ID: 1022430553

View in Genome Browser
Species Human (GRCh38)
Location 7:30315535-30315557
Sequence AGAATGCAAATGCACTCTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 210}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022430553_1022430556 3 Left 1022430553 7:30315535-30315557 CCCTTAGAGTGCATTTGCATTCT 0: 1
1: 0
2: 3
3: 16
4: 210
Right 1022430556 7:30315561-30315583 AAAGTTGAGTCTACCTGGCTTGG 0: 1
1: 0
2: 1
3: 15
4: 137
1022430553_1022430559 24 Left 1022430553 7:30315535-30315557 CCCTTAGAGTGCATTTGCATTCT 0: 1
1: 0
2: 3
3: 16
4: 210
Right 1022430559 7:30315582-30315604 GGGAGTAATTACAGTGAACATGG 0: 1
1: 0
2: 0
3: 14
4: 157
1022430553_1022430557 4 Left 1022430553 7:30315535-30315557 CCCTTAGAGTGCATTTGCATTCT 0: 1
1: 0
2: 3
3: 16
4: 210
Right 1022430557 7:30315562-30315584 AAGTTGAGTCTACCTGGCTTGGG No data
1022430553_1022430555 -2 Left 1022430553 7:30315535-30315557 CCCTTAGAGTGCATTTGCATTCT 0: 1
1: 0
2: 3
3: 16
4: 210
Right 1022430555 7:30315556-30315578 CTCACAAAGTTGAGTCTACCTGG 0: 1
1: 0
2: 0
3: 5
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022430553 Original CRISPR AGAATGCAAATGCACTCTAA GGG (reversed) Intronic
906708353 1:47911146-47911168 GGAATGCAGATTCAATCTAAAGG - Intronic
906832434 1:49047408-49047430 AGGAGGCAAATGGACTCTATTGG - Intronic
907320176 1:53597014-53597036 AGAATGTAAATGTTCTCTCAGGG - Intronic
908250058 1:62258713-62258735 AGAATGTTAATTCACTCAAAAGG - Intronic
910761910 1:90741332-90741354 AAAATGCAAATGCACAATTAAGG - Intergenic
913138800 1:115919369-115919391 AGAATTCAGATGCCCTCTTAGGG + Intergenic
914247376 1:145896267-145896289 AGAATTCAAAACCACTCTCAGGG - Exonic
915696020 1:157742581-157742603 AGAATGAAAAAGCAATTTAAAGG - Intergenic
915957775 1:160237518-160237540 AAAAAGAAAATGAACTCTAATGG - Intronic
917719660 1:177775157-177775179 AGAATGAAACTGCAATCTACTGG - Intergenic
918200425 1:182261127-182261149 AGAATGTAAATGCATTGTTATGG - Intergenic
919359465 1:196572617-196572639 GGAATGCAAAGGCTTTCTAAGGG + Intronic
919993573 1:202727126-202727148 AGATGGCAAAAGCTCTCTAAAGG + Exonic
920391748 1:205608314-205608336 AGGATGCAAAAGCACTTTGAGGG - Exonic
921481601 1:215670358-215670380 AGAATGCAAATGGACTCTGATGG + Intronic
921883822 1:220283668-220283690 AGAATGCAAATGGATGCCAAAGG - Intergenic
922021220 1:221706532-221706554 ACAATGCAAACTCATTCTAATGG - Intronic
922195339 1:223354933-223354955 AGAAAGAAAATGCATTCTTATGG - Intronic
923799289 1:237191391-237191413 AAAATTCAAATGCAATCTCAAGG - Intronic
924329140 1:242924928-242924950 AGACTGGAAATTCACTCAAAGGG + Intergenic
1063816679 10:9783368-9783390 AGAATACAAATGCACATAAAAGG + Intergenic
1064730163 10:18322314-18322336 AGAATGCAAATCAACTTTCATGG + Intronic
1064837179 10:19546231-19546253 AGAATGCATATTCACTGTTAGGG - Intronic
1067114878 10:43427399-43427421 AAAATGCACATGAACTCTTACGG + Intergenic
1068161162 10:53266370-53266392 AGAACTCAAAGGCACTCAAAAGG - Intergenic
1072255143 10:93613966-93613988 AAAATGAACATGTACTCTAATGG - Intronic
1072838304 10:98741128-98741150 AAAATAGAAAGGCACTCTAAGGG + Intronic
1074001857 10:109381490-109381512 ATAATGCAAAAGAACTCTAAAGG + Intergenic
1074757940 10:116640707-116640729 AGGAGGCAAATGAACTCTACAGG - Intronic
1075111296 10:119587112-119587134 AAAAGGCCAATGCACTTTAAAGG + Intronic
1078960205 11:16257431-16257453 ATAAAGCAAAGGCAATCTAAAGG + Intronic
1083548557 11:63567293-63567315 AAAATGCACATGCTCTCTACAGG - Intergenic
1083698960 11:64461651-64461673 AAAATGCAAATGCAAAATAAAGG - Intergenic
1086159246 11:83702909-83702931 AGAAAGCAAATATACTCTGATGG + Intronic
1089738334 11:120564682-120564704 GGAATACTAATGCACCCTAAAGG + Intronic
1090671748 11:128952320-128952342 AGAATGCATGTGGATTCTAAAGG + Intergenic
1092039741 12:5373533-5373555 AAAATGTAAATGAACTATAAAGG - Intergenic
1092159014 12:6305276-6305298 AGAATACAAATGCACTGTGCAGG - Intergenic
1095745664 12:45655747-45655769 GGAATGCAAATGGGCTCAAATGG + Intergenic
1097175511 12:57140470-57140492 AAAATGCAAAAGATCTCTAAAGG - Intronic
1099218914 12:79888932-79888954 AGAATGAAATTGCACTGTCAAGG - Intronic
1099530837 12:83778752-83778774 ATAATTCAAATTCATTCTAAAGG + Intergenic
1100681296 12:96925182-96925204 AGAATGGAAAAGCATTTTAAAGG + Intronic
1100862948 12:98826535-98826557 AGAATTCCAAATCACTCTAATGG + Intronic
1103353479 12:120302316-120302338 AAAATGCAAATGCAATCAGACGG + Exonic
1106837711 13:33653402-33653424 AGAATGCCAATGCTATTTAACGG + Intergenic
1110021141 13:70475100-70475122 AAAATGTAAATACACTCTCAGGG + Intergenic
1110458579 13:75718439-75718461 AGAAAGCAAAAGGAATCTAACGG - Intronic
1110834643 13:80069617-80069639 AAAGTTCAAATGCCCTCTAATGG + Intergenic
1111366510 13:87253112-87253134 AGAATGTCAATGCATTTTAATGG - Intergenic
1111648009 13:91056596-91056618 AGACTGGAAATCCACTCTCAAGG + Intergenic
1113033489 13:106021125-106021147 AGAATGAAAATGTAATATAATGG - Intergenic
1114850533 14:26377954-26377976 AGAATGCACATGCTCTTTGATGG - Intergenic
1115415225 14:33124457-33124479 ATAATGCTACTGCTCTCTAAAGG + Intronic
1116949055 14:50862133-50862155 TGAATGCAAATGCAACCTCAAGG - Intronic
1118079884 14:62346563-62346585 CCAATGCAAATCCACACTAATGG + Intergenic
1119690916 14:76671851-76671873 AGGATGCAAATGCCTTCTGAAGG - Intergenic
1120753021 14:88215883-88215905 AGAGTGAAGATGCACTTTAAAGG + Intronic
1122648579 14:103211491-103211513 AGAATTCATATGGACTCTCAAGG - Intergenic
1123960401 15:25392961-25392983 GGAGTGCAAATGCACTCTTCCGG + Intronic
1125120220 15:36148152-36148174 AGGATGCAAATACACTAAAATGG + Intergenic
1125432084 15:39605638-39605660 AGAATACACATGCCTTCTAAGGG + Intronic
1125468371 15:39977175-39977197 AGTAACCAAATGCAATCTAAAGG + Intronic
1127416547 15:58763308-58763330 AGAATGCTATTACACTCTAGTGG + Intergenic
1127475150 15:59326100-59326122 ATAATACAAATGTACTCAAATGG - Intronic
1127728590 15:61777209-61777231 GGAATGCACATGCAATCTTATGG + Intergenic
1130555179 15:84917681-84917703 AGAATGCAGAAGCTCTCTATGGG - Intronic
1134404056 16:13939734-13939756 AGAATGCTAGTGCAGTCTGATGG + Intronic
1136514660 16:30760974-30760996 AGAATGTAAATGGAGTCTCATGG - Exonic
1136905448 16:34085988-34086010 AGAATTGGAATGGACTCTAATGG - Intergenic
1138115417 16:54357071-54357093 AAGATGAAAATGAACTCTAATGG - Intergenic
1138725531 16:59134458-59134480 AGAATGCAAATGAAGTCACAAGG - Intergenic
1140292540 16:73674327-73674349 AGAATGCAAATCCACATTAAAGG + Intergenic
1140624938 16:76781973-76781995 AGAATATAAAAGCACTGTAAGGG - Intergenic
1146128168 17:30245683-30245705 AGAATGTAAATGCTCACTTAGGG + Intergenic
1147931090 17:43981946-43981968 AGAATGGAAAGGCACGCTACAGG - Intronic
1150936699 17:69643432-69643454 AGAAGGCAAATTCACCCAAATGG - Intergenic
1150950211 17:69795171-69795193 AGAATGCAAAAGGACTCTCTAGG + Intergenic
1151139720 17:71979778-71979800 AAAATGCAAATGGACTCGAGGGG - Intergenic
1151738801 17:75964493-75964515 AGAGTGAAGATGCACGCTAAGGG + Intronic
1153050979 18:903066-903088 ATAATTAAAATGCACTCTAATGG + Intergenic
1158609941 18:58930274-58930296 AGCATGCAAATGCAGGCTACAGG - Intronic
1158688297 18:59635096-59635118 AGACAGCAAAGCCACTCTAAAGG + Intronic
1158858880 18:61572396-61572418 AAAATGCACATGCTCTCTATGGG + Intergenic
1159005742 18:63008633-63008655 AGAATGCAAATGACCCTTAAAGG - Intergenic
1159148650 18:64490427-64490449 AGAAGAGAAATGTACTCTAAAGG + Intergenic
1161841382 19:6683111-6683133 AGAATACAAAGTCACTTTAAAGG + Intronic
1164013421 19:21230084-21230106 AGAAAGAGAATGCACTCTTAGGG + Intronic
1164730133 19:30497275-30497297 AAAATGTAAATGCACTAGAAAGG - Intronic
1167032113 19:46969607-46969629 AGGAGGCAAGTGCTCTCTAAGGG - Intronic
1167882053 19:52467670-52467692 AGAAATCAAAGGCACTCAAATGG + Intronic
1168201551 19:54819032-54819054 AGAATGCAGGTGGCCTCTAAGGG + Intronic
1168206290 19:54852715-54852737 AGAATGCAGGTGGCCTCTAAGGG + Intronic
925864090 2:8210246-8210268 AAAATGCAAAGGAACTATAATGG + Intergenic
926455985 2:13069228-13069250 AGATAGCAGATGTACTCTAAGGG - Intergenic
927619829 2:24642719-24642741 ACAACCCAAATGCACTTTAAAGG + Intronic
928284901 2:29981568-29981590 AAAGTCCAAATTCACTCTAAAGG - Intergenic
928843451 2:35638889-35638911 AGAAAGCAAATGCATTCTTGAGG - Intergenic
935496661 2:103790728-103790750 AGAAAACAAAAGCACTCTAAAGG - Intergenic
937814491 2:126236532-126236554 AGAATGCGATTGCATTATAAAGG + Intergenic
940976159 2:159947147-159947169 ATAATGCAAATGCATGCAAAAGG + Intronic
941166485 2:162088546-162088568 ACAAGGCAAATGCAGTCCAATGG + Intergenic
942765283 2:179448307-179448329 AGATTGCAAATTCAATCTGAGGG - Intronic
945339714 2:208638596-208638618 AGAATGCAAGAGCATTCTCATGG + Intronic
945634098 2:212325041-212325063 ATACTGCAAACGCATTCTAAAGG - Intronic
945695169 2:213092963-213092985 AGAATACAAGTGCATTCTCAGGG + Intronic
946637609 2:221747078-221747100 CGGATGCAAAAGCACTCTATGGG - Intergenic
946652361 2:221907323-221907345 AGAATGCAAATTCAATGAAAGGG - Intergenic
948891851 2:240910724-240910746 AGAATGCATATGCAGGTTAAAGG - Intergenic
948949409 2:241239263-241239285 AAAATGAAAATGCAGTCTAAGGG - Intronic
1168988193 20:2069719-2069741 ATAATGCATATGCATTCTAGTGG - Intergenic
1172022832 20:31926271-31926293 AGGATGCAAATGTTCTCCAAAGG - Intronic
1173285124 20:41663871-41663893 AGAAAGCTAATGCCCACTAATGG + Intergenic
1174879280 20:54260611-54260633 ATAATGTAAATGCAATGTAAAGG + Intergenic
1175037278 20:56011770-56011792 CGAATGCAAATGGACTCTTGTGG - Intergenic
1181863278 22:25835731-25835753 AGCCTGCAACTGCACTCTAATGG + Intronic
1182639513 22:31755144-31755166 TGAATGCAAATGCATTAGAAGGG - Intronic
1182818975 22:33197091-33197113 AAAATGCAAATACACTTTCATGG + Intronic
949335986 3:2976446-2976468 AGAAAGCAAATTATCTCTAAGGG + Intronic
949630613 3:5921961-5921983 ATAATGCAACTGAACTCTATAGG - Intergenic
952455685 3:33469691-33469713 AGAAAGCAGATTCTCTCTAAAGG + Intergenic
953109053 3:39914979-39915001 AGAATGCAAATGTGTTCTAATGG + Intronic
953541932 3:43828144-43828166 AGATTGCACATGCACTGTTAGGG + Intergenic
953628013 3:44586633-44586655 AGAATGCAAATACACCATTATGG + Intronic
953814240 3:46141286-46141308 AGAATGAAAATGCAGTCCTAAGG - Intergenic
955974297 3:64465702-64465724 AGATGGCAAATGCACTCTACTGG + Intergenic
956065601 3:65394190-65394212 AGAGTGCAAATGAAGTCTACTGG + Intronic
956326383 3:68057213-68057235 ATAATTCAAATGCTGTCTAATGG + Intronic
961094181 3:124140708-124140730 AGAATGGGAATGGACTCTCAGGG - Intronic
965566510 3:170124278-170124300 AGAAGGGAAATGAACTCTTATGG - Intronic
965705036 3:171497783-171497805 AGAATGCAGAGGTACTCTGAGGG - Intergenic
966084894 3:176058729-176058751 AGAATGTTAATACACTCTAAAGG + Intergenic
966223932 3:177577886-177577908 AGAAAGAAAATCCACTCTACTGG + Intergenic
966294435 3:178402433-178402455 AGAATGTAAATGCTTTTTAAAGG - Intergenic
970723355 4:19014020-19014042 AGCATGAAAATGAACTCTGAAGG - Intergenic
972480137 4:39488961-39488983 AGAAAGCAAATGCAGGCTTAGGG + Intergenic
972487126 4:39552818-39552840 AGAAAGCAAGTGAACTGTAAAGG + Intronic
973222158 4:47739209-47739231 AAAATTCAAATAAACTCTAAAGG + Intronic
975668450 4:76756101-76756123 AGAAAACAACAGCACTCTAAAGG - Intronic
976611070 4:87030927-87030949 AGAATGCAAATGCACTCAACTGG - Intronic
979175254 4:117655001-117655023 AAAATGCATTTGAACTCTAAGGG - Intergenic
979214140 4:118142096-118142118 TAAATGCAAATGCATTCTAATGG - Intronic
980073941 4:128273949-128273971 AGAATACAAATGTACTTTACTGG - Intronic
980437891 4:132802610-132802632 AGAAGACAAATTCACTCTACGGG - Intergenic
980801698 4:137759391-137759413 AGAATGGAAATGTACTCAAGAGG - Intergenic
981731764 4:147906755-147906777 TGAATGCAAGTCAACTCTAAAGG - Intronic
982810000 4:159813295-159813317 AAAATGCCAATTCTCTCTAACGG - Intergenic
984453980 4:179941623-179941645 ATAATGCTAATGCACCCTTATGG - Intergenic
985800104 5:2000458-2000480 AGATGGCAAACGCAGTCTAATGG + Intergenic
986122330 5:4852740-4852762 AAAATCCAAATGCTCTTTAAAGG + Intergenic
986942646 5:12973954-12973976 AGAATGCCAATGCAGGCAAATGG + Intergenic
987544738 5:19299362-19299384 AGAAAGCAAATTCACTCATAAGG - Intergenic
987588941 5:19897137-19897159 AGAATGAAAAAGCAATCTAAGGG + Intronic
987887350 5:23829753-23829775 AAAATGCACATGCTCTCTACAGG + Intergenic
987937267 5:24482214-24482236 AGAAAACAAATGCAATGTAAAGG + Intergenic
988400193 5:30752132-30752154 AGAAGACACATGCACTCCAAGGG - Intergenic
991337486 5:65565056-65565078 AAAATGATAATGCACTGTAAGGG - Intronic
991983676 5:72260353-72260375 ATAATGCAAAGGGACTCTTAGGG - Intronic
994706361 5:103211589-103211611 AAAATGCAAATGCCCTTTGAAGG + Intronic
995421217 5:111969249-111969271 AGAAAGCAAATACACTGAAAGGG + Intronic
996620208 5:125491962-125491984 ACAATGAAAATGCACTCAAAAGG + Intergenic
997564620 5:134877341-134877363 AGAATGCAGATGCATTCACAGGG + Intronic
998028596 5:138843420-138843442 AGCATGCAAATGCCCTCCGAAGG - Intronic
999562727 5:152822327-152822349 AAAATGCAAAGGAACTCGAATGG + Intergenic
999890420 5:155973136-155973158 AGGATGGAAATCCACTCTGAGGG + Intronic
1000692988 5:164345891-164345913 AGAATGCAAATTCATGATAAAGG + Intergenic
1000863143 5:166480543-166480565 ATAATGCATATGCAGTATAAAGG - Intergenic
1001221821 5:169906905-169906927 AGAAAGCAAATGCTGTCTAGAGG + Intronic
1001259558 5:170216112-170216134 CGAATTCAAATGCAGTCAAAGGG + Intergenic
1004242559 6:13938710-13938732 AGAATGCCACTGCAATTTAATGG - Intronic
1004296464 6:14416219-14416241 AGAATGCCAGTGCACCCAAAGGG - Intergenic
1004483467 6:16043145-16043167 AGAATGCAGTAGCACTATAATGG - Intergenic
1005427346 6:25716666-25716688 AGCATGGAAAAGCACTCTAAGGG - Intergenic
1006420050 6:33927378-33927400 AAAATGCAAATGCTGTCTGAGGG - Intergenic
1007067852 6:39010701-39010723 AGAGTGGAAATTCACTCTTAAGG - Intronic
1007130697 6:39470790-39470812 AGCATGCAAATGCACTCCAAGGG + Intronic
1008748072 6:54697611-54697633 AAAACGCCAATGCCCTCTAATGG - Intergenic
1008899854 6:56599288-56599310 AGAATGAAAATGCATGATAAAGG - Intronic
1009190578 6:60624583-60624605 ATAAATCAAATACACTCTAAGGG - Intergenic
1009481827 6:64168757-64168779 TGAATGCAAATGGACACAAAGGG + Intronic
1010563498 6:77380613-77380635 AAAATGCATATGCAATCTCAAGG + Intergenic
1010726970 6:79346196-79346218 AGAAATGAAATGTACTCTAAAGG - Intergenic
1013071101 6:106730063-106730085 AGAATAGAAATGCATTCTACTGG + Intergenic
1013741983 6:113298108-113298130 ACAATGAAACTACACTCTAAGGG - Intergenic
1014241860 6:119026871-119026893 AGAATGCAAATTTACTTTACAGG - Intronic
1014480494 6:121930168-121930190 AGAATGGAAAGGCAGTCTGAGGG - Intergenic
1015564716 6:134557205-134557227 AAATTGCAAAATCACTCTAATGG - Intergenic
1017961614 6:159227286-159227308 CCTATGCAAATGTACTCTAAGGG + Intronic
1018014427 6:159699297-159699319 ACAAAGCAAATGCCATCTAAGGG - Intronic
1018048418 6:159985777-159985799 AAAATCCAAATGCACTCCAAAGG - Intronic
1021138455 7:16993971-16993993 AAACTGCAAATTCACTTTAAGGG + Intergenic
1022263167 7:28726982-28727004 AGAAAACAGATGCATTCTAATGG - Intronic
1022330428 7:29373844-29373866 AGATTTTAAATGAACTCTAAGGG + Intronic
1022430553 7:30315535-30315557 AGAATGCAAATGCACTCTAAGGG - Intronic
1024025562 7:45407312-45407334 TTAATGCAATTGCACTCCAATGG - Intergenic
1025483933 7:61022356-61022378 AGAAATCGAATGCACTCGAATGG - Intergenic
1027868925 7:83681433-83681455 AAAATGCACATGCTCTCTACAGG - Intergenic
1028793991 7:94883896-94883918 ACAATGCACATGCTCTCTACAGG + Intergenic
1031726344 7:125244404-125244426 AGCATTCAAATACGCTCTAATGG + Intergenic
1032381673 7:131490443-131490465 AAAATGCAAATGCACTTAAGAGG - Exonic
1032985314 7:137330854-137330876 AGAAGGCAAATCCACCCTAGAGG + Intronic
1036497441 8:9282256-9282278 AGAATGCAAATGCACACTGCTGG + Intergenic
1037332095 8:17752971-17752993 AGAATTCACATGCAGTGTAAAGG - Intronic
1038079505 8:24117941-24117963 AGATTACTAATGCACTCTGAAGG - Intergenic
1038410689 8:27356665-27356687 ACAATGCAAATGTCCTTTAATGG + Intronic
1038892918 8:31747158-31747180 AGAATCCAACTGCACTCTTCAGG - Intronic
1039535969 8:38313009-38313031 AAAATGAAAATGCATTCTGAAGG + Intronic
1040632466 8:49231179-49231201 AGAATGCACCTGGACCCTAAGGG - Intergenic
1042781240 8:72493567-72493589 AGAATGTGGATGCACTCTTAGGG - Intergenic
1043295219 8:78653654-78653676 AGAATTCAAATGCAATGTGATGG + Intergenic
1043548333 8:81340010-81340032 AGAATTTATATGCACTCTACTGG - Intergenic
1045255168 8:100513742-100513764 AGAATGCAAAAGCACTTTTGGGG + Intronic
1046238984 8:111465487-111465509 AGAATGCAAAGGCTCTGTGATGG + Intergenic
1048963495 8:139598666-139598688 AGAAGGCAGATGCACCCTATGGG - Intergenic
1054928342 9:70610888-70610910 GTAGTGCAAATGCACTCTTAGGG - Intronic
1058080612 9:100697701-100697723 AGAGTGAAAATGCTATCTAATGG - Intergenic
1058151428 9:101467880-101467902 AGAAAGAAAATGCAATCTAATGG + Intergenic
1059693508 9:116709025-116709047 AGCCAGCAATTGCACTCTAATGG - Intronic
1060712169 9:125878220-125878242 AGAATGCTAATTCACTCAACTGG + Intronic
1061682185 9:132248276-132248298 AGGATTCAAATGCACTCTCTTGG + Intergenic
1061904679 9:133690614-133690636 AGAAAACAAATGCCCTCTCAGGG + Intronic
1185855286 X:3528743-3528765 AGAATGCAAATACAGTTTGATGG + Intergenic
1189706928 X:43768137-43768159 AGAGTGCAAACGCACTTTAGAGG - Intronic
1190948844 X:55122519-55122541 AGGATGCAAAAGCACTCAAGTGG + Intronic
1193999359 X:88408727-88408749 AAAATCAAAATGCTCTCTAAAGG - Intergenic
1194049910 X:89055716-89055738 AGCATGCAAATGAGCTCTTATGG + Intergenic
1194314740 X:92362581-92362603 AGAATGAAAATGCAACCTACAGG - Intronic
1196143555 X:112292120-112292142 ACAATGCACATTCACTCTAGAGG - Intergenic
1200622796 Y:5474098-5474120 AGAATGAAAATGCAACCTACAGG - Intronic
1201226517 Y:11824039-11824061 AGACTGGAAATTCACTCAAAGGG + Intergenic