ID: 1022433151

View in Genome Browser
Species Human (GRCh38)
Location 7:30347800-30347822
Sequence AATCTAGATTTATATTCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 258}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022433150_1022433151 -7 Left 1022433150 7:30347784-30347806 CCTGAGGTTTCAGATGAATCTAG 0: 1
1: 1
2: 2
3: 14
4: 139
Right 1022433151 7:30347800-30347822 AATCTAGATTTATATTCTCCAGG 0: 1
1: 0
2: 0
3: 27
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022433151 Original CRISPR AATCTAGATTTATATTCTCC AGG Intronic
905466620 1:38159201-38159223 AGTCTAGAATTCTGTTCTCCAGG + Intergenic
906882825 1:49611105-49611127 AAGCGACATTTACATTCTCCAGG - Intronic
907068578 1:51512387-51512409 AATCTAGATTTTTAAACTTCAGG - Intronic
907105179 1:51876685-51876707 AGTCTAGATATATTTTCTCCAGG - Intronic
909093744 1:71260460-71260482 AATGAAGATTTATAATCTCCAGG - Intergenic
909692557 1:78425081-78425103 AATCTAGAGGTATGTTCTCGAGG + Intronic
909926988 1:81449143-81449165 ACTATGGATTTATATTATCCAGG + Intronic
909926998 1:81449220-81449242 ACTATGGATTTATATTATCCAGG + Intronic
909944612 1:81649531-81649553 CATCTCCATTTCTATTCTCCTGG + Intronic
910346738 1:86247580-86247602 AATCTAGATTTATTTTTTAAAGG + Intergenic
911526706 1:98996375-98996397 ACTCTAGAGTTTTATTCTCCAGG - Intronic
912378224 1:109230169-109230191 AATGTAGATTTTTTTTTTCCAGG - Intronic
914951359 1:152117574-152117596 AATCAAGTTTGAAATTCTCCTGG + Intergenic
915991382 1:160520580-160520602 AAACGAGATTTATTTTCTCTAGG + Intronic
917005261 1:170408355-170408377 ACTACAGATTCATATTCTCCTGG + Intergenic
917377830 1:174368902-174368924 AATCAAGATTTATAATATCTAGG + Intronic
918183220 1:182103681-182103703 AAATTAGAATTATATTTTCCTGG + Intergenic
918210302 1:182344394-182344416 ATTCCAGATTTCTAGTCTCCAGG + Intergenic
918538384 1:185601015-185601037 AACCTAGAATTAGATTGTCCAGG - Intergenic
918697768 1:187564765-187564787 TATCAAGTTTTATTTTCTCCCGG - Intergenic
918737030 1:188077903-188077925 AATGTCTTTTTATATTCTCCGGG + Intergenic
920771702 1:208892661-208892683 AATCTGGCTTTAATTTCTCCAGG + Intergenic
920807987 1:209252988-209253010 AATTTAGATTTTTTTTCCCCTGG - Intergenic
920943646 1:210507657-210507679 ACTCTAGAAATATATTCTCATGG - Intronic
921702137 1:218280721-218280743 ATTCTAGATTTATATCATTCAGG + Intergenic
1062777550 10:165900-165922 AATATAGATTTATAGTCTAGTGG + Intronic
1063699875 10:8373851-8373873 CATCTAGCATAATATTCTCCAGG + Intergenic
1064956289 10:20914620-20914642 AAACTCCATTTATATTTTCCAGG + Intronic
1065473319 10:26106321-26106343 AATCTATACTTATATTCATCTGG + Intronic
1067492919 10:46729493-46729515 AATCCAGATCTATCTTCTGCAGG - Intergenic
1067601745 10:47610899-47610921 AATCCAGATCTATCTTCTGCAGG + Intergenic
1067950336 10:50729588-50729610 AATATAAATTTATATTCCCCAGG - Intergenic
1068273828 10:54766503-54766525 AATATAAATTTATATTCCCCAGG + Intronic
1069384961 10:67875832-67875854 GATCTAGGTTTATATACTGCTGG + Intergenic
1069943661 10:71971846-71971868 GTTCTAGATTTCTATTCTCGGGG - Intronic
1070530079 10:77329133-77329155 AATATAGATATATATTGACCGGG - Intronic
1070885669 10:79894812-79894834 AATATAAATTTATATTCCCCAGG - Intergenic
1071142489 10:82526685-82526707 ATCCTAAATTTATATTCACCTGG + Intronic
1071150160 10:82624637-82624659 AATATAGACTTATAATTTCCTGG - Intronic
1071250296 10:83811445-83811467 AATCTAGATTAATTTTCTCAAGG + Intergenic
1071653271 10:87418486-87418508 AATCCAGATCTATCTTCTGCAGG + Intergenic
1073501099 10:103937841-103937863 AATTTGGATTCATTTTCTCCTGG + Intergenic
1073660220 10:105467613-105467635 AATGTAGATGAATATTCTCATGG + Intergenic
1074735266 10:116424773-116424795 CATCTGGCTTTAGATTCTCCTGG - Intergenic
1075042691 10:119121108-119121130 AATCTACATTTATTTTGGCCGGG - Intronic
1079520602 11:21321876-21321898 AATCTAGATTCAAATCCTGCTGG - Intronic
1079985957 11:27201148-27201170 AAACAAGATTTGTATTCTCCTGG - Intergenic
1081107975 11:39095557-39095579 GATTTATATTTATATTTTCCAGG - Intergenic
1082615226 11:55351110-55351132 AATATAGAATGATATTTTCCTGG - Intergenic
1082719229 11:56653100-56653122 AATCTAGATTGTTATTCACTTGG + Intergenic
1084495896 11:69502895-69502917 AATCTAGATTTAAAGTATGCAGG - Intergenic
1086131259 11:83404926-83404948 CATCTTGATTTATAATCCCCAGG + Intergenic
1086762316 11:90647215-90647237 AATCTAGATTTGCATTCTCTGGG - Intergenic
1087744031 11:101922102-101922124 AAAGTAGATTTTTTTTCTCCAGG + Intronic
1088164644 11:106918859-106918881 AATCTTGATTTATCATCTTCTGG + Intronic
1089438281 11:118491091-118491113 AATCTAAATCTATATTCTTCTGG - Intronic
1090909858 11:131109546-131109568 AATCTAGATATGCATTCTCTTGG - Intergenic
1091499796 12:1005154-1005176 AATCTTTATTTATTTTCACCTGG + Intronic
1095543291 12:43336576-43336598 AATTTAGACTTTTATTCCCCAGG + Intergenic
1095881337 12:47140407-47140429 TATCTAGATTTTTATGCCCCTGG + Intronic
1097288469 12:57895340-57895362 AACCTATATTTTTCTTCTCCAGG + Intergenic
1098165615 12:67694601-67694623 CCTATAGATATATATTCTCCAGG + Intergenic
1098807627 12:75039674-75039696 AATTTATATTTATGTTTTCCAGG - Intergenic
1099138490 12:78939595-78939617 AAACTAGATCTAGTTTCTCCTGG - Intronic
1099736213 12:86569089-86569111 AATATATATATATATTCTTCAGG + Intronic
1101236278 12:102793411-102793433 CATCTTGAATTATATACTCCAGG - Intergenic
1104363676 12:128156926-128156948 AATAGAGATTTACATTCTGCTGG - Intergenic
1106932780 13:34684803-34684825 AGTCTAGATCCATTTTCTCCTGG + Intergenic
1107503872 13:41010990-41011012 AAACTAGATATACATTCTTCAGG - Intronic
1109376625 13:61503507-61503529 AATCTAGATTGAGTTTCTACAGG + Intergenic
1110105988 13:71676742-71676764 ATTCTAGATTAATATTGCCCCGG + Intronic
1110366604 13:74693791-74693813 AATCTACATTTATATTGTAGAGG + Intergenic
1111261854 13:85751315-85751337 AATTTAGATTTTTATTATGCAGG - Intergenic
1111265439 13:85806209-85806231 AATTTGGATTTATATTGCCCAGG - Intergenic
1111469257 13:88656581-88656603 ATTATACATTTATCTTCTCCAGG - Intergenic
1111887444 13:94040129-94040151 AATCTAGAATTACGTTCTTCTGG + Intronic
1111916126 13:94362508-94362530 AATCTACAGTTTTATTCTCGGGG + Intronic
1115674185 14:35650751-35650773 AATCTTGAGTTCTATTCTCCAGG - Intronic
1116021045 14:39461498-39461520 AATTTAAATTTAAATTCCCCTGG + Intergenic
1116033688 14:39602991-39603013 ATTTTAGAATTATATTCTACAGG + Intergenic
1116037965 14:39651250-39651272 ACTATAGATTCATATTATCCTGG - Intergenic
1116152865 14:41164508-41164530 AATCTTTATTTATATTTACCTGG - Intergenic
1116777294 14:49195546-49195568 AGTCTAGATTTGAAATCTCCTGG - Intergenic
1120174624 14:81279889-81279911 AATTTAGATTTATTTTCTTAGGG - Intronic
1121706067 14:95994805-95994827 GATCCATATTTATTTTCTCCTGG - Intergenic
1127085434 15:55420156-55420178 GATTTAGCTTTATCTTCTCCAGG - Intronic
1127649089 15:60988780-60988802 GACCTAGATTTATCTACTCCAGG + Intronic
1128042773 15:64590163-64590185 AATCTAGCCTTTTATTGTCCTGG + Intronic
1129623049 15:77167014-77167036 AATCTGCATTTATATACTCCAGG + Intronic
1131099931 15:89680036-89680058 CAAGTAGATTTTTATTCTCCTGG + Intronic
1131787800 15:95931870-95931892 AATCTACATTTTTATTATCATGG - Intergenic
1135715836 16:24765865-24765887 AGTCTAGATTTATGTACTCAGGG + Intronic
1136900217 16:34028021-34028043 AATCTAGAGTTGTCTTCTTCTGG - Intergenic
1140444828 16:75017567-75017589 AATCTATATTGATCTGCTCCTGG + Intronic
1143779758 17:9223155-9223177 AATCTAGGTTTATTTTCCCGTGG - Intronic
1143896309 17:10139038-10139060 AGCCTAGTTTTATATTCTCCAGG + Intronic
1144404329 17:14938232-14938254 AAGCTAGCTTCATATTCTCTGGG + Intergenic
1146076250 17:29732278-29732300 AATTTGCATTTATATACTCCTGG - Intronic
1148087720 17:45004553-45004575 AAACCAGATTGTTATTCTCCTGG + Intergenic
1150966763 17:69979398-69979420 AATCTAAATGTATATTTTGCAGG - Intergenic
1151005020 17:70425113-70425135 AATCTATTTTTATATGCTCTGGG + Intergenic
1155888584 18:31238578-31238600 AATCATCATTTATATTCTCATGG + Intergenic
1156285603 18:35692263-35692285 AATCAGGATATATATTCTCTAGG - Exonic
1156682124 18:39603077-39603099 ACACTATGTTTATATTCTCCTGG - Intergenic
1156963221 18:43058361-43058383 AATCCAGCTTTAGATTCACCCGG + Intronic
1158087459 18:53669543-53669565 AATATAGAATTGTATTTTCCTGG + Intergenic
1158399488 18:57108802-57108824 AATCTGAGATTATATTCTCCAGG - Intergenic
1159926149 18:74270706-74270728 AATCTAGATTTAAAATATTCAGG + Intronic
1165464904 19:35968209-35968231 AATCTAGATGTATACTGGCCAGG - Intergenic
1166269059 19:41702406-41702428 ACTCTAAATGTATCTTCTCCTGG - Intronic
1167789495 19:51664536-51664558 AATCTAGATACATACTTTCCTGG - Intergenic
926040193 2:9666645-9666667 AATATAGAAATACATTCTCCAGG + Intergenic
928885628 2:36144747-36144769 AATCTAGAAAAATATTTTCCTGG + Intergenic
929137204 2:38636649-38636671 ACTATAGATTTTTATTCTCCTGG + Intergenic
929202194 2:39247410-39247432 AAATTAGATTTTTTTTCTCCAGG - Intergenic
929259973 2:39855162-39855184 AAACTACAATTATATCCTCCTGG - Intergenic
931036560 2:58250858-58250880 AATCTGGATTTAGATTCCTCTGG - Intergenic
932888225 2:75566657-75566679 AATAGAGATTTAAATACTCCTGG + Intronic
935430090 2:102966622-102966644 AATCTACTTTTATTTTCTACTGG - Intergenic
937987274 2:127643741-127643763 AATCTAGATTCAGAGTCCCCAGG + Intronic
939224845 2:139352155-139352177 AAATTGGGTTTATATTCTCCTGG + Intergenic
941031132 2:160512740-160512762 AAACTGGATCTTTATTCTCCTGG - Intergenic
941172599 2:162157798-162157820 AATGTAGAAATTTATTCTCCAGG - Intergenic
941485992 2:166083390-166083412 TATCTACATTTGTATACTCCAGG + Intronic
941515514 2:166470894-166470916 AATATAGATTAATATTTACCTGG - Intronic
941850683 2:170177127-170177149 TACCTAGATTTATCTGCTCCAGG + Intergenic
942852214 2:180501460-180501482 TATTTAGATTTATATTGTCTTGG - Intergenic
943096255 2:183433194-183433216 AAGTTAGATTTGTATTCTTCAGG + Intergenic
943249892 2:185505521-185505543 CTTCTAGATTTGTATTCTCTTGG + Intergenic
943530985 2:189080030-189080052 AATTTACATTTTTATTCTCAGGG - Exonic
945137825 2:206647938-206647960 AATTTAGATTTATAATCTGATGG + Intergenic
948083393 2:235226238-235226260 AATCTTGGGTTATTTTCTCCAGG - Intergenic
1169362542 20:4963113-4963135 AATTGATATTTACATTCTCCAGG - Intronic
1169534213 20:6519887-6519909 ATCCCAGATTTATTTTCTCCTGG + Intergenic
1169831091 20:9826192-9826214 AATCTAGATTTTTTTTTTTCTGG + Intronic
1170356453 20:15497193-15497215 CATCTAGATTTATAATCGCCTGG - Intronic
1171490764 20:25515400-25515422 TATCTAGTTTTTTATTCTACAGG + Intronic
1173080427 20:39862031-39862053 AATCTGGATTTATGTTTTCTAGG - Intergenic
1174678608 20:52382186-52382208 AATCTATATCTATATTGACCTGG - Intergenic
1175797777 20:61783620-61783642 GAACTAGGCTTATATTCTCCTGG - Intronic
1177397057 21:20549996-20550018 AAGCTAGATGTATATTCTTGGGG - Intergenic
1178171622 21:30047606-30047628 AATCTAGATCTATACTTACCTGG + Intergenic
1179453545 21:41482144-41482166 AATGTTGATTTAGAGTCTCCTGG - Intronic
1182157697 22:28091309-28091331 TATCTAGATTAAAATTCACCAGG - Intronic
1183375295 22:37461139-37461161 AATGTAGATTTAAATTAGCCAGG + Intergenic
949742176 3:7248966-7248988 GATCTATATTTATTTTCTCCTGG - Intronic
950990549 3:17433581-17433603 AATATAGGTTTATAATCCCCAGG - Intronic
951008768 3:17651049-17651071 AATCTTGATTTTTCTTTTCCAGG - Intronic
951188756 3:19744887-19744909 AATCTAGCTTAACCTTCTCCTGG + Intergenic
952224646 3:31362904-31362926 AAACTAGATTTATTTTGTCATGG - Intergenic
952242014 3:31541215-31541237 ACTTTAGATTTATATTTTTCAGG - Intronic
955176688 3:56621446-56621468 AAACTAGAATTATATTCACTTGG - Intronic
955989755 3:64613689-64613711 ATTCTATATTTATAGTCTCTGGG + Intronic
956006957 3:64790554-64790576 AATCTTGATTTGTATTTTCCTGG - Intergenic
957645964 3:82927409-82927431 AATATAAATGTATATTCTCCAGG + Intergenic
957700525 3:83705049-83705071 ATTCAAGGTTTATATTGTCCAGG + Intergenic
958928397 3:100183690-100183712 CAGCTAGATATACATTCTCCAGG - Intergenic
959555059 3:107707377-107707399 ATTCACTATTTATATTCTCCAGG - Intronic
960766059 3:121131886-121131908 AATCTGGTTTCATGTTCTCCTGG - Intronic
961618378 3:128203057-128203079 CATGTAGATTTTTATTTTCCAGG + Intronic
962719937 3:138163858-138163880 AATCATGATTCATATTGTCCAGG - Exonic
963353709 3:144183880-144183902 ACTCTAGATTTATATTTGCAAGG - Intergenic
963641121 3:147862859-147862881 CATCTTGAATTATAATCTCCGGG - Intergenic
964111497 3:153092498-153092520 AATTTATATTTAGATTCTCAAGG + Intergenic
964579451 3:158216559-158216581 AAACTAGATTAATATTATCCCGG - Intronic
965178345 3:165365575-165365597 TCTTTAGCTTTATATTCTCCAGG + Intergenic
965312216 3:167143494-167143516 AATCTGCATCTATATTCTCTAGG + Intergenic
970299966 4:14670953-14670975 AATGTGGATTTAAATTCTGCTGG + Intergenic
970809166 4:20071356-20071378 AATATAAATTTATTTTCTCATGG - Intergenic
971395129 4:26220236-26220258 AATATAAATTTCTATGCTCCAGG - Intronic
972502124 4:39688044-39688066 AATCTGCATTTTTATTCTCCAGG - Intergenic
972805156 4:42522457-42522479 AATGTAGATTAATGTTCCCCTGG + Intronic
973123821 4:46558438-46558460 AATTTAGATTTCTAGTTTCCTGG - Intergenic
973865594 4:55109650-55109672 AATGTATATTGGTATTCTCCAGG - Intronic
974169565 4:58248537-58248559 CATTTAGATGTATATTCTCAAGG - Intergenic
976893112 4:90074884-90074906 AATATAGACTTATGTTTTCCGGG + Intergenic
977187003 4:93951390-93951412 AATCTGGTTTTACATTCTCCTGG - Intergenic
977291069 4:95164908-95164930 TATATAGGTTTATATTTTCCTGG + Exonic
977536959 4:98264403-98264425 AATATATATATATATTCTCATGG + Intronic
977540018 4:98305729-98305751 AATGGAGATTTATATCCTTCTGG - Intronic
978983891 4:114984617-114984639 AACTTATATTTATATTTTCCAGG + Intronic
979212146 4:118117841-118117863 AATCAAGATTTCTTTTCTGCTGG + Intronic
979747182 4:124231466-124231488 AATCAATATGTATTTTCTCCTGG - Intergenic
981561871 4:146056708-146056730 CAACTAGATTTATATTCCCTAGG + Intergenic
982407781 4:155039745-155039767 TATCTGGATTTTTATTCCCCAGG - Intergenic
983070622 4:163264034-163264056 AATCAGCATTTATTTTCTCCAGG - Intergenic
983304601 4:165970468-165970490 ACTCAATATTTATTTTCTCCTGG + Intronic
983700214 4:170582754-170582776 TATCTTGATATATATTCTGCAGG - Intergenic
984204693 4:176772501-176772523 TTTCTAGATTTGTTTTCTCCAGG - Intronic
986187883 5:5462134-5462156 AAATTAGATTTTAATTCTCCAGG + Exonic
986189366 5:5480148-5480170 AAGCTTGTTTTATATTCCCCAGG - Intronic
987677806 5:21097702-21097724 AATCAAGTTTTATCTTCTTCTGG + Intergenic
989725860 5:44585579-44585601 AATCTATTTTTATCTTCTCTCGG + Intergenic
989767221 5:45101972-45101994 CATCAAGATTCATATTCTTCAGG + Intergenic
990731581 5:58814542-58814564 AGACAAGATTTATATTGTCCTGG - Intronic
993010126 5:82471542-82471564 AAGATAGATTCATATTCTCATGG - Intergenic
993826813 5:92698686-92698708 AATCTAGATATATAATCTATTGG - Intergenic
994427866 5:99617174-99617196 AATCTAGTCTTAGATTCTTCAGG + Intergenic
994432092 5:99679364-99679386 ATTCTAGCTTTTTCTTCTCCAGG - Intergenic
995836044 5:116400442-116400464 ATTAGAGATTTATGTTCTCCTGG - Intronic
995848966 5:116524295-116524317 AATCAAAATTTATATTTCCCAGG - Intronic
996001801 5:118373274-118373296 AATCTAGAATTAAAATCTTCTGG + Intergenic
996253369 5:121367452-121367474 AATCCAGCTTTGTATTCTCAAGG + Intergenic
997878248 5:137568174-137568196 ACTCCAGATTCATTTTCTCCGGG + Intronic
998777821 5:145622435-145622457 AATCCTAAATTATATTCTCCAGG + Intronic
999945122 5:156587486-156587508 AATCAAGATTTATGCTCTCCTGG - Intronic
1000076920 5:157798225-157798247 TATCTAAATTTATATTCTAAAGG + Intronic
1001069404 5:168571494-168571516 AATATATATTTCTATTCTCTAGG + Intronic
1001209834 5:169800293-169800315 AATCTAGGGTTATATTCTCTTGG - Intronic
1003610437 6:7609411-7609433 AATCTAGATCCATATTAACCTGG + Exonic
1006858409 6:37152401-37152423 TATTTTGATTTATATTATCCTGG + Intergenic
1008684918 6:53914761-53914783 ACTCAAGCTTTATTTTCTCCAGG + Intronic
1009290687 6:61877501-61877523 ACTCTAAGTTTATATTCTCAGGG + Intronic
1009993658 6:70875620-70875642 AATTTAGAATTATTTTCTTCTGG + Intronic
1010624795 6:78124637-78124659 AAACAAGATTTATAGTTTCCTGG + Intergenic
1012660878 6:101889801-101889823 TATCTGGATGTATATTCTGCTGG + Exonic
1012826991 6:104158820-104158842 ACTATAGTTTTATATTCTCAAGG - Intergenic
1013283440 6:108660356-108660378 AATCAGGATATATAGTCTCCTGG + Intronic
1013702072 6:112784108-112784130 AAGCTACATTTATAGTATCCTGG + Intergenic
1013791000 6:113836428-113836450 AGACTAGATTTTTATTCTCTCGG + Intergenic
1013989862 6:116241223-116241245 AATAAAGATTATTATTCTCCAGG + Intronic
1014442355 6:121488258-121488280 AATTTTGATATATATTCTTCAGG - Intergenic
1014663705 6:124207927-124207949 ATTCTAGACTTGTATTCTGCAGG + Intronic
1015006800 6:128292527-128292549 ATTTTAGATTTATTTTCCCCAGG + Intronic
1017252345 6:152294170-152294192 AGTCTAGATTAATATGCTCTGGG + Intronic
1017689878 6:156953435-156953457 AAACTATTTTTATTTTCTCCTGG + Intronic
1018451260 6:163909883-163909905 TATATAGTTTTATATTCTTCAGG - Intergenic
1020769204 7:12366368-12366390 TTTGTAGATTTATATTCTCTTGG - Intronic
1020855512 7:13416581-13416603 AATATAAATTTATATTTGCCTGG - Intergenic
1020876779 7:13705975-13705997 AATCTTTATTTTTATACTCCAGG - Intergenic
1021456234 7:20832129-20832151 AGTTTAGCTTTGTATTCTCCTGG + Intergenic
1021578945 7:22132157-22132179 AATCAAGATTTTTATTCTGCTGG + Intronic
1022433151 7:30347800-30347822 AATCTAGATTTATATTCTCCAGG + Intronic
1024693625 7:51831655-51831677 AATATAAATTTATTTTCTCAAGG + Intergenic
1024806105 7:53142592-53142614 AATCTAGAGTTGTCTTCTTCTGG + Intergenic
1025641837 7:63380889-63380911 AATGTATATTTATATACTGCAGG + Intergenic
1028021547 7:85781652-85781674 AATATATCTTTATATTCCCCAGG - Intergenic
1029231259 7:99070946-99070968 AATATATATATATATTCTGCAGG + Intronic
1029890351 7:103922533-103922555 AATCCATATTTATAGTCTCCTGG - Intronic
1029905674 7:104091093-104091115 AATATATGTTTATATTTTCCAGG + Intergenic
1030373981 7:108733396-108733418 AATTTAGATTAATATTTTCCAGG - Intergenic
1030557049 7:111039502-111039524 AATTTAGTTTTTTATTTTCCAGG - Intronic
1031205794 7:118756073-118756095 AATCTCTATTTATATGCTCTAGG - Intergenic
1033506299 7:142004865-142004887 TAACTAGATTTAAAGTCTCCTGG + Intronic
1034015149 7:147575072-147575094 AGTATTGATTCATATTCTCCCGG + Intronic
1034487981 7:151378030-151378052 GATTTAGATATATTTTCTCCAGG + Exonic
1034564880 7:151905324-151905346 CTTATAGATTTTTATTCTCCTGG - Intergenic
1035248201 7:157579179-157579201 AATATTGATTTATGTTCTCACGG + Intronic
1037872443 8:22510997-22511019 AAAGTAGCTTCATATTCTCCTGG + Intronic
1038409538 8:27347453-27347475 AACGGAGATTTATTTTCTCCCGG + Intronic
1039581974 8:38674516-38674538 ATTCTAGATTTCTTGTCTCCAGG - Intergenic
1042468397 8:69155043-69155065 AATTTAGATTGATCTACTCCAGG - Intergenic
1043126064 8:76396980-76397002 AATGAATATTTATACTCTCCTGG + Intergenic
1043252139 8:78088239-78088261 AATCTAGAATTATACTTTGCAGG + Intergenic
1044275558 8:90295632-90295654 TGTCCAGATTTATATCCTCCTGG - Intergenic
1044340151 8:91037470-91037492 AATCTTAATTTATACTCTCAAGG + Intronic
1046291947 8:112173789-112173811 AAACTATATTTATATTTTACAGG + Intergenic
1048740139 8:137548349-137548371 ACTTTAGAGTTTTATTCTCCAGG - Intergenic
1048825049 8:138416151-138416173 AATTAAGATTTATTTTGTCCTGG - Intronic
1049912956 9:287421-287443 AATTAAGATTCATATCCTCCTGG + Intronic
1050948404 9:11556139-11556161 AATATATATATATATTTTCCTGG + Intergenic
1052834997 9:33243853-33243875 AATGTAGTTTTATATTTTCCTGG - Intronic
1053541336 9:38976915-38976937 AATATAGCTTTAAATTCTCTGGG - Intergenic
1053805757 9:41799960-41799982 AATATAGCTTTAAATTCTCTGGG - Intergenic
1054624802 9:67386993-67387015 AATATAGCTTTAAATTCTCTGGG + Intergenic
1054913149 9:70472537-70472559 AATATATATTTATATTTCCCAGG - Intergenic
1055209334 9:73770445-73770467 AAAATATATATATATTCTCCAGG + Intergenic
1058307229 9:103459102-103459124 AATCTGAGTTTTTATTCTCCTGG - Intergenic
1058404680 9:104659270-104659292 ATTCTAGCTTTACATTCTCTGGG + Intergenic
1058559865 9:106215232-106215254 AATCTGGATTTGAATTCTTCAGG + Intergenic
1186105108 X:6197147-6197169 TATCTAGATTAAAATTCTTCTGG + Intronic
1188234015 X:27704379-27704401 TATTTAGAATAATATTCTCCAGG - Intronic
1189148264 X:38677597-38677619 AATCCAACTTTATATTTTCCTGG + Intronic
1189274622 X:39776597-39776619 ATTCTAGATTTATTTCTTCCAGG + Intergenic
1189274630 X:39776721-39776743 ATTCTAGATTTATTTCTTCCAGG + Intergenic
1189274638 X:39776845-39776867 ATTCTAGATTTATTTCTTCCAGG + Intergenic
1190722487 X:53161631-53161653 AATTGAGAAATATATTCTCCTGG + Intergenic
1194426117 X:93740386-93740408 CATCTATATTTGTATGCTCCAGG - Intergenic
1195361729 X:104088834-104088856 TATTTATATTTATATTCTCTTGG + Intergenic
1195592844 X:106651696-106651718 AATAGAGATTTATATACTGCAGG + Intronic
1196350983 X:114729181-114729203 AATCAAGACTTAAATTATCCTGG + Intronic
1197055362 X:122112662-122112684 CATTTAGATTTATCTTCTGCAGG + Intergenic
1197476868 X:126936107-126936129 AATTTAAAATAATATTCTCCTGG - Intergenic
1197615332 X:128684164-128684186 AATCTAAAATTATATTTTCTTGG - Intergenic
1199499593 X:148495302-148495324 GCCCTAGATTTATAATCTCCAGG + Intergenic
1200828254 Y:7665392-7665414 AGTCTAGATTCATTTTCTGCCGG + Intergenic