ID: 1022431846

View in Genome Browser
Species Human (GRCh38)
Location 7:30331818-30331840
Sequence ATGTTAACACAAATGGAACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 266}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022431846_1022431848 2 Left 1022431846 7:30331818-30331840 CCGTGTTCCATTTGTGTTAACAT 0: 1
1: 0
2: 2
3: 25
4: 266
Right 1022431848 7:30331843-30331865 CTAAAATGCTTCTTGTTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022431846 Original CRISPR ATGTTAACACAAATGGAACA CGG (reversed) Intronic
900880630 1:5378522-5378544 ATTTGAACCCAAATGGAAGAAGG + Intergenic
906979271 1:50611331-50611353 ATATTAACACAAAAAGAAAAAGG + Intronic
908149550 1:61285741-61285763 ATTTTAACCCAAAGGGAACCAGG + Intronic
909177169 1:72375704-72375726 AAATTAAAACAAATGGAATATGG - Intergenic
909258771 1:73459644-73459666 ATGAAAACAGAAATGGCACATGG + Intergenic
910505632 1:87947279-87947301 ATTTAAACACATATGGAAAATGG + Intergenic
911158680 1:94660932-94660954 ATGTTAAAGGAAAAGGAACAGGG + Intergenic
911620432 1:100061037-100061059 ATCTTACCAAAAATTGAACATGG + Intronic
912661493 1:111535252-111535274 AAGTTAGCACAAAAGGAACCTGG - Intronic
913281987 1:117194714-117194736 GTGGTAACACAGATGGAACCTGG + Intronic
913492905 1:119398330-119398352 AACTTAACACAAATGGAACGAGG - Intergenic
913499402 1:119457203-119457225 AACTTAACACAAATGGAAGGAGG - Intergenic
915805491 1:158844538-158844560 ATGCTAACAACAATGGAAAAAGG - Intronic
916371416 1:164099925-164099947 ATAGTAACCCAAAGGGAACAAGG - Intergenic
917016861 1:170541651-170541673 ATGTCAACTCAAATTAAACAAGG - Intronic
917863240 1:179168786-179168808 ATGTGAACAAAAAAGGAATAAGG + Intronic
918016823 1:180642876-180642898 ATGTTAACACATAGTGAAGAGGG + Intronic
918544461 1:185666498-185666520 ATGTTAACATAAATGGTAGCAGG - Intergenic
920806118 1:209235516-209235538 ATGTTTAGACAGATTGAACATGG + Intergenic
920942620 1:210498390-210498412 ATGTTACCAAAAATGCTACAGGG - Intronic
921699667 1:218254047-218254069 ATGTTAATACAATAGGAATATGG - Intergenic
921959557 1:221020454-221020476 ATGTTAAGACCAAGAGAACATGG + Intergenic
922316654 1:224448414-224448436 AAGTCAAGAAAAATGGAACAGGG + Intronic
923085029 1:230696740-230696762 ATGTGAACACATTTGGAAAAGGG - Intergenic
1065227855 10:23563879-23563901 ATATTTATACGAATGGAACATGG - Intergenic
1065457911 10:25926878-25926900 ATGTGAAAATAAATAGAACAGGG - Intergenic
1067133130 10:43584337-43584359 ATGTTATCAAAAAAGGAACCCGG - Intergenic
1067155495 10:43777750-43777772 GTGTAGACACAAAGGGAACAAGG - Intergenic
1067263009 10:44711158-44711180 AAGTTAACTCAAATGAATCACGG - Intergenic
1067400217 10:45966010-45966032 ATGTTAATACATATGACACAGGG + Intergenic
1067868544 10:49935298-49935320 ATGTTAATACATATGACACAGGG + Intronic
1068314046 10:55319340-55319362 TTGTTAACATAAATGGAACAAGG + Intronic
1069380072 10:67834219-67834241 ATGTTAACATAAAGGGAAGCTGG + Intronic
1070967217 10:80536850-80536872 AGGTTAACACAACAGGAAGATGG - Intergenic
1071593007 10:86894141-86894163 ATGTTTAGAAAAAGGGAACAGGG - Intronic
1073533047 10:104250601-104250623 ATGTCAACATAAAAGGAAGAGGG + Intronic
1074138170 10:110645184-110645206 ATGGTAACATTAATGGAAAACGG - Intronic
1078262281 11:9721176-9721198 ATGTTAAGAAAAAGGGAAAAGGG - Intronic
1078863676 11:15276818-15276840 GTGTGAACACAAATGAAAAAGGG + Intergenic
1079044187 11:17085157-17085179 TAGTTAATACAGATGGAACAAGG + Intronic
1079720572 11:23806909-23806931 CTGTTAACAGAAAAGGGACAGGG - Intergenic
1082937139 11:58666891-58666913 ATGTTATCACTAATGTCACAGGG - Intronic
1083831144 11:65234561-65234583 ATGTTAGCACAAATGTTTCATGG + Intergenic
1085208770 11:74754905-74754927 ATGTTAACCCTAAGTGAACAGGG - Intronic
1086025636 11:82287359-82287381 ATGTAATCACAAGTGGAAAAGGG - Intergenic
1087164456 11:94987166-94987188 CTGTGAATGCAAATGGAACAAGG + Intronic
1091993404 12:4974190-4974212 ATGTTTATAGAAATGGAAGAAGG - Intergenic
1093172916 12:15879178-15879200 ATATTAAAATAAATGGAAAATGG - Intronic
1094073790 12:26450276-26450298 AAGTTAACACAAATCCACCAAGG + Intronic
1096019304 12:48308862-48308884 ATTTTAAGGCAAATGGATCATGG + Intergenic
1097457905 12:59822603-59822625 ATCTTAACACAAATGACAGATGG - Intergenic
1098683212 12:73384359-73384381 ATGTTAAATAAAATGGAAGAGGG - Intergenic
1098895499 12:76055760-76055782 ATGTAAAGACAAAAGGCACAGGG + Intronic
1099179857 12:79464153-79464175 ATGTTAAATCTAATGTAACAGGG + Intergenic
1099964451 12:89430698-89430720 ATGTAAACACAAATATAATAAGG - Intronic
1100751312 12:97701318-97701340 ATTTTAACAGCAATGGAACATGG + Intergenic
1103192189 12:119010692-119010714 ATGTCAACACTAAAGGAAAAAGG + Intronic
1104206775 12:126646265-126646287 ATATTAACAGAAATGTAAAATGG - Intergenic
1104354724 12:128075363-128075385 ATGTTAAGTCACATGGAAAAGGG + Intergenic
1104362180 12:128144334-128144356 ATGTTGGCACAGATGGATCAGGG + Intergenic
1104831552 12:131755802-131755824 ATGTTAACACAACAGAAGCAAGG - Intronic
1106964290 13:35040710-35040732 ATTTTCACATAAATGGAAAAGGG - Intronic
1107112983 13:36717585-36717607 ATGTACACAGAAATGGAACTGGG + Intergenic
1108069037 13:46608377-46608399 ATGTTACCCCAAATGACACATGG - Intronic
1108477046 13:50830757-50830779 ATGTTACCCCACATGGCACAGGG + Intronic
1108826512 13:54418405-54418427 AAGTTAAAACAAATGCCACATGG + Intergenic
1109398937 13:61798831-61798853 ATGGTAACACAAATTGTGCATGG - Intergenic
1110080308 13:71301793-71301815 ATGTTAAAACATATGAAATATGG - Intergenic
1111005883 13:82248246-82248268 ATGTTAACTCACATGACACAAGG - Intergenic
1112254680 13:97818999-97819021 TTGTTAATACTAATGGCACATGG - Intergenic
1113433298 13:110268723-110268745 CTCTTAACACAACTGGGACAAGG + Intronic
1114334601 14:21675278-21675300 CTGTTAAAACAAATGAAATATGG + Intergenic
1114860042 14:26505935-26505957 ATTTTAATACAAATGAAATAAGG - Intronic
1115087001 14:29529536-29529558 AGGTAAACACAAAACGAACATGG + Intergenic
1115666879 14:35560663-35560685 ATGTTAACAGAAATGGAAGTTGG + Intronic
1117346013 14:54833493-54833515 AAGTTAACACACATGATACATGG - Intergenic
1118203339 14:63698147-63698169 ATGTAAACACAAATGGCCCCTGG + Intronic
1118416813 14:65547796-65547818 ATGTTAACATTAGGGGAACATGG - Intronic
1119902775 14:78275551-78275573 ATGGTAACAAAAATGGAATATGG + Intronic
1120349638 14:83338464-83338486 ATTTTAACGAAAATAGAACAAGG + Intergenic
1120599270 14:86480838-86480860 ATGTAAACAAAAAGGGAAGATGG - Intergenic
1123020283 14:105394718-105394740 ATGTTAACAGAAATGCAGCTGGG - Exonic
1124642788 15:31407001-31407023 ATGTTATCTCACATGGAAAAAGG - Intronic
1127107594 15:55633518-55633540 ATTTTAATACAAATGGAACAAGG - Intronic
1127853602 15:62936462-62936484 CAGTTAATACAAATGGAATATGG - Intergenic
1128197134 15:65768540-65768562 ACTTTTACATAAATGGAACATGG + Intronic
1128704352 15:69827829-69827851 CTGGGAACACAAATGGACCAAGG - Intergenic
1130223459 15:82040753-82040775 AAATTAACACAAAAGGAAGAAGG + Intergenic
1130685716 15:86035639-86035661 ATGTTAACATAAAGGGAAACTGG - Intergenic
1130905586 15:88238702-88238724 ATGTTACCACACAGAGAACAAGG + Intronic
1131640619 15:94288673-94288695 ATGTTAACTCACATGGGAAAAGG + Intronic
1135385082 16:22031954-22031976 CTGGTAACAGAAATGGAAAATGG - Intronic
1137543358 16:49379720-49379742 ATGTTAACATTAAGGGAAAATGG + Intronic
1140161468 16:72499349-72499371 ATGTTCACAAAAATGGAAAAGGG - Intergenic
1142270248 16:89085256-89085278 ATGTCAACACACAGGAAACACGG + Intergenic
1144019500 17:11227700-11227722 ATGCAAATACAAAGGGAACAGGG - Intergenic
1144794139 17:17879661-17879683 ATGTTAACAGAAATGGTCCCTGG - Exonic
1144865969 17:18335955-18335977 TTCTTAACACAACTAGAACAAGG + Intronic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1147489863 17:40855935-40855957 GTATTTACACAAATGGAACTTGG - Intergenic
1152056133 17:78028329-78028351 TTGTTGACACCACTGGAACAAGG + Intronic
1155559067 18:27055789-27055811 ATGATATAACAAAAGGAACACGG + Intronic
1155993078 18:32301019-32301041 ATGTTAAAATAAAAGGCACATGG + Intronic
1156356485 18:36346457-36346479 ATGTTAATGCAAATGGTAAATGG + Intronic
1156358867 18:36366334-36366356 ACATTAAGACAAATGGAACGAGG + Intronic
1157336371 18:46740833-46740855 ATGTTAACACATAAAGCACATGG + Intronic
1158014271 18:52765689-52765711 AAGCTAAGACAAATGTAACATGG - Intronic
1158065916 18:53408207-53408229 ATATTATCACAAATGTAGCAGGG + Intronic
1158543631 18:58378169-58378191 ATGATTACCCAAAGGGAACAAGG + Intronic
1158755429 18:60318823-60318845 ATATAAAGACTAATGGAACAGGG - Intergenic
1159495885 18:69204109-69204131 ATGTTAATATAAATGAAATAAGG + Intergenic
1159986161 18:74843811-74843833 AAATAAACACAAGTGGAACATGG - Intronic
1160544498 18:79643625-79643647 CTGATCACACAAATGGATCAAGG + Intergenic
1162289874 19:9770931-9770953 ATGTAAACCAAAATGGAAAAAGG + Intronic
1163493127 19:17628683-17628705 CGGTTAACACAGATGAAACATGG + Intronic
1165184480 19:34005420-34005442 ATCTTAAAACAAAAGGAACAAGG + Intergenic
1168351452 19:55678484-55678506 CTGGAAACACAAATGGGACATGG - Intronic
1168555944 19:57339985-57340007 ATGTAGACACAAATGGATTAGGG + Intergenic
925985210 2:9209528-9209550 ATGTTTAAACAAATGAATCACGG + Intronic
926612303 2:14958587-14958609 ATGGTAAGAGCAATGGAACACGG + Intergenic
927039695 2:19215983-19216005 CTGTGACCACAAATGGAAGAAGG - Intergenic
928646782 2:33362624-33362646 AAGTTAACACAGATGGAAAATGG - Intronic
929210999 2:39357033-39357055 ATTATAACACAGTTGGAACAAGG - Intronic
932283480 2:70514264-70514286 ATATTAACACACATGGAGAAAGG + Intronic
933463867 2:82625144-82625166 ATGTTACCATACATGGAAAATGG + Intergenic
937227855 2:120379867-120379889 ATATGAACACACATGCAACAGGG - Intergenic
939739216 2:145885505-145885527 ATGTTAATATAAATTGAATATGG - Intergenic
940517672 2:154700286-154700308 ATGCTAAAACAAATTGCACATGG + Intronic
940600840 2:155857793-155857815 ATATTCACCTAAATGGAACACGG + Intergenic
940776494 2:157889954-157889976 ATGTAAACAAATATGGAAGAAGG - Intronic
941291015 2:163675095-163675117 ATGTTAACTCAAATGTGGCATGG - Intronic
942426379 2:175864752-175864774 ATTTTAAGACAAGTGAAACAAGG - Intergenic
943225090 2:185163035-185163057 ATGTTGATACAAATGTAAAATGG - Intergenic
943877288 2:193085910-193085932 ATATTAACAGAGATGGAATATGG + Intergenic
943901096 2:193437682-193437704 ATGTTAACACAAATACAATAAGG + Intergenic
944055605 2:195519182-195519204 ATTTTAAAAGAATTGGAACAAGG + Intergenic
944964654 2:204916963-204916985 ATGTTAAAACCAAGAGAACAGGG - Intronic
948371206 2:237490090-237490112 ATCTAAACAGAAATGGAACAAGG + Intronic
1169865084 20:10191344-10191366 TTGTCACCCCAAATGGAACATGG + Intergenic
1170012414 20:11739460-11739482 ATGATAACACAAATTGACTAGGG - Intergenic
1170684375 20:18555750-18555772 ATGTTAACACTAAGGGAAAATGG - Intronic
1172329958 20:34068608-34068630 ATGTTTAAACATATGGTACATGG - Intronic
1173026740 20:39314497-39314519 ATGTTAACACTAAGGGAACCTGG - Intergenic
1173305874 20:41848718-41848740 ATGTGGAAACAAATGGGACAGGG + Intergenic
1173881660 20:46418223-46418245 ATCTGAACACAGTTGGAACACGG - Intronic
1174455625 20:50646631-50646653 ATGCCCACACAAAAGGAACAGGG + Intronic
1174828729 20:53793381-53793403 ATGTTTACACAAATAGTAAATGG - Intergenic
1174929792 20:54800601-54800623 ATGTTAAAACAAGTGATACAGGG + Intergenic
1176933144 21:14837671-14837693 ATGTTAACACAATCAGAAAAAGG - Intergenic
1177902831 21:26937897-26937919 ATGTTAAAACAAAAGGAAGAAGG - Intronic
1177926997 21:27229760-27229782 ATGTTAAAATAAAAGAAACAAGG + Intergenic
1179431944 21:41327513-41327535 ATCTTAAGACAAATGGAAATGGG - Intronic
1179944538 21:44662934-44662956 ATGTCAAAATATATGGAACATGG + Intronic
1180696638 22:17755344-17755366 ATGTGAACACACATGGACCATGG + Intronic
1183887075 22:40892932-40892954 ATATTATAACAGATGGAACATGG + Intronic
1184805141 22:46790262-46790284 AAGGTCACACAAATGCAACATGG - Intronic
949484384 3:4523730-4523752 ATGTTGTCACAAATGAACCAGGG + Intronic
949886782 3:8701657-8701679 ATGTTAACCCTAATGTCACACGG - Intronic
950858383 3:16126485-16126507 ATGGCAACATACATGGAACATGG + Intergenic
951406621 3:22307586-22307608 ATCATAACACAAATGGACTATGG + Intronic
951637534 3:24796099-24796121 ATGATAAGACAAATGGAAAAAGG + Intergenic
951874913 3:27412861-27412883 ATATTAAGAGAAATGAAACAAGG + Intronic
953487912 3:43319722-43319744 ATGTTAACAGAGATGAACCAAGG + Intronic
954172317 3:48814616-48814638 CTGGAAATACAAATGGAACAAGG - Intronic
955672539 3:61417053-61417075 ATGTTAACATTAAGGGAAGATGG + Intergenic
956226320 3:66963088-66963110 ATGGGAAGACAAATAGAACAGGG - Intergenic
957480452 3:80786409-80786431 GTGTTAAGATAAATGGAAGAGGG - Intergenic
957660484 3:83145265-83145287 AGGTGAAGACAAATGGAACGTGG - Intergenic
960196864 3:114779168-114779190 GTGTTAAAGCAAATAGAACAAGG - Intronic
960206822 3:114912027-114912049 ATGTTCACTTATATGGAACAAGG - Intronic
960247411 3:115414712-115414734 ATGTTCACAGAAATGGAGGAAGG - Intergenic
961594932 3:128008511-128008533 CTGTTAAAAAGAATGGAACAAGG + Intergenic
964284655 3:155104639-155104661 ATGTTTAAACAGAAGGAACATGG + Intronic
967162832 3:186754365-186754387 ATGTTAACAGTGAGGGAACATGG + Intergenic
967665024 3:192160908-192160930 ACTTTGACACAAATGGAGCAAGG + Intronic
967874076 3:194254665-194254687 ATCTTAAAATAAATTGAACAAGG - Intergenic
970737699 4:19193987-19194009 ATGCTAAAAGAAATGGAACCAGG - Intergenic
970969673 4:21967165-21967187 ATGTTCACACATATGGATGATGG + Intergenic
971761398 4:30770768-30770790 CAGTTATAACAAATGGAACACGG - Intronic
973308628 4:48682052-48682074 ATGAAAACACAAAGGTAACAGGG + Intronic
973928025 4:55759627-55759649 ATGTTAAAACAAATTGTTCAAGG - Intergenic
974391446 4:61275148-61275170 CTGTTCATACAACTGGAACAAGG + Intronic
976669286 4:87634202-87634224 ATGTTAAAGCACATGGAACTTGG - Intergenic
978166395 4:105613261-105613283 ATGTTAACAGAAATGGTTAATGG + Intronic
978870997 4:113577827-113577849 ATGTCCAAACACATGGAACATGG - Intronic
979560623 4:122097521-122097543 ATGTTTACAAAATTGAAACAGGG - Intergenic
980243431 4:130205380-130205402 ATATTGACTCAAATGGAATATGG + Intergenic
980895877 4:138859721-138859743 AAATTAACACAAATGGAGCTGGG - Intergenic
981854364 4:149270190-149270212 GTGTTAAGAAAAATGGAAAATGG - Intergenic
982986892 4:162221191-162221213 AGGATGAAACAAATGGAACAGGG + Intergenic
983051474 4:163052667-163052689 ATGATAACTAAAATGGAAAATGG + Intergenic
983104974 4:163675560-163675582 ATATTAACAAAATTGGAACTGGG + Intronic
983113735 4:163785811-163785833 ATGTTACCATAAATGGCAAAAGG + Intronic
984137186 4:175955346-175955368 ATGTTTACAAAAATAGAAAATGG + Intronic
984358316 4:178693896-178693918 ATGTTAACTTAAAGGGAACTAGG + Intergenic
985012194 4:185594441-185594463 ATGTTAATTCAAATGTAGCATGG - Intronic
985407451 4:189651681-189651703 ATGGTAACACCAGTGGAATAAGG + Intergenic
985407535 4:189651989-189652011 ATGGTAACACCAGTGGAATAAGG + Intergenic
985407583 4:189652165-189652187 ATGGTAACACCAGTGGAATAAGG + Intergenic
986139721 5:5018176-5018198 CTGTTCAGAGAAATGGAACAAGG - Intergenic
986551453 5:8960692-8960714 ATGTAAGCACAAATCAAACAAGG + Intergenic
986567857 5:9133148-9133170 TTTTTAACTGAAATGGAACAAGG - Intronic
986891771 5:12317943-12317965 ATGTTAACACTAAGGGAAACTGG - Intergenic
988827689 5:34955642-34955664 ATATTAACACAAAGGAAATATGG + Exonic
989793364 5:45434992-45435014 ATGTTAAGACTAATTGAAGAGGG + Intronic
989826384 5:45861741-45861763 AGGTGAACACATATGGAAGAGGG + Intergenic
990264288 5:54058999-54059021 ATGTTGTGACAAATGGAACAAGG - Intronic
990967071 5:61460491-61460513 CTGTTAACATACATAGAACATGG + Intronic
993359448 5:86955945-86955967 ATGTAAGAACAAATAGAACAAGG - Intergenic
993420142 5:87691493-87691515 ATGGTAACCCAAAGGGAGCAGGG - Intergenic
994864253 5:105245442-105245464 ATATTAGAACAAATGGAAGATGG + Intergenic
995086121 5:108111905-108111927 CTGTTGACACACATTGAACAAGG + Intronic
996442201 5:123504226-123504248 ATATTATCTCAAATGGCACAAGG + Intergenic
999835275 5:155363755-155363777 ATGTTAACTCAGGTGGAAAATGG - Intergenic
1001151405 5:169231433-169231455 AAGTTTACACAAATGGAATCAGG + Intronic
1002384522 5:178856318-178856340 ATGCCAACAGAAATGGAAGAAGG - Intergenic
1003341196 6:5222530-5222552 AAGTTAACACAAAGGGCCCAAGG + Intronic
1004747501 6:18525560-18525582 ATTGTAACACAAAAGCAACATGG - Intergenic
1004987151 6:21095391-21095413 ATGTTCACACAAGTGGGAAAAGG - Intronic
1007657970 6:43463946-43463968 ATGTTAACACTAAGGGAAATTGG + Intergenic
1007813093 6:44500199-44500221 AAGTTCACGCCAATGGAACATGG - Intergenic
1008266455 6:49433269-49433291 ATGTCAGGACAAATGGTACATGG - Intronic
1009512241 6:64567985-64568007 GTGGGAACACAAATGGAACATGG + Intronic
1010338247 6:74715179-74715201 AATTTAAAACAAATGGAAGAGGG - Intergenic
1010364142 6:75030384-75030406 TTTTTAACACTAATGTAACAGGG + Intergenic
1011581465 6:88871485-88871507 ATGTTACAACAAATAGAATATGG + Intronic
1012060118 6:94467851-94467873 ATGTTTACCCAACTGTAACATGG + Intergenic
1012470196 6:99564089-99564111 CTGTTAATACAAATGGAAATTGG - Intronic
1013446528 6:110234287-110234309 ATATTAAAACAAATAAAACATGG - Intronic
1013784184 6:113760804-113760826 AAGTTTAAACTAATGGAACAGGG + Intergenic
1014076258 6:117238768-117238790 ATATTTAGACAAATGGTACATGG + Intergenic
1014363089 6:120505628-120505650 TTGCTAACGCAAATGGAAAATGG - Intergenic
1014788970 6:125649810-125649832 ATGCTAACACAAATAAAACAAGG - Intergenic
1015974100 6:138772000-138772022 TTGTAAACACAAATGCTACAGGG + Intronic
1017027521 6:150194276-150194298 AAGGTAACAGAAATGGAAGAGGG - Intronic
1017366380 6:153645759-153645781 ATGTTAACTAAAATAGACCATGG + Intergenic
1021304686 7:19017902-19017924 ATGGTAATAAAAAGGGAACAGGG + Intergenic
1021858529 7:24882050-24882072 ATGTTACCACATTTGGAAAAAGG - Intronic
1022431846 7:30331818-30331840 ATGTTAACACAAATGGAACACGG - Intronic
1023620444 7:42066471-42066493 AGGTTAACACAAATTAAATATGG + Intronic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1026117272 7:67506486-67506508 ATGTTCACACAAACAGTACATGG - Intergenic
1027591704 7:80126813-80126835 CAGTTAACACAAATGAAAAATGG + Intergenic
1028202214 7:87975044-87975066 ATGTTACCTCACATGGAAAAAGG - Intronic
1029990182 7:104955929-104955951 ATGTTAAAAGAAATGTAACAGGG - Intergenic
1030234936 7:107248274-107248296 ATGCCATCACAAAAGGAACAAGG + Intronic
1032509038 7:132457131-132457153 ATGTTAACACAAGGGGAAGCTGG - Intronic
1036045851 8:5139591-5139613 GTGTTGACACAAATGGAAGATGG - Intergenic
1036133735 8:6140083-6140105 CTGTTTACACAAAGGGAATAGGG - Intergenic
1036392696 8:8338203-8338225 AGGTTAAAACACATGGTACATGG - Intronic
1036667450 8:10756800-10756822 ATGTTAACTGAACTGGAAGAGGG - Intronic
1037145275 8:15564267-15564289 ATGTTAACTCAAAAACAACATGG - Intronic
1038130218 8:24722101-24722123 AGGTAAGCACAAATTGAACAAGG + Intergenic
1038472293 8:27835486-27835508 AAGATAACACAGATGGAAGAAGG - Intronic
1042074577 8:64977762-64977784 ATATTTACAGAAATAGAACACGG + Intergenic
1042893463 8:73639376-73639398 TTGTTAGCACAAATGAAACTAGG - Intronic
1043065489 8:75565558-75565580 ATTTTAAAACAAATGAAGCATGG + Exonic
1043342067 8:79251960-79251982 ATGTACACACAACTGTAACAGGG + Intergenic
1043659599 8:82721335-82721357 ATGTTAATATAAATGAAACATGG + Intergenic
1044828192 8:96219205-96219227 ATGTTAACCTACATGGAAAAAGG + Intergenic
1044828344 8:96220245-96220267 ATGTTAACCCACATGGCAAAAGG + Intergenic
1047085038 8:121506675-121506697 ATTTTAAAACAATTGGAACAGGG + Intergenic
1050037991 9:1457612-1457634 ATGTTAGCACAAATAGAATGAGG - Intergenic
1050058749 9:1682897-1682919 ATGATAACACAAAAGGCAGAAGG - Intergenic
1050784124 9:9377718-9377740 ATGTTGGCACAGATGAAACAAGG + Intronic
1050818830 9:9851864-9851886 ATGTTAACAGTAAGGGATCATGG - Intronic
1050875150 9:10624399-10624421 ATGTTAAAACAAAGGAAACAGGG + Intergenic
1052038182 9:23706916-23706938 ATGTTAACACCATTGGGGCAGGG - Intronic
1053529638 9:38867294-38867316 CTGTTAACAGGAATGTAACATGG + Intergenic
1054201863 9:62091721-62091743 CTGTTAACAGGAATGTAACATGG + Intergenic
1054636494 9:67496638-67496660 CTGTTAACAGGAATGTAACATGG - Intergenic
1055262720 9:74457377-74457399 ATCTAAACACAAATTGAACAGGG + Intergenic
1055538589 9:77276940-77276962 ATGTTAACTCATATGGCAAAAGG - Intronic
1055608710 9:77998486-77998508 ATGTGAAGTAAAATGGAACATGG - Intronic
1056241449 9:84651528-84651550 AATTTATCCCAAATGGAACATGG - Intergenic
1057454484 9:95195296-95195318 AAATTAACTCAAATGGATCAGGG - Intronic
1059595529 9:115716052-115716074 ATGTAAAAACAAAGGGAACCAGG + Intergenic
1060064484 9:120491861-120491883 ATGTTAATACAAATGTCATAAGG + Intronic
1060246173 9:121948208-121948230 AAGTTAACACAACCGGAACATGG + Intronic
1061556967 9:131376611-131376633 TTGTTAACACAACTGGAAGTGGG + Intergenic
1062305390 9:135903639-135903661 ATCTTTACACAAATGGAGGATGG + Intronic
1186071061 X:5821215-5821237 CTGGAAACACAAATGGCACACGG + Intergenic
1187184758 X:16972838-16972860 ATGTTAACATTAAGGGAGCAGGG - Intronic
1187215540 X:17272168-17272190 ATGTTAACAGTAGTGGAACCTGG - Intergenic
1188975729 X:36673028-36673050 AGGTTAATACACTTGGAACAAGG - Intergenic
1189459572 X:41228290-41228312 TTTTTAACACAAAAGAAACAAGG + Intronic
1192461812 X:71323475-71323497 ATGGTAGGAAAAATGGAACAGGG + Intergenic
1192616054 X:72623847-72623869 ATAATAACAGAAATGGATCATGG + Intronic
1193208140 X:78773172-78773194 TTGTCCACACAAATGGAAGAAGG - Intergenic
1194096770 X:89650034-89650056 ATGGCAACACAAATGGACTATGG + Intergenic
1196676789 X:118428582-118428604 TTATTAAAACAAATGGAAGAGGG + Intronic
1200449787 Y:3311408-3311430 ATGGCAACACAAATGGACTATGG + Intergenic
1201324800 Y:12744658-12744680 ATGGTAATGCAAATGGAACCAGG - Intronic
1201891722 Y:18949655-18949677 ATCATAACACAAATGGAATCGGG + Intergenic