intergenic
1144742091 17:17589695-17589717 CCGGAGATTTTGATTGAGGAGGG + Intronic
1145870006 17:28266248-28266270 CCAGAAATGCTGAGTCAGGGTGG - Intergenic
1145915513 17:28571544-28571566 GCAGAGATTCCGATTGGGTGAGG - Exonic
1146211438 17:30946630-30946652 ACAGAGATGCTGAGTGGGGGTGG + Intronic
1146427732 17:32758765-32758787 ATAGAGATTCTAATTGTGGGGGG + Intronic
1147163836 17:38582865-38582887 CCTGGGCTTCTGGTTGAGGGTGG + Intronic
1147502504 17:40979012-40979034 CCAGAGATTCTGTCTGCGGGAGG + Exonic
1148679167 17:49463599-49463621 CCAGAGCTTCAGAGTGAGTGTGG - Intronic
1149825033 17:59820483-59820505 CCAGTGATTCTCAATGAGGGTGG - Intronic
1150229420 17:63541960-63541982 AGGGAGATTCTGATGGAGGGTGG + Intronic
1150427977 17:65092347-65092369 CCAGAGATGCTGATTCACAGTGG + Intergenic
1155977624 18:32148066-32148088 CCAGAGATTTTGATTTAGTTTGG + Intronic
1157265965 18:46222110-46222132 CCAAAGATTCTGATTGAATGGGG - Intronic
1157277670 18:46323316-46323338 CCTGAGATTCTGACCCAGGGAGG - Intergenic
1158301874 18:56061573-56061595 CCAGAGCTTCTGATTCAGTAGGG - Intergenic
1158654093 18:59313139-59313161 CCAGAGATTCTGATGCAGCAGGG - Intronic
1159140212 18:64385280-64385302 CCAGAGACTCTGATTGAATTGGG - Intergenic
1161021271 19:2012865-2012887 CCAGGCTTTCTGTTTGAGGGGGG - Intronic
1162033569 19:7927499-7927521 CCAGAGTTTGGGGTTGAGGGAGG - Intronic
1164410455 19:28000343-28000365 CCAGTGCTTCTGGTTGAGGGTGG + Intergenic
1164515431 19:28931367-28931389 CCAGTGCTTCTGGTTGAGGTTGG + Intergenic
1165963267 19:39553051-39553073 TCAGAGATTCTGAGTGGGGAGGG + Intergenic
1167677667 19:50897568-50897590 CCAGAGATTCTGTGGGAGGGTGG - Intergenic
1168259678 19:55186351-55186373 CCAGAGACCCTGGTTGAGGAAGG + Exonic
925656698 2:6157085-6157107 CCAGACATTCTGATTGAATTGGG + Intergenic
925818200 2:7773903-7773925 CCAGAGTTTCTGATTCAGTAGGG - Intergenic
926358938 2:12067153-12067175 CCACAAATTCTGTTTGGGGGTGG + Intergenic
926395503 2:12438300-12438322 CTGGAGATTCTGATTCAGGAGGG + Intergenic
927188585 2:20500161-20500183 GCAGAGGTTTTGATTGAGGGTGG + Intergenic
927465177 2:23331517-23331539 TCTGAGATGCTGTTTGAGGGGGG - Intergenic
928900848 2:36315997-36316019 CCAGAGATTCTGTTCCAAGGTGG - Intergenic
931630183 2:64291399-64291421 CCAGAGCTTCTGACTCATGGGGG + Intergenic
932083465 2:68736792-68736814 CCAGAGATTCTGATTTTGTAAGG - Intronic
932699155 2:73981658-73981680 CCAGGGTTTCTGATTCAGTGGGG + Intergenic
934140548 2:89042968-89042990 ACAGGGATCCTCATTGAGGGTGG + Intergenic
934228687 2:90157568-90157590 ACAGGGATCCTCATTGAGGGTGG - Intergenic
935072360 2:99706026-99706048 CCAGGGATTCTGCTTAAGTGTGG - Intronic
936764706 2:115832762-115832784 CCACAGATTGTGATTGAATGTGG + Intronic
936850477 2:116891563-116891585 CCAGTGATTCTTATTGTGGAAGG - Intergenic
939040035 2:137177561-137177583 CCAGAGTTTCTGATTCAGTAGGG + Intronic
939815571 2:146892552-146892574 CATGAGATTCTGAATGAGAGAGG + Intergenic
939973691 2:148691389-148691411 CCAGAGATTCTCATACAGGTAGG - Intronic
941691969 2:168509521-168509543 CCAGAGCTACTGAATGATGGAGG - Intronic
941754116 2:169166399-169166421 CCATAGATTCTGAGTCAGAGAGG + Intronic
941928682 2:170920011-170920033 CCAGAGATTCTCTTTGACAGGGG + Intergenic
942252562 2:174059894-174059916 CTGGAGATTCTAATTCAGGGAGG - Intergenic
942846150 2:180428531-180428553 GCAGAAATTCTGTATGAGGGAGG + Intergenic
943589493 2:189780412-189780434 CCAGAGGATCAGATTGTGGGTGG + Intronic
943734884 2:191343161-191343183 CTAGAGATTCTAATCAAGGGTGG - Intronic
944381907 2:199120310-199120332 CCAGAAATTCTTATTGAATGAGG - Intergenic
944493353 2:200281613-200281635 CCAAAGATTCTGATTTAGGAAGG + Intergenic
945350073 2:208767011-208767033 TCAGAGATCCTGATTCAGTGGGG - Intronic
946997949 2:225417378-225417400 GCAGAGATTCATTTTGAGGGGGG - Intronic
947624097 2:231608681-231608703 ACAGAGAATCTGATTGTGGCTGG + Intergenic
948951532 2:241255438-241255460 TCAGAGATGCTGTCTGAGGGTGG + Exonic
1168984802 20:2038972-2038994 CCAGAGATTCTAATTCAGTGGGG - Intergenic
1170045722 20:12083325-12083347 CCAGAGTTTCTGATTTAGTAGGG + Intergenic
1170208709 20:13826683-13826705 CCAGAGATTCTGATTAAATTTGG + Intergenic
1170464048 20:16606807-16606829 TCAGAGATCCAGACTGAGGGAGG + Intergenic
1174251694 20:49224657-49224679 CAAGAAATACTTATTGAGGGCGG - Intronic
1174566558 20:51468922-51468944 CCAGTGATTCTGATGTGGGGCGG - Intronic
1175188046 20:57192903-57192925 CAAGAGATTCTCCTTAAGGGTGG + Intronic
1175655946 20:60771050-60771072 CTGGAGATTCTGTTTGAGTGAGG - Intergenic
1175966287 20:62661670-62661692 TCAGAGACTCTGAGGGAGGGAGG - Intronic
1176385325 21:6136133-6136155 CCAGAGATGCTGCCTGAGAGCGG + Intergenic
1177001378 21:15617822-15617844 CAAGAGATTCTGATTTATTGAGG + Intergenic
1179167775 21:38948006-38948028 GCAGTGAGTCTCATTGAGGGAGG - Intergenic
1179396732 21:41047014-41047036 CCAGAGCTTCTCATTCAGCGGGG - Intergenic
1179454712 21:41491105-41491127 CCAGAGATTCTGTTTCAGTTGGG + Intronic
1179738148 21:43402119-43402141 CCAGAGATGCTGCCTGAGAGCGG - Intergenic
1181792795 22:25281411-25281433 GCAGGGAATCAGATTGAGGGGGG + Intergenic
1181813369 22:25419294-25419316 GCAGGGAATCAGATTGAGGGGGG + Intergenic
1181831358 22:25563459-25563481 GCAGGGAATCAGATTGAGGGGGG + Intergenic
1181970421 22:26685652-26685674 ACTGAGATTCTGATTCAGAGGGG - Intergenic
1182711964 22:32328810-32328832 CTAGAGATTCTGGGAGAGGGAGG + Intergenic
1183348812 22:37323092-37323114 CCAGAGTTTCTGATCCACGGGGG + Intergenic
1184399513 22:44265694-44265716 CTAGAGATTCTGGGAGAGGGAGG + Intronic
949317882 3:2776884-2776906 GCAGAGACTCTGTGTGAGGGTGG + Intronic
949396057 3:3615793-3615815 CCTGGGATTCTGAGTGGGGGTGG + Intergenic
951284381 3:20791099-20791121 GCAGAGATTCTGATGCAAGGGGG + Intergenic
951627489 3:24681857-24681879 CCAGAATTTCTGATTCAGTGGGG + Intergenic
952216797 3:31285949-31285971 TCAGAGGTTCTGATTCAGTGTGG + Intergenic
953685140 3:45071747-45071769 CCAGAGATTCTGACTCTGTGTGG + Intergenic
954049050 3:47957841-47957863 CTGTATATTCTGATTGAGGGAGG - Intronic
955746847 3:62148858-62148880 CCAGGGATCCAGAATGAGGGTGG + Intronic
956364344 3:68483685-68483707 CCACAGAATCTGTTTCAGGGAGG - Intronic
956583785 3:70842598-70842620 CCAGAGTTTCTGATTCAGCTGGG + Intergenic
957615674 3:82523663-82523685 CCTGATATTCTCATTGAGAGAGG + Intergenic
958736305 3:98013229-98013251 TCAGAGATTCTGATTCAGTATGG + Intronic
959656300 3:108808621-108808643 TTAGAGATTCAGATTCAGGGAGG - Intergenic
960107774 3:113816658-113816680 CCAGAGATTCCAATTCAGGTTGG - Intergenic
960702667 3:120452107-120452129 CCAGAATTTCTGAGTGAGGGAGG - Intergenic
961085332 3:124062522-124062544 CCAGAGACTCCGATTCAGGAAGG - Intergenic
961496685 3:127298022-127298044 CCAGAGATTCTGATGAAGTGTGG + Intergenic
961692208 3:128678232-128678254 CCAGAAATTCAGGTTGAGGTTGG - Intronic
961883229 3:130077848-130077870 CCAGAGATAATGACTGGGGGAGG - Intergenic
961906506 3:130268584-130268606 CCAGAGATTCTGACTGATTTGGG - Intergenic
962974499 3:140434201-140434223 CCAGAGATCCTGGTGGAGGGAGG + Intronic
963712605 3:148764477-148764499 GCAGACATTCTGACTGAGAGAGG + Intergenic
963844533 3:150141672-150141694 CCAGAATTTCTGATTCAGAGGGG + Intergenic
965426790 3:168535028-168535050 CTATAGATTCTGACTGCGGGTGG - Intergenic
966432121 3:179843310-179843332 CCAGAGATTGTGATTTAGTTGGG - Intronic
966779972 3:183575733-183575755 CCAGAGTTTCTGATTCAGTGGGG - Intergenic
967001453 3:185339477-185339499 CCAGAGTTTCTGATTCAGTTAGG - Intronic
967221375 3:187250687-187250709 CCAGAGTTTCTGATTCAGTGAGG + Intronic
967893770 3:194381761-194381783 GCAGAGATTCAGAAGGAGGGCGG + Intergenic
968149489 3:196325801-196325823 CCAGAGTTTCTGATTCAGGATGG - Intronic
969068730 4:4513222-4513244 GTGGAGATTCTGATAGAGGGGGG + Intronic
971823316 4:31587836-31587858 TCTGAGATTCTGATTCATGGTGG + Intergenic
972647263 4:40980967-40980989 AGAGAGATTCTGATTCAGCGGGG - Intronic
972679794 4:41294321-41294343 CCAGAGATGCTAATTCTGGGTGG + Intergenic
972762325 4:42119038-42119060 CCAGACATTCTGATTCAGAAGGG - Intronic
973992414 4:56422906-56422928 CCAGAGTTTCTGATTCTGGATGG - Intronic
974456564 4:62136002-62136024 ACAGAGAATGTGGTTGAGGGAGG + Intergenic
975727321 4:77304693-77304715 CCAGTGATTCTGAGTGATGAAGG + Intronic
976064587 4:81170553-81170575 CCAGAGACTCTGATTCAGGTTGG + Intronic
976531597 4:86160479-86160501 CCAGTGATTCTCATTAAAGGTGG + Intronic
981253296 4:142629426-142629448 GCAGAGATTCTGATTTAGGAAGG + Intronic
981675807 4:147341685-147341707 CCAGAGCTTCTGATGAATGGTGG + Intergenic
982208304 4:153014206-153014228 CCAAAGTTTCTGAGTTAGGGTGG - Intergenic
984935498 4:184886271-184886293 CCAGAGATTCTGACTGAGTGTGG - Intergenic
986207701 5:5640975-5640997 CCAGAGATTCTGAATCAGGGAGG - Intergenic
987385557 5:17325943-17325965 CCAGAGACTCCTACTGAGGGGGG - Intergenic
987803557 5:22731142-22731164 CCAAAGATTCTGATTAATTGTGG - Intronic
987855143 5:23411374-23411396 CCTGAGCTTCTGATCCAGGGAGG + Intergenic
989092849 5:37752165-37752187 CCAGAGTTTCAGGTGGAGGGTGG + Intronic
989404678 5:41046955-41046977 CCAGAGATTCTGAATCTGGAAGG + Intronic
990944249 5:61233337-61233359 CCAGAAATTCTGATTTGGCGGGG - Intergenic
991945342 5:71893939-71893961 CCAGAGATTCTGATTTACCAGGG + Intergenic
993436489 5:87901894-87901916 CCAGACATTCTGACTGGGGCAGG + Intergenic
993637711 5:90365467-90365489 CCAGATATTCTGATTTAGACTGG + Intergenic
994039386 5:95241030-95241052 CCAGAGATTCTAATTTTGGGGGG + Intronic
995530452 5:113086886-113086908 CCAGGGATTCTGATTTAGCAGGG + Intronic
995604699 5:113840046-113840068 CCCGAGATTCTGATTAAGTCTGG + Intergenic
995966569 5:117914756-117914778 CTATAGATTCTCATTGATGGTGG + Intergenic
998429419 5:142057919-142057941 CCAGGGATTCTGATTCAGTATGG + Intergenic
998528112 5:142860944-142860966 CTAGAGATTTTGATTGAGGGTGG + Intronic
1000134087 5:158327887-158327909 TCAGAGATTTGGAGTGAGGGAGG - Intergenic
1001037552 5:168308636-168308658 CCAGAGATTCTGACTGGGGTAGG - Intronic
1001118818 5:168962099-168962121 CCAGAGATGCTGGTGGAGGCAGG - Intronic
1001769754 5:174284817-174284839 TCAGTGATTCTTACTGAGGGAGG - Intergenic
1003497036 6:6673262-6673284 CCACAGATGCTGAGTGAGGTCGG - Intergenic
1003976157 6:11346595-11346617 CCATAGTTTCTGTTTGAGGCTGG + Intronic
1004797522 6:19104003-19104025 CTAGAGATTCTGGAGGAGGGGGG - Intergenic
1005346462 6:24895391-24895413 CCAGAGATTCTGACTTAGTCTGG + Intronic
1006507998 6:34502926-34502948 ACAGAGATTCTGATTCAGCAGGG - Intronic
1008262625 6:49385765-49385787 ACTGAGATTCTCATTGAGAGTGG - Intergenic
1010351257 6:74877442-74877464 TCAGAGATTCAGGTTGATGGAGG - Intergenic
1010719687 6:79268928-79268950 TCAGAAATTCTGATGGAGGGGGG + Intergenic
1011329627 6:86189111-86189133 CCAGAGATTCTGATTAAACTGGG + Intergenic
1013400807 6:109794534-109794556 CCACAGATACTGATGGAGGGAGG - Intronic
1013417290 6:109936407-109936429 TCAGAGATTCTGATTCAGTAGGG + Intergenic
1014143323 6:117968753-117968775 CCTGAGATTCTGATTCAGTATGG + Intronic
1016896470 6:149059098-149059120 CCAGAGCTGCTGACTTAGGGGGG + Intronic
1017165268 6:151401875-151401897 CCAGACGTTCTGATTTAGTGTGG + Intergenic
1018790726 6:167145642-167145664 CCAGAGGGTCTCAGTGAGGGTGG + Intergenic
1021111589 7:16700556-16700578 CCAGAGATTCTGATTCAGTAGGG + Intronic
1021434718 7:20601083-20601105 CCAAAGATTCTGATTCAGTAGGG + Intergenic
1021591757 7:22271206-22271228 CCCGAGATTCTGATTTAGTTGGG - Intronic
1022286975 7:28962563-28962585 CCAGAGATTCTGATTTAATAAGG - Intergenic
1022429970 7:30308499-30308521 CCAGAGATTCTGATTGAGGGTGG - Intronic
1024305798 7:47928662-47928684 CTAGAGATGATGATTGGGGGTGG - Intronic
1024990505 7:55231628-55231650 CCAGACAGTCTGCATGAGGGAGG - Intronic
1025604586 7:63030285-63030307 CCAGGCATTCCGATTGGGGGAGG - Intergenic
1031077559 7:117227409-117227431 CCAGAGATTCTGACAGGTGGTGG - Intronic
1031732538 7:125316364-125316386 AGAGAGAATCTGCTTGAGGGAGG + Intergenic
1034166196 7:149026995-149027017 CCAGTGATTCTGTTTTTGGGGGG - Intronic
1035763172 8:2084988-2085010 CCAGAGATTCTGTTGGAAGAGGG - Intronic
1036780384 8:11642842-11642864 CCAGGCATTCCGATTGGGGGAGG + Intergenic
1037323175 8:17663143-17663165 CCAGAGATTATGTTTGACTGTGG - Intronic
1038460473 8:27712126-27712148 CCAGGGATTAGGATGGAGGGAGG - Intergenic
1038586809 8:28797106-28797128 CCAGAGTTTCAGATTCAGGTTGG + Intronic
1039615511 8:38952081-38952103 CCAGAGATTCAGGCAGAGGGAGG + Intronic
1039842189 8:41302088-41302110 CTATAGATACAGATTGAGGGTGG - Intronic
1041445648 8:57948562-57948584 GCAGAGATCCTGGTGGAGGGGGG - Intergenic
1044537738 8:93376460-93376482 CTAGAGATTCTGATTCAGTAAGG + Intergenic
1044824032 8:96179465-96179487 CCAGAGCTTCTGTTTGAAAGTGG - Intergenic
1045183428 8:99811476-99811498 CCAGAGTTTCAGATTGGGTGTGG + Intronic
1046154293 8:110267007-110267029 CCAGAGTTTCTGATTTAGAAAGG - Intergenic
1046804525 8:118465145-118465167 CCAGAGATTCTGATTTAATTTGG - Intronic
1048962777 8:139594235-139594257 CCAGATAATCTGTTGGAGGGGGG + Intergenic
1055550103 9:77425413-77425435 CTAGAGCTTCTGTTTGAAGGTGG + Intronic
1056004421 9:82252728-82252750 CCAGAGGTTCAGAGTGAAGGAGG - Intergenic
1056495328 9:87149679-87149701 ACAAAGATTGTTATTGAGGGAGG + Intronic
1058613407 9:106799945-106799967 CCACAGATTCAGGTTGAGGCTGG - Intergenic
1058907298 9:109492214-109492236 CCAGAGGTTCTCGGTGAGGGAGG - Intronic
1059175472 9:112166407-112166429 CCAAAGATTCTGATTCAGTAGGG + Intronic
1059804024 9:117779137-117779159 CCAGAGATTCTAAAGGTGGGGGG + Intergenic
1060549270 9:124477457-124477479 CCAGTGATTCTGATTCAGAGAGG + Intronic
1061149478 9:128820743-128820765 CCAGGCATTCTGGTTGAGGTGGG - Exonic
1062324174 9:136004507-136004529 CCAGACATTCTGTTTGGTGGTGG - Intergenic
1189466865 X:41284154-41284176 CCAGAGTTTCTGAATAAGGCTGG + Intergenic
1189506391 X:41615304-41615326 CCAGATTTTTTGATGGAGGGGGG - Intronic
1189987374 X:46565843-46565865 CCATAGATTGGGATTGAGAGAGG - Intergenic
1190571764 X:51789797-51789819 CCAGAGATTCTGATTTGGCCTGG - Intergenic
1191778736 X:64845317-64845339 GGAGAGACTCTGGTTGAGGGAGG - Intergenic
1192779709 X:74281820-74281842 GCATAGTTTCTGATTGAGTGTGG + Intergenic
1193133166 X:77939992-77940014 TAAGAGATTTTGATGGAGGGAGG + Intronic
1197613460 X:128665033-128665055 CCAGAGATTTTGATTATGGAAGG - Intergenic
1197893670 X:131289008-131289030 CCAGAGATTCTCACCGAGGCAGG + Intronic
1199731290 X:150634997-150635019 CTAGAGATTCTGATTCAGTAGGG + Intronic
1199846838 X:151697723-151697745 CCAGAGCTTCTGCTTGGGGAGGG + Intronic