ID: 1022434397

View in Genome Browser
Species Human (GRCh38)
Location 7:30366926-30366948
Sequence TTATTGTGCTTTGCATCTCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 4, 3: 20, 4: 222}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022434397 Original CRISPR TTATTGTGCTTTGCATCTCC AGG Exonic
904372702 1:30060122-30060144 TTAATGTTCCTTGCACCTCCAGG - Intergenic
904927886 1:34062780-34062802 TTCTGTTGCTTTGCTTCTCCAGG - Intronic
905568669 1:38986797-38986819 TTACTTTGCTTTGCATATCCAGG - Intergenic
907763544 1:57386228-57386250 TTATTTATCTTTGTATCTCCAGG - Intronic
911306355 1:96237393-96237415 TTATTGTGCTTTTCACCATCAGG - Intergenic
911925727 1:103830009-103830031 TTATTATACTTTTCAGCTCCAGG + Intergenic
912083630 1:105971775-105971797 TTATTGTGCATTGAAATTCCTGG - Intergenic
912134105 1:106638189-106638211 TTATTTTGTTTTGAATCTCTAGG + Intergenic
913119941 1:115730796-115730818 TTCTTGTCCCTTGCCTCTCCTGG + Intronic
914394923 1:147256630-147256652 TTTTAGTACTTTGCCTCTCCTGG + Intronic
914452232 1:147802805-147802827 TTATTTGTCTTTGCATTTCCAGG - Intergenic
917787872 1:178478495-178478517 TGATTTTGTTTTTCATCTCCAGG + Intronic
918671776 1:187226077-187226099 TTATTGTGCTTTTCCTGTACTGG + Intergenic
919582514 1:199394061-199394083 TTATTCTGCTCTCTATCTCCAGG + Intergenic
920813834 1:209312200-209312222 TAATTGTGCTCTGCCTCTACAGG + Intergenic
921950574 1:220925999-220926021 TTATTGACCATTGCATCCCCAGG + Intergenic
922138434 1:222856018-222856040 TTATTTGGCTTGGCAGCTCCAGG + Intergenic
924029387 1:239870947-239870969 ATTTTGTGCTTTACTTCTCCTGG + Intronic
1063093533 10:2889603-2889625 TTATGGTACTTTGCTTTTCCGGG + Intergenic
1063770185 10:9188957-9188979 TTATAGTGCTTTCCATCTTAGGG + Intergenic
1065113891 10:22465375-22465397 TTGTTGTGTTTTGCTTTTCCAGG - Intergenic
1067896744 10:50189997-50190019 TTAGTCTACTTTCCATCTCCAGG + Intronic
1067952227 10:50752036-50752058 TTAGTCTACTTTCCATCTCCAGG - Intronic
1068589758 10:58841381-58841403 ATATTCTGCTGTGCTTCTCCTGG + Intergenic
1069004330 10:63300295-63300317 TTATTGTGCTTTTGATAACCAGG - Intronic
1069536409 10:69256947-69256969 CTATAGTGCTTTGCATCTGTTGG + Intronic
1070017146 10:72544396-72544418 ATATTGTGATTTACTTCTCCTGG - Intronic
1071536041 10:86430930-86430952 TTTATGTCCTTTGCATTTCCAGG + Intergenic
1071935298 10:90523842-90523864 TCATTTTGCTATGCATTTCCTGG + Intergenic
1072300329 10:94054648-94054670 TTATAGTGCTTTACATCTATTGG + Intronic
1072675533 10:97462989-97463011 TTTTTTTTCCTTGCATCTCCAGG - Intronic
1072771314 10:98141533-98141555 TTATTGTGCTATGGATCTGTTGG + Intronic
1072848078 10:98855134-98855156 GTATGGTGCTTGGCATCACCTGG - Intronic
1073351041 10:102820043-102820065 TTTTTGTGCTTTTCAGCACCAGG - Intergenic
1073790217 10:106932610-106932632 TTATGGTGCTTTGTTTCTCTTGG - Intronic
1074245256 10:111684442-111684464 TTATTTTGCTTTGGATCCACTGG + Intergenic
1076826094 10:132970317-132970339 TTATTCTGCTTTGGATTTGCTGG + Intergenic
1079372384 11:19862679-19862701 CTATGGAGCTGTGCATCTCCAGG + Intronic
1080987298 11:37483988-37484010 TCACTGTGCTTTGCGTTTCCTGG - Intergenic
1081844905 11:46233332-46233354 TTCCTGTGCTTTGCAGCTTCTGG - Intergenic
1083376587 11:62228287-62228309 TTTTTATGGTTTGAATCTCCTGG + Intergenic
1086262031 11:84951742-84951764 TTATTTTAGTTTGCATATCCAGG + Intronic
1087979297 11:104591220-104591242 TTATTATGCTTTGGATCTCCAGG - Intergenic
1088107042 11:106219067-106219089 TTATTCATCTTTGTATCTCCGGG - Intergenic
1088632008 11:111782700-111782722 TTATTGTGTTTTGCATTTCCTGG - Intronic
1090166851 11:124558446-124558468 TTACTGTGGTCTTCATCTCCTGG - Intergenic
1090550111 11:127810049-127810071 TTATTGTGTTTTTCTTCTCAGGG - Intergenic
1092662266 12:10751236-10751258 TTATTGTGTTTTGTTTCTACAGG + Intergenic
1092864708 12:12750053-12750075 TTATTATGCTTTGTCTCTACCGG - Intronic
1092985259 12:13838843-13838865 TTATGCTGCTTTGCATCAGCAGG - Intronic
1093419289 12:18956242-18956264 TTATTCTCCATTGAATCTCCTGG + Intergenic
1093432720 12:19102418-19102440 TTATTGGTCTTTGTATGTCCTGG - Intergenic
1094118647 12:26945258-26945280 TTATTTTGCTCTTCTTCTCCAGG + Intronic
1094414120 12:30200655-30200677 GTAATTTGCTTGGCATCTCCCGG + Intergenic
1098504054 12:71227919-71227941 TTATTGTAGTTTTCACCTCCTGG - Intronic
1098676571 12:73296298-73296320 TTTTTGTGCTTTGCTTCTAATGG + Intergenic
1098773554 12:74585018-74585040 TAATTGTCCTTTGAGTCTCCAGG + Intergenic
1100856611 12:98762843-98762865 TCACTGGGCTTTGCATCTCTAGG + Intronic
1101484619 12:105141413-105141435 TTATTTAGCTTTGCTTCTACAGG + Intronic
1103013570 12:117476595-117476617 ATCCTGTGCTTTGCTTCTCCAGG - Exonic
1103216135 12:119202737-119202759 TTATTGTGCTTTTCAGCCCTTGG + Intronic
1103380949 12:120494096-120494118 TTAGTGTCATTTGCATTTCCAGG + Intronic
1105833308 13:24185039-24185061 GCATTGTGTTTTGCTTCTCCAGG + Intronic
1107161534 13:37234675-37234697 TTATTGTACTTTTCATCTCCAGG - Intergenic
1108802462 13:54116316-54116338 TTGTTCTCCATTGCATCTCCTGG - Intergenic
1108909981 13:55536544-55536566 TTATTGTGCTTTACTTGCCCAGG + Intergenic
1109511049 13:63374819-63374841 TTATTGTGCTAGGCAATTCCTGG + Intergenic
1111848696 13:93544029-93544051 TGATTTTGATTTGCATTTCCCGG + Intronic
1112544297 13:100349981-100350003 TTATTTTTCTTTGCCTTTCCTGG + Intronic
1113368893 13:109704975-109704997 ATTTTATGCTTTGCATTTCCCGG - Intergenic
1114760047 14:25303662-25303684 TTTTTGTGTTTTCCATTTCCTGG - Intergenic
1115710546 14:36046108-36046130 TTTTTGTGCATTGTATCTCCTGG - Intergenic
1116145622 14:41064286-41064308 TTATTGTGCTTGGTATTACCAGG + Intergenic
1117282999 14:54258700-54258722 TTATTCACCTTTGCATCCCCAGG - Intergenic
1119217254 14:72878537-72878559 TTACAGTGCTTTGCATCTTCTGG + Intronic
1119943969 14:78672360-78672382 TTATTTATCTTTGTATCTCCAGG + Intronic
1122916755 14:104862930-104862952 TGGTTTTGCTTTGCATTTCCTGG + Intergenic
1124383090 15:29184329-29184351 TCCTTGTTCTGTGCATCTCCTGG - Intronic
1128615172 15:69103225-69103247 TTATTGTGCTTTGCTTGTGCTGG + Intergenic
1129489885 15:75914379-75914401 TTATTGTACTTCTCATCTCAAGG + Intronic
1130188846 15:81712366-81712388 TTATTTTGTTTTGAATATCCAGG + Intergenic
1137630602 16:49941022-49941044 TTGTAGTGCTTTCCATCTCCAGG - Intergenic
1138640349 16:58380957-58380979 TCTTTTTGCTTTGCATTTCCTGG - Intronic
1139066909 16:63327514-63327536 GTAGTGTCCTTTGCATCACCTGG + Intergenic
1139620008 16:68131622-68131644 TGATTGTGCTTGGTATCTGCTGG - Intronic
1139949107 16:70660684-70660706 TTGCTTTGCTTTGCATCTTCAGG + Intergenic
1141566993 16:84909373-84909395 TTTTTGTGCTTTGCATGAACAGG + Exonic
1145081203 17:19895833-19895855 TTATTTTCCCCTGCATCTCCTGG + Intergenic
1145117571 17:20225567-20225589 TCATTGTGCTTTCCCTCCCCCGG + Intronic
1146415273 17:32626042-32626064 TTACTGTGCTGTGCACCTACGGG + Intronic
1147448612 17:40490135-40490157 TTCTTGAGCTATGGATCTCCTGG + Intronic
1148536771 17:48445580-48445602 TTCTTCTGCTTTGCATCCACAGG + Intergenic
1153518619 18:5930254-5930276 TTGTTGTGCTTTGTTTCCCCAGG - Intergenic
1156379216 18:36542270-36542292 TTAATGTGTTTTTCATCTCATGG + Intronic
1156658209 18:39312589-39312611 TTATGTTGCTTTGCACCTGCAGG - Intergenic
1157389282 18:47287894-47287916 TCTTTGTGCTTCTCATCTCCTGG - Intergenic
1157681888 18:49613865-49613887 TTATTAATCTTTGTATCTCCAGG - Intergenic
1157961922 18:52164115-52164137 TTATTGTACTCTTCAACTCCAGG + Intergenic
1158108893 18:53917749-53917771 TTGGTGTTCTCTGCATCTCCTGG + Intergenic
1158864124 18:61620627-61620649 TTATTCTGCCTTGCTACTCCTGG + Intergenic
1159677018 18:71297649-71297671 TTATTTATCTTTGCAACTCCAGG - Intergenic
1161622825 19:5308294-5308316 TTGTTTTAATTTGCATCTCCTGG + Intronic
1164998232 19:32739251-32739273 ATGGTGTTCTTTGCATCTCCTGG + Intronic
1165084050 19:33330343-33330365 TTTTTGTGCTTTTCTTCTCAAGG - Intergenic
926427552 2:12753154-12753176 TTTTTGGGCTTTGAGTCTCCAGG + Intergenic
928778717 2:34794724-34794746 TCTTTTTACTTTGCATCTCCAGG + Intergenic
929417986 2:41763044-41763066 TGATTGTGCTTTGGACCTACAGG + Intergenic
930872962 2:56185475-56185497 TTCCTGTGCTTTCCCTCTCCCGG + Intronic
931113910 2:59143935-59143957 TTATTTTGGTTTTCATCTTCAGG + Intergenic
933243178 2:79945698-79945720 TTATTTTACTATTCATCTCCAGG - Intronic
933672156 2:85018716-85018738 TTATTCAGCTTTGCCTCTCAAGG + Intronic
935158160 2:100502490-100502512 TTATTGTACTTTTGAACTCCAGG - Intergenic
935466442 2:103403898-103403920 TTATCGTTCATTGCATCTTCTGG + Intergenic
935545188 2:104393774-104393796 TTTTGATGCTTTGCATATCCAGG - Intergenic
935677836 2:105610919-105610941 TTCCTGTGCTTTCCGTCTCCAGG - Intergenic
937470424 2:122169601-122169623 TGATTGTGCTTTGCATCCTGTGG + Intergenic
937516693 2:122663656-122663678 TTATTGTCCATGGCATTTCCAGG + Intergenic
940596618 2:155801636-155801658 TTATTGTGCTTTGGATTTCTTGG - Intergenic
942735968 2:179112994-179113016 TTCTTGTTCTTAGCATCTTCAGG + Intronic
943828612 2:192428996-192429018 TTTTTTTGCTTTGCTTTTCCAGG - Intergenic
944318476 2:198308710-198308732 TTATTTTGCCTTGCATCTTTTGG + Intronic
944984570 2:205160689-205160711 TTATTGTGCTTAGTATATGCTGG + Intronic
946308341 2:218868840-218868862 TTATTTTCCTTTGCATCTCCTGG - Intronic
946752156 2:222903210-222903232 TTATCGCACTTTTCATCTCCTGG + Intronic
949076260 2:242060519-242060541 TGATTGTGTTTTTCATTTCCAGG - Intergenic
1171120342 20:22563133-22563155 TAAATGCGCTTTGCATATCCTGG + Intergenic
1172165316 20:32895233-32895255 TCATGGGGCTTAGCATCTCCCGG - Intronic
1174078018 20:47951651-47951673 TTATTGGGCTCTCCCTCTCCAGG - Intergenic
1174703511 20:52633400-52633422 TTAGCTTGCTTGGCATCTCCTGG + Intergenic
1175670847 20:60901574-60901596 TTGTTGTGCTTTGCTCATCCAGG + Intergenic
1175749496 20:61485473-61485495 TTCTTCAGCTGTGCATCTCCGGG - Intronic
1176702537 21:10072920-10072942 TGATTGTGCTTTGCTTCACTTGG - Intergenic
1178265495 21:31138909-31138931 TTTCTGGGCTTTGCACCTCCTGG + Intronic
1179032979 21:37736198-37736220 TTATTGGTCTTTGCATCCCCAGG - Intronic
1182064765 22:27422760-27422782 TTATTTACCTTTGCATCACCTGG - Intergenic
1182136708 22:27911603-27911625 TTATGTTTCTTTGGATCTCCAGG - Intronic
1184373103 22:44095191-44095213 TTCTGGTGCTTGGCATCTCGGGG - Intronic
952208747 3:31207446-31207468 TTAATTTGCATTGCATTTCCTGG + Intergenic
957104083 3:75864139-75864161 TTATTATGCTTTGCATGTTATGG + Intergenic
957339464 3:78875761-78875783 TGATTCTGCTTTTAATCTCCAGG - Intronic
959172218 3:102856908-102856930 TTATAGTGCTTTGCATATTCTGG + Intergenic
959403857 3:105936702-105936724 TTGTTGTGCTTTACTTCTGCTGG + Intergenic
961588537 3:127957307-127957329 ATATTGTGCTTAGCACCTCAGGG + Intronic
961936606 3:130591233-130591255 TCATTGTGCTTTGCTTCTGGTGG + Intronic
962842611 3:139249581-139249603 CTATTGTGCTTTGCATGTGAGGG + Intronic
963295368 3:143540278-143540300 TTATTCTGTTTTGCCTCTGCTGG - Intronic
963644695 3:147898951-147898973 TTATTTTTCTTTGCATCTCAGGG + Intergenic
964713583 3:159697502-159697524 TTATTCACCTCTGCATCTCCAGG + Intronic
968790830 4:2660148-2660170 TTATTGTGCTTTTCATGACAAGG + Intronic
969838363 4:9861763-9861785 TTATTCATCTTTGCATCCCCTGG + Intronic
970841401 4:20475385-20475407 CTATAGTGCTTTTCATCTGCTGG + Intronic
971025816 4:22587299-22587321 TTATTTTGTTTTGAATATCCAGG - Intergenic
972721146 4:41700284-41700306 TTATTGTGTGTCTCATCTCCAGG - Intergenic
974496717 4:62638736-62638758 TTATTTTTCTTTACATCTCCAGG - Intergenic
974605892 4:64148835-64148857 TTATTATGCTTGGCATCTTATGG - Intergenic
974803749 4:66853728-66853750 TTATCTTGCTCTGGATCTCCTGG - Intergenic
979800776 4:124906077-124906099 TAACTGTCCTTTGTATCTCCTGG + Intergenic
980374710 4:131929339-131929361 TGATTGTGCTTTGCTTCACTTGG - Intergenic
982729576 4:158941688-158941710 TTATTGTGCTTTAAATCTCTTGG + Intronic
983498909 4:168477711-168477733 ATATTTTGCTTTGCATCACCTGG - Intronic
983930597 4:173449449-173449471 TTTTTTTGGTTTGTATCTCCTGG + Intergenic
984192118 4:176618641-176618663 CTATTTGGCTTTGCATATCCAGG + Intergenic
984774109 4:183465959-183465981 TTAATGTGAATTGTATCTCCCGG + Intergenic
985306646 4:188549452-188549474 TTTTTGTTCTTTGTAACTCCTGG - Intergenic
985343475 4:188975808-188975830 TTAGTGTACTTTGCATTTCATGG + Intergenic
986486146 5:8239945-8239967 CTATTTTTCTTTGCATCCCCAGG + Intergenic
991059008 5:62351466-62351488 TCATTATGCTTTTCATGTCCTGG - Intronic
991214550 5:64147672-64147694 TTCATGTGCTTTACATCTCAGGG + Intergenic
991904232 5:71492462-71492484 TTGTTTTGATTTGCATTTCCCGG + Intronic
993950392 5:94167772-94167794 TTAATGTCCTTTGCATTTCATGG - Intronic
994651586 5:102535655-102535677 TTATCTTTCTTTGCATCTGCTGG + Intergenic
994909657 5:105886315-105886337 ACATTGTTCTTTGCATGTCCAGG - Intergenic
995439765 5:112177228-112177250 TTCTTGTGTTTTCCATCTTCTGG + Intronic
996295988 5:121917119-121917141 TTATTGCATTTTGCATTTCCAGG - Intergenic
996411941 5:123167943-123167965 TCCCTGTGCTTTGCCTCTCCTGG + Intronic
1001201429 5:169721054-169721076 TTTTTGTGTTTTCCATCTACTGG + Intronic
1003822863 6:9919456-9919478 TTATTGTGCTTTGCAAATAATGG + Intronic
1003861826 6:10329442-10329464 TTATTGATCTTTGCACCTCCTGG + Intergenic
1004971813 6:20918922-20918944 ATATTGTGCTTATCATATCCTGG + Intronic
1008047434 6:46865597-46865619 TTATTTATCTTTCCATCTCCTGG + Intronic
1008086149 6:47246545-47246567 ATATTGAACTTTGAATCTCCAGG - Intronic
1008969728 6:57353211-57353233 TTACAGTGCTTTGTATCTACAGG - Intronic
1009023637 6:57971763-57971785 TTATTATGCATTGCATATCAGGG + Intergenic
1009053000 6:58300845-58300867 TTTTTGTTCTTTGCTTCTACTGG - Intergenic
1009158694 6:60255036-60255058 TTACAGTGCTTTGTATCTACAGG - Intergenic
1009199210 6:60723316-60723338 TTATTATGCATTGCATATCAGGG + Intergenic
1009238112 6:61149715-61149737 TTTTTGTTCTTTGCTTCTACTGG + Intergenic
1009759024 6:67979649-67979671 TAATGATGCTTTGCATCTGCAGG + Intergenic
1009898420 6:69781631-69781653 TTATTGTGCTTTGGATATCAAGG - Intronic
1010380263 6:75215875-75215897 TTTTTGTCCTTTGCTTCTTCTGG - Intergenic
1011284085 6:85705631-85705653 CTTTTGGGCTTTGCAGCTCCTGG - Intergenic
1011338522 6:86286330-86286352 TTACTGTGCATTGAATCCCCTGG + Intergenic
1011917269 6:92522883-92522905 CTATTGTGCTTTTCAATTCCAGG + Intergenic
1012911318 6:105121115-105121137 TTTTTGGGCTTTGCAACACCAGG + Intronic
1013498765 6:110726075-110726097 TTATTGTTCTTTGAAGCTACTGG - Intronic
1016320198 6:142834631-142834653 TAATATTGCTTTGCATGTCCTGG - Intronic
1018530426 6:164757439-164757461 TAATTGTACTATGCATTTCCAGG + Intergenic
1019375197 7:687228-687250 GTATTGTCTTTTGCTTCTCCTGG - Intronic
1019743506 7:2687567-2687589 TTAGAGTCCTTTCCATCTCCTGG + Intronic
1020452924 7:8340361-8340383 TTATGGTTCTTTGTTTCTCCAGG + Intergenic
1022434397 7:30366926-30366948 TTATTGTGCTTTGCATCTCCAGG + Exonic
1027623162 7:80517935-80517957 TTATTGTGCTTTGCAAATATGGG - Intronic
1030443741 7:109623212-109623234 TTATTGTAATTTTCAACTCCAGG + Intergenic
1030463616 7:109872331-109872353 TTATTTTACTTTCCATTTCCGGG + Intergenic
1033134739 7:138775046-138775068 TGAATGAGCTTTGCTTCTCCAGG + Intronic
1033615836 7:143013228-143013250 TCATGGTGCTTTGGATCTCTGGG + Intergenic
1033645911 7:143303987-143304009 TTATTGTGCTTTGCAGGTACAGG + Intronic
1034094506 7:148394674-148394696 TTAATGTGCTTAGAATCACCTGG + Intronic
1034210758 7:149359976-149359998 TTATTTTGCTTTGCAGATACTGG + Intergenic
1035003439 7:155636145-155636167 TTATTGTTCTTTTCCTCTCTAGG + Intronic
1035648256 8:1245014-1245036 GTATTTTGATTTGCATTTCCTGG - Intergenic
1038590138 8:28830025-28830047 TTCTTGTGCTTTGCCTGTCCAGG - Intronic
1039361627 8:36883462-36883484 TTGTTGTGCTTTGCCTTTTCTGG + Intronic
1039702635 8:39978216-39978238 TTGTTGTCCTTTTAATCTCCAGG - Intronic
1041796967 8:61755349-61755371 TTATTGTGAATTGCGTATCCTGG - Intergenic
1042794323 8:72643989-72644011 TTATAGTGCTTTGCAACATCTGG + Intronic
1043177028 8:77034393-77034415 TGACTGTGCTTTGCATATCAGGG - Intergenic
1044379161 8:91513033-91513055 TTAGTGTACTCTGCACCTCCAGG - Intergenic
1045856911 8:106774874-106774896 TGGTTTTGGTTTGCATCTCCTGG + Intergenic
1046354142 8:113056879-113056901 TTATTGGGCTTTACATAGCCTGG + Intronic
1046584147 8:116130759-116130781 TTATTGGGTGTTGCATCTCCTGG - Intergenic
1046851440 8:118977877-118977899 TTATTGTACTGAGCATCTACAGG + Intergenic
1048177482 8:132165703-132165725 TTATTTTGCATTGTATCTCTGGG - Intronic
1053380441 9:37644956-37644978 TCATTCTGCTTTGCATCTGCTGG - Intronic
1053639737 9:40059637-40059659 TGATTGTGCTTTGCTTCACTTGG - Intergenic
1053766396 9:41405798-41405820 TGATTGTGCTTTGCTTCACTTGG + Intergenic
1053899432 9:42778804-42778826 TAATTGACCTTTCCATCTCCAGG - Intergenic
1054320486 9:63655974-63655996 TGATTGTGCTTTGCTTCACTTGG - Intergenic
1054545012 9:66316978-66317000 TGATTGTGCTTTGCTTCACTTGG + Intergenic
1055090182 9:72356456-72356478 TTATCCTGCGTTGCATCTACAGG - Intronic
1055198888 9:73631974-73631996 TTTTTGTTCTCTGCATCTACAGG + Intergenic
1055910053 9:81339721-81339743 ATATTCTCCTTTCCATCTCCTGG - Intergenic
1060001243 9:119960554-119960576 TTATTGTTCTTTGCTTCTCTCGG - Intergenic
1062503822 9:136862761-136862783 TTCTGGAGCTTTGCTTCTCCAGG - Intronic
1202787555 9_KI270719v1_random:43012-43034 TGATTGTGCTTTGCTTCACTTGG - Intergenic
1185865889 X:3623636-3623658 TTATAGGGCTTTGCATCTTCAGG - Intronic
1188265818 X:28072714-28072736 TCATTCTACTTTCCATCTCCAGG - Intergenic
1188512804 X:30954898-30954920 TTTTTGTGCTTTGTTTCTCATGG - Intronic
1189145081 X:38647549-38647571 TCATTGTGTTTTACATTTCCAGG - Intronic
1189176628 X:38963853-38963875 TTATTTTCTGTTGCATCTCCAGG + Intergenic
1191591207 X:62887539-62887561 ATATTGTGTTTTGCATCTGGAGG - Intergenic
1192715245 X:73633851-73633873 TCATTGTGATTTTCAGCTCCAGG + Intronic
1194660011 X:96620681-96620703 TTCTTGTGCATGGCATCTGCAGG - Intergenic
1196249394 X:113441615-113441637 TTATTGTATTTTTCAACTCCAGG - Intergenic
1197234613 X:124045864-124045886 TTGGTGTGCGTTGCCTCTCCAGG + Intronic
1200716100 Y:6546216-6546238 TTAATGTGCTTTGTCTCTGCCGG - Intergenic
1201509425 Y:14742083-14742105 TTATTTTTCTCTGCATTTCCAGG - Intronic