ID: 1022441003

View in Genome Browser
Species Human (GRCh38)
Location 7:30433303-30433325
Sequence TTGGAGCCTGGCTGTTTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 262}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022441003_1022441009 3 Left 1022441003 7:30433303-30433325 CCCAGAAAACAGCCAGGCTCCAA 0: 1
1: 0
2: 1
3: 18
4: 262
Right 1022441009 7:30433329-30433351 CAGCCTGTCAGCCCCACAGAAGG 0: 1
1: 0
2: 3
3: 26
4: 275
1022441003_1022441011 10 Left 1022441003 7:30433303-30433325 CCCAGAAAACAGCCAGGCTCCAA 0: 1
1: 0
2: 1
3: 18
4: 262
Right 1022441011 7:30433336-30433358 TCAGCCCCACAGAAGGTCAATGG 0: 1
1: 1
2: 1
3: 14
4: 172
1022441003_1022441012 11 Left 1022441003 7:30433303-30433325 CCCAGAAAACAGCCAGGCTCCAA 0: 1
1: 0
2: 1
3: 18
4: 262
Right 1022441012 7:30433337-30433359 CAGCCCCACAGAAGGTCAATGGG 0: 1
1: 0
2: 1
3: 9
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022441003 Original CRISPR TTGGAGCCTGGCTGTTTTCT GGG (reversed) Intronic
900567126 1:3339030-3339052 TTGGAGCCCTGCTGCTGTCTGGG + Intronic
901450379 1:9333058-9333080 TTGGACCCTGGGGGTTTGCTGGG - Intronic
901909896 1:12448212-12448234 TGAGAGCCTGTGTGTTTTCTTGG + Intronic
902838208 1:19060040-19060062 CTGGAGCCTGGGTGAGTTCTGGG - Intergenic
902953380 1:19906101-19906123 TTAGAGCCTGTTTCTTTTCTGGG + Intronic
904526280 1:31136221-31136243 TTGGAGCCTGGGGTTTTTATGGG - Intergenic
907149102 1:52266021-52266043 TTGGAGCCTGGTTTCTTTATAGG - Intronic
908114008 1:60923774-60923796 CCGGAGCCTGGCTGTGTTCTGGG + Intronic
912163775 1:107018200-107018222 TTGGAGCCGGTATGTGTTCTTGG - Intergenic
912245679 1:107959627-107959649 TTGGAGCATGCCTGTTCTCGAGG - Intronic
912703015 1:111892516-111892538 TGAGTGCCAGGCTGTTTTCTGGG + Intronic
912955747 1:114153341-114153363 TGGGAGCCTGGCTGTCTGCGGGG + Intronic
915278200 1:154804131-154804153 GAAGAGACTGGCTGTTTTCTTGG + Intronic
915924608 1:160006279-160006301 ATGGAGTCTGGCTGTTTCCCAGG + Intergenic
918967040 1:191364253-191364275 TAATAGCCTGGCTGTTTTCTCGG + Intergenic
919429157 1:197471395-197471417 TGGGAGCTTATCTGTTTTCTGGG + Intronic
920201230 1:204261057-204261079 ATGGAACCTGGCTTTTCTCTTGG + Intronic
920398864 1:205664765-205664787 TGGGCGCCTGGCTGATTCCTAGG - Exonic
921254773 1:213329454-213329476 TTGGAGAATGGCAGTTGTCTTGG + Intergenic
921328339 1:214010424-214010446 TTGGAGTCTGGATGTTCTCATGG + Intronic
922403174 1:225282281-225282303 TTTGGGCCTGGCTGTGGTCTGGG + Intronic
922786141 1:228283255-228283277 ATGGAGGCTGGCTGTGCTCTTGG - Exonic
923435458 1:233963889-233963911 CTGGAGCCTAGTTTTTTTCTGGG + Intronic
923629559 1:235640884-235640906 TCACAGCCTGGCTGTTTTGTGGG - Intronic
923637005 1:235708435-235708457 TTGGCTCTTGGCTGTTGTCTGGG + Intronic
1063208008 10:3853339-3853361 TTGCAGCCAGGCTGCTTTCGTGG + Intergenic
1065287479 10:24200234-24200256 ATGGGGCCTCGCTGTTTCCTAGG + Intronic
1066259120 10:33711714-33711736 ATGGAGTCTGGCTGTTGTCCAGG - Intergenic
1067008827 10:42691145-42691167 CTGGAGCCTGGCTCCTTCCTTGG + Intergenic
1067345187 10:45433196-45433218 TTGCAGCCTGGCAGTGTTCACGG + Intronic
1068661655 10:59628912-59628934 TGGGAGACTGGCTGTGGTCTGGG - Intergenic
1070483961 10:76912061-76912083 CTGGACCCTGGCTGGTCTCTTGG - Intronic
1070626219 10:78053281-78053303 GCAGAGCCTGGCTGCTTTCTAGG + Intronic
1070703684 10:78621861-78621883 TGGGTGCCTGGCTGTTTGCTGGG + Intergenic
1070743707 10:78919843-78919865 TTGAAGCCTGGCTGTGATCTTGG - Intergenic
1074427100 10:113361082-113361104 TTGTAGCCAGGCTTTTTCCTGGG + Intergenic
1074550759 10:114440024-114440046 TTGGAACATGGCTGTTCTATCGG + Intronic
1074823269 10:117197383-117197405 CTGGAGCCTGGCTGTTCTCCGGG + Intergenic
1075005949 10:118830253-118830275 AGGGAGACTGGCTGTTTTCCTGG - Intergenic
1075595552 10:123726650-123726672 TGGCAGCCTGGCTGATTTCAAGG + Intronic
1076016281 10:127029830-127029852 CTGAACCCTGGCTGTTTTCCTGG + Intronic
1077320219 11:1937662-1937684 TTGGAGTTTCGATGTTTTCTGGG + Intronic
1080448653 11:32360420-32360442 GTGGAGACTGGCTGCTTACTGGG - Intergenic
1081393280 11:42555338-42555360 ATAGAGCCTGGCTGATTACTAGG + Intergenic
1083706503 11:64520058-64520080 TTGGAGACTGCCGGTTTTGTTGG - Intergenic
1084496392 11:69506180-69506202 TTGGTGACTGGCTGCTTTCAGGG + Intergenic
1086461884 11:87014090-87014112 TGGGAGCTTGGCTTTTTTCCAGG - Intergenic
1086962338 11:92991143-92991165 TTGGCCCTTGGCTGTTATCTGGG - Intergenic
1086962397 11:92992025-92992047 TTGGCCCTTGGCTGTTATCTGGG - Intergenic
1087933820 11:104007597-104007619 TTGGTTCCTGGCTGTCTTATGGG - Intronic
1088240967 11:107773324-107773346 TTGGAGTCTGGTTGATTGCTTGG - Intergenic
1089098377 11:115938743-115938765 TTGGTGCCAGGCTCTTTCCTAGG - Intergenic
1089739252 11:120571111-120571133 CTGGTGCCCGGCTGTTTTCCTGG + Intronic
1089749810 11:120642952-120642974 GTGGAGGCTGGGTGTATTCTGGG - Intronic
1090732455 11:129583448-129583470 CAGGAGCCTGGGTGTTTGCTGGG + Intergenic
1091170718 11:133517646-133517668 TTGGAGCCAGGCTGACTCCTGGG + Intronic
1092463756 12:8710010-8710032 ATGGAGTCTTGCTGTTTTCCAGG + Intronic
1093230101 12:16533467-16533489 ATTGAGCCTTGCTTTTTTCTCGG + Intronic
1093310563 12:17577301-17577323 TTGGAGCATGTCTATTTTATAGG - Intergenic
1094063887 12:26342921-26342943 TAGGAGCCTGGATGGGTTCTCGG + Intronic
1096247876 12:50004741-50004763 TTGTTGCCTGGTTGTTTTATGGG - Intronic
1097359867 12:58646868-58646890 TTGTAGCCAGGCACTTTTCTTGG + Intronic
1097938342 12:65278367-65278389 TGGGCGCTTGGCTGTGTTCTGGG + Intergenic
1101281685 12:103263902-103263924 CTGGAACCTGGCTGATGTCTGGG + Intronic
1101984539 12:109435474-109435496 CTGCAGCCTGGGTGTTTGCTGGG + Intronic
1104534453 12:129605883-129605905 CAGGTTCCTGGCTGTTTTCTTGG - Intronic
1107699128 13:43030158-43030180 TTGGAGACTGCCTGTGTTATTGG - Intronic
1108492347 13:50994131-50994153 TCACAGCCTGGCTGTGTTCTGGG + Intergenic
1110552307 13:76823527-76823549 ATTGAGCCTGGTTCTTTTCTGGG - Intergenic
1111945114 13:94656928-94656950 TTGCATCCTTGCTGTTTTCAAGG + Intergenic
1113472425 13:110556361-110556383 CTGGAGCCTGCCTGATTTCCTGG - Intronic
1114295570 14:21326101-21326123 TTAGAGCCTGGCTCGTATCTTGG + Exonic
1115479283 14:33845654-33845676 TTGGTGCCTGGCTTTTTTGCAGG + Intergenic
1115648081 14:35384098-35384120 GTGGAGGCTGGCTGTATTTTGGG + Intergenic
1116251891 14:42496344-42496366 TTGGAGGCTGTTTGTTATCTGGG - Intergenic
1118495587 14:66305294-66305316 TGAGAGCCTGGATGTTTTCATGG - Intergenic
1119057839 14:71441362-71441384 TAGGAAGCTGGCTCTTTTCTGGG - Intronic
1119637920 14:76291827-76291849 TTTGGTCCAGGCTGTTTTCTGGG + Intergenic
1125251722 15:37712824-37712846 ATGCAGCCTGGCTCTTTGCTAGG - Intergenic
1125615136 15:41004579-41004601 GTGGAGCCTGGCTTTCTCCTTGG + Intronic
1127862587 15:63006825-63006847 TGGGAGCCTGTCTGTGTGCTAGG - Intergenic
1129261488 15:74370596-74370618 ATGGAGCCTGGCATTTTGCTGGG - Intergenic
1132624886 16:886958-886980 TTGTCTCCTGGCTGTTTTATTGG - Intronic
1132655476 16:1040270-1040292 CTTGGGCCTGGCTGTTCTCTTGG - Intergenic
1134081738 16:11329397-11329419 TTGGAGGCAGGCTGATTTCAGGG + Intronic
1135772335 16:25227047-25227069 TTGGTGCCTGGGTGTTTGCAGGG + Exonic
1137457400 16:48628503-48628525 GTGGGGCCTGGCTGTTTTCAAGG - Intergenic
1141449919 16:84092133-84092155 TGGGAGCTTGGGTGTTATCTAGG - Intronic
1141611259 16:85182322-85182344 CTGGAGCCTGCCTGGTTTCTTGG - Intronic
1141838733 16:86560279-86560301 TTTGAGCCTGGCTTATTCCTTGG + Intergenic
1141981043 16:87550704-87550726 ATGGGGCCTGGCTGAGTTCTGGG + Intergenic
1144095249 17:11894510-11894532 TGAGAGCTTGGCTTTTTTCTAGG - Intronic
1144961713 17:19047935-19047957 TTGGAGCCTGGATGGATCCTTGG - Intergenic
1144973448 17:19126589-19126611 TTGGAGCCTGGATGGATCCTTGG + Intergenic
1145781692 17:27567910-27567932 TTGGAGCCTGCCTTTGATCTCGG + Intronic
1145901577 17:28493728-28493750 CGGGAGCCGGGCTTTTTTCTTGG + Exonic
1147381105 17:40056772-40056794 AGGGAGCCTGGCAGATTTCTAGG + Intronic
1149053164 17:52330904-52330926 TTGAAGCCTGGCTTTGTCCTTGG + Intergenic
1149534063 17:57418540-57418562 TTGGGGTCTTGCTTTTTTCTTGG + Intronic
1149616640 17:58006671-58006693 TGGGAGCCTGGCGTGTTTCTGGG - Intronic
1150125282 17:62630981-62631003 TGGGATCCTGGCTCTCTTCTGGG + Intronic
1153968515 18:10203477-10203499 TTAGAGCCTGGCTTTTTCCTTGG + Intergenic
1156827248 18:41445881-41445903 TTGGACCTTGGCTTTTTTCACGG + Intergenic
1157247737 18:46069274-46069296 TTGTGGCCTGGCTGTTTCCCTGG + Intronic
1157324282 18:46657588-46657610 TGGGAGCCTGGCTGATTCCGGGG - Intergenic
1157691067 18:49682324-49682346 TTGCAGCCTGTCTGTTCTGTGGG - Intergenic
1158112219 18:53952943-53952965 TTGAAGCCTCTCTCTTTTCTTGG - Intergenic
1158529058 18:58241736-58241758 CTGGAACCTGTCTCTTTTCTTGG + Intronic
1159278260 18:66249424-66249446 CTGGTGCCTGGTTGTTTTCCTGG + Intergenic
1160990905 19:1859959-1859981 TTGGGGCCTGATCGTTTTCTGGG - Intronic
1162158554 19:8696130-8696152 TGGGAGGCTGGCTCTTTCCTGGG + Intergenic
1162494248 19:11014256-11014278 ATGGGGCCTGGCTGTCTTATAGG - Intronic
1164936864 19:32222122-32222144 TTGGAGGCTGGCAGTTTTGATGG - Intergenic
1167746959 19:51357422-51357444 TTGAAACCTGGCTGTTTTGGAGG + Intronic
1167900505 19:52618283-52618305 ATGGAGCCTGGCTGTCTCCCAGG + Intronic
925807405 2:7664500-7664522 TAGGTGCCAGGCTGTATTCTAGG - Intergenic
927253248 2:21017498-21017520 TTGGAGCCACGCTGAGTTCTGGG + Intronic
929882224 2:45847026-45847048 TTGGTACCTGGCTCTGTTCTTGG - Intronic
930794154 2:55370049-55370071 TTGGATCCTTCCTCTTTTCTTGG + Intronic
931075770 2:58709960-58709982 TTGGACACTGACTGTCTTCTTGG + Intergenic
931761532 2:65421532-65421554 TTGTAGCCTTGCTGTTTTGTGGG - Intronic
932376803 2:71243692-71243714 TTGGAACCTGGAAGTATTCTTGG - Intergenic
932585580 2:73026007-73026029 TGGGAGCCTTTCTGTTTTCCTGG - Intronic
932885168 2:75542795-75542817 TTGGAGTTTGGCTGGTTTGTAGG + Intronic
932922771 2:75936165-75936187 TTGGTGCCTGGTTCATTTCTGGG + Intergenic
933203303 2:79476390-79476412 TTGCAGCCTGGCTATTTCATCGG + Intronic
933370256 2:81406240-81406262 TTTGAGTCTGGCTTTTTTCATGG + Intergenic
933378352 2:81510974-81510996 TTCTAGGATGGCTGTTTTCTGGG - Intergenic
934174383 2:89566215-89566237 ATTGATGCTGGCTGTTTTCTGGG + Intergenic
934284699 2:91640565-91640587 ATTGATGCTGGCTGTTTTCTGGG + Intergenic
935234992 2:101130778-101130800 TAGGAGCCTGGCTCTTTCCCAGG - Intronic
935734829 2:106098114-106098136 TTGGAGGGTGTCTGTTGTCTGGG - Intronic
935816576 2:106851942-106851964 CTGCAGACTGGATGTTTTCTTGG - Intronic
939642672 2:144659917-144659939 TTGGAGCCTCGCGGTGTTCTGGG + Intergenic
942298857 2:174542789-174542811 TTGAAGCCTGGGTGTTTTCTGGG + Intergenic
945130994 2:206571930-206571952 TATTAGCCTGGCAGTTTTCTAGG + Intronic
946030526 2:216700266-216700288 TTGGAGCCCTTCTGTCTTCTTGG + Intergenic
947959182 2:234220605-234220627 TTGGGGCCTGGCTGGTCTCTTGG + Intergenic
1169255029 20:4090769-4090791 TTGGTGCCTGCGTGATTTCTGGG - Intergenic
1169461815 20:5802136-5802158 TTGGATCCTGGCAGCTTCCTGGG - Intronic
1172264604 20:33600215-33600237 ATGGAGTCTTGCTGTTTTCCAGG + Intronic
1172299400 20:33838644-33838666 CTGCAGCCTGGCTGGTGTCTAGG + Intronic
1173164340 20:40676038-40676060 TTGAAGCATTGCTCTTTTCTGGG + Intergenic
1175861192 20:62151293-62151315 TTGGTGCCTGGCTGTGCCCTGGG + Intronic
1176013517 20:62914292-62914314 TGTGAGCCTGGCTGTCTGCTTGG - Exonic
1176257452 20:64159685-64159707 ATGGAGCCCGGCTGTCCTCTGGG - Intronic
1177383521 21:20377494-20377516 ATACAGCCTGGCTGTTTACTGGG - Intergenic
1178034571 21:28565042-28565064 TTGGAGCCTTTGGGTTTTCTAGG - Intergenic
1181469720 22:23130598-23130620 TTCAAACCAGGCTGTTTTCTTGG - Intronic
1181510034 22:23385009-23385031 TTGGAGCCAGGCTGTGGGCTGGG - Intergenic
1181882172 22:25989829-25989851 TTTGCACCTAGCTGTTTTCTAGG + Intronic
1181928041 22:26376163-26376185 TAGGTGCCAGGCAGTTTTCTCGG + Intronic
1182766254 22:32760206-32760228 TTGGTGCGTGGCTGTTGGCTGGG - Intronic
1183578499 22:38707531-38707553 TTGTAACCTGGATGTTTCCTGGG - Intronic
1184853262 22:47132783-47132805 TTGAAGGCGGGCTGTTTGCTGGG + Intronic
1184874856 22:47267928-47267950 TTGGAGCCTTGGTGTTTGCCAGG + Intergenic
950606144 3:14082614-14082636 TAGGAGCCTGGCTGTTCTTCAGG + Intronic
950966471 3:17150125-17150147 TTGGCTCCAGGCTCTTTTCTGGG - Intergenic
951380305 3:21976026-21976048 TTAGAGCCTGAGTGTTTGCTAGG - Intronic
951678514 3:25269602-25269624 TTGAAGACTAGCTATTTTCTAGG - Intronic
951848598 3:27113001-27113023 TTGAAGCCTGACTTATTTCTTGG + Intronic
951938220 3:28047446-28047468 TTGGGGTCTGGAAGTTTTCTTGG - Intergenic
952260195 3:31732695-31732717 TTGGAGCCTGGCTGATCACCAGG + Intronic
953070952 3:39518945-39518967 TGGGAGCCAGGCTGGCTTCTAGG + Intronic
954195883 3:48996968-48996990 TGGGAGCCTGTCTGTCCTCTTGG + Intronic
954689178 3:52386749-52386771 TTGGTGCCTGGCTTTTCTCCAGG - Exonic
955337510 3:58098977-58098999 TTGGGCCCTGACTGTTTTCCTGG - Intronic
956860615 3:73320276-73320298 TGTGGGCCAGGCTGTTTTCTTGG + Intergenic
960698746 3:120420255-120420277 TTGGCACATGGATGTTTTCTAGG + Intronic
960977832 3:123193605-123193627 TTGGAGCCTGGCCTTTGTTTTGG + Intronic
961909981 3:130304357-130304379 ATGGAACCTGACTGTCTTCTTGG + Intergenic
962607575 3:137045258-137045280 CTGGAGTCTTGCTGTTTTGTGGG + Intergenic
965680987 3:171251158-171251180 TTGGAACCTGCCTGTGGTCTGGG + Intronic
965681451 3:171256137-171256159 TTTGAGCATGGCTGTTGTTTCGG + Intronic
965822486 3:172698760-172698782 TGCAAGCCTCGCTGTTTTCTGGG - Intronic
966243917 3:177784836-177784858 TTTTACCCTGCCTGTTTTCTTGG - Intergenic
967602894 3:191410587-191410609 TTGCAGATTGGCTCTTTTCTAGG + Intergenic
968546197 4:1200269-1200291 GTGGAGCCTGCCTGGTCTCTGGG - Intronic
970457728 4:16242007-16242029 TTGGTACCAGGCTGTTTTATTGG - Intergenic
972366783 4:38383359-38383381 TTGGAGCCTAGCAGTTTACAAGG + Intergenic
972759917 4:42093008-42093030 ATGGAGTCTGGCTGTCTTCCAGG + Intergenic
973095891 4:46199267-46199289 TTGAAGCCTGGCTGGCTTGTTGG - Intergenic
974087853 4:57279929-57279951 TTGGAGAGTGGCTTTTTCCTAGG + Intergenic
981092645 4:140747598-140747620 TTGGAGCCTGTCTTTTTTTCAGG - Intronic
981691184 4:147511165-147511187 TAGAAGCCAGGCTGTCTTCTAGG - Intronic
986191437 5:5499761-5499783 CTGGAGCCTGCCTTTTTCCTGGG + Intergenic
986600815 5:9470744-9470766 TGGGAGGCAGGCTGATTTCTGGG - Intronic
987588839 5:19895965-19895987 TTGAAGCATGGATGTTTTCTGGG - Intronic
991472988 5:66989209-66989231 TTGGATCCTGCCTCTTCTCTAGG + Intronic
992342929 5:75844752-75844774 GTTGATGCTGGCTGTTTTCTGGG + Intergenic
992617069 5:78555136-78555158 TTGAAGACTTGATGTTTTCTTGG - Intronic
992741026 5:79773847-79773869 TTGAAGCCTGCTTGTTTTATCGG - Intronic
993854013 5:93049799-93049821 TTGGAGCCAGGCTGTATGGTGGG - Intergenic
996101534 5:119450173-119450195 TTGGAGCCTGGGGTTTTTATGGG + Intergenic
996109243 5:119545446-119545468 TTGATGCCTGGCTGGTATCTGGG - Intronic
996356222 5:122599201-122599223 ATGGAGCCTTACTGTTTTCTGGG + Intergenic
997705393 5:135946582-135946604 GTGCAGCCTCACTGTTTTCTTGG + Intronic
997967170 5:138367365-138367387 TTGGATTCTGGCTGTTCTCAAGG - Intronic
998173883 5:139888504-139888526 TTGGAGCCAGGGAGTTGTCTGGG + Intronic
1000848340 5:166309373-166309395 CTGTGGCCTGGCTGATTTCTAGG - Intergenic
1001313533 5:170627520-170627542 CTGGAGCCTTGTTGTTTTCTTGG - Intronic
1001887551 5:175309136-175309158 TTAGAGTCTGACTGGTTTCTAGG - Intergenic
1001960432 5:175877402-175877424 TTGCAGCCTGGCTGAGTTCAGGG - Intronic
1001982605 5:176047095-176047117 CTGGGGCCTGGGTGTTTTCCTGG + Intergenic
1002234858 5:177796962-177796984 CTGGGGCCTGGGTGTTTTCCTGG - Intergenic
1002271098 5:178072930-178072952 GTGGAGCCGGCCTGTTCTCTGGG - Intergenic
1004152046 6:13130424-13130446 TTGGATCTTGGATCTTTTCTTGG - Intronic
1004176172 6:13342036-13342058 GTGGACCCTGGCTGATATCTGGG + Intergenic
1004537741 6:16519206-16519228 TGGGGGCCTGAGTGTTTTCTAGG - Intronic
1004867662 6:19869956-19869978 TTGGAGCTTGGCTGAAGTCTGGG - Intergenic
1005407177 6:25501768-25501790 TTGGTGCCTGGCATTTTGCTAGG - Intronic
1007992765 6:46274655-46274677 CTGGAGGCTGGCTGCTTTCCTGG - Intronic
1010402592 6:75463641-75463663 TAAGACTCTGGCTGTTTTCTAGG - Intronic
1010799293 6:80155886-80155908 TTGGAGCTTAGTTGTTTTTTTGG + Intronic
1012197882 6:96367332-96367354 TTGGAGCTTGTTTGTTTCCTTGG + Intergenic
1012517181 6:100075908-100075930 TTGGTGCCAAGCTGTGTTCTAGG - Intergenic
1013311705 6:108900677-108900699 TTGGTGCTTGGCTGTGTTCATGG + Intronic
1014748353 6:125226675-125226697 TGGGAGTCTGGGTTTTTTCTCGG - Intronic
1015847989 6:137541827-137541849 TTGGAGCTTGGCCTTTTGCTAGG + Intergenic
1016071682 6:139747026-139747048 TTGGAGCCAGCCTGTTTTGCAGG + Intergenic
1016484789 6:144525557-144525579 TTGGATCCTCTCTCTTTTCTTGG + Intronic
1017467187 6:154705507-154705529 TTGGATCTTGGCTGGTGTCTGGG + Intergenic
1019369018 7:651175-651197 TAGGAGCCTGGCTGTATGCTGGG - Intronic
1019936633 7:4262405-4262427 ATGGACCCTGCATGTTTTCTAGG - Intronic
1020362962 7:7349585-7349607 TCAGAGCCTGGCAGTTTTCCAGG - Intergenic
1021259983 7:18443399-18443421 TTGGAAACTGGGTGTGTTCTAGG + Intronic
1022441003 7:30433303-30433325 TTGGAGCCTGGCTGTTTTCTGGG - Intronic
1022644372 7:32216880-32216902 CTGCAGCCTGGCTCTTCTCTCGG - Intronic
1024319734 7:48052864-48052886 CTGGAGCCTGGCTGCATCCTGGG - Exonic
1024535697 7:50429916-50429938 TTAGTTCCTGGGTGTTTTCTAGG - Intergenic
1026250358 7:68664647-68664669 TTGGAGGCTGGAATTTTTCTGGG - Intergenic
1028663078 7:93305870-93305892 GTTGAGACTGGCTGTTTACTAGG - Exonic
1028844200 7:95461246-95461268 TTCCATCCTGGCTGTTTTCATGG - Intergenic
1029985948 7:104923403-104923425 TTGCAGCCAGGCTGTTCACTGGG - Intergenic
1034776584 7:153833099-153833121 TTGAGGCCTGGCAGTTTTCATGG + Intergenic
1035819569 8:2577436-2577458 TGGGAGCCTGGCTGTGATCCAGG + Intergenic
1037912479 8:22752094-22752116 TTGGAGTCTTGCTGTTTCCCAGG + Intronic
1038455765 8:27671127-27671149 TTTGGGCCTGGCTGTCCTCTCGG - Exonic
1038731059 8:30128110-30128132 TTGGATCCGGGCTGTCCTCTGGG + Intronic
1038965300 8:32565312-32565334 ATAGAGTCTTGCTGTTTTCTAGG + Intronic
1039162177 8:34634536-34634558 TATGAGCGTGGCTGTTTTTTTGG - Intergenic
1039380304 8:37078803-37078825 TTTGAGCCTGGCTGTTACCAAGG + Intergenic
1040908316 8:52491729-52491751 GTAGAGCCTGGGTTTTTTCTGGG + Intergenic
1041139839 8:54805621-54805643 TTGGACTCTGGGTGTTTTGTTGG + Intergenic
1041210252 8:55543472-55543494 TTGGGGCCAGGCTCCTTTCTTGG - Intergenic
1041653531 8:60325363-60325385 TTGCAGCCTGGCTTTTGGCTGGG - Intergenic
1043670432 8:82878489-82878511 TTGGAGCCTTACTGGTTTTTTGG - Intergenic
1044159044 8:88889393-88889415 TTGGAGGCTTGCTTTCTTCTGGG + Intergenic
1044965538 8:97570497-97570519 TTTGGCCCTGCCTGTTTTCTAGG + Intergenic
1046593525 8:116233973-116233995 TTGGAGCTTTGGTGTTTTCTTGG + Intergenic
1047836360 8:128697770-128697792 TTGGGGCCTGACTGTTTAATTGG - Intergenic
1048070244 8:131013294-131013316 TTGTTGCCTGGGTCTTTTCTTGG - Intronic
1050993995 9:12190471-12190493 TTGAAGCCTGGCTGAGGTCTGGG - Intergenic
1055454828 9:76462307-76462329 GTGGAGACTGTCTGTATTCTTGG + Intronic
1056267896 9:84917803-84917825 CTGGCGCCTGACTGTTTTGTTGG - Intronic
1056838961 9:89982240-89982262 TTGACACCTGGCTGTTCTCTGGG + Intergenic
1056968401 9:91183156-91183178 TGGGAGCCTGGCTGGTTTGTTGG + Intergenic
1057898537 9:98929674-98929696 TGGATGCCTGGCTGTTTGCTTGG - Intergenic
1057974212 9:99586972-99586994 TTGTTGCCAGGCTGTATTCTAGG - Intergenic
1058336992 9:103842261-103842283 TTGGTGCCTTAGTGTTTTCTGGG - Intergenic
1059360372 9:113737502-113737524 ATGGAGCGGGGCTGTTTACTGGG - Intergenic
1060336683 9:122730362-122730384 TTGGACCCTGACTTTGTTCTTGG - Intergenic
1060612498 9:124980399-124980421 TTGGCCCCTGGCTGGCTTCTGGG + Intronic
1061782393 9:133003809-133003831 TTTGTGCCCCGCTGTTTTCTTGG - Intergenic
1062257924 9:135638663-135638685 TAGGTGCCAGGCTGTATTCTAGG - Intronic
1062568316 9:137172996-137173018 TTGCTGCCTGGCGGTTTGCTTGG - Intergenic
1062573811 9:137197457-137197479 TGGGAGCCTGGCTTCTTCCTGGG - Intronic
1185700970 X:2229497-2229519 TTCGGGGCTGGATGTTTTCTGGG + Intronic
1186308690 X:8293159-8293181 TTGGATCCTCTCTCTTTTCTTGG - Intergenic
1187511834 X:19926757-19926779 TGGCAGCCTGACTGTTTTCAGGG - Intronic
1189536391 X:41939624-41939646 ATGGAGCAGGTCTGTTTTCTGGG - Intergenic
1191163688 X:57364179-57364201 TTGGTGCAGGGCTTTTTTCTTGG + Intronic
1192529880 X:71874820-71874842 TATGTGCCTGGCTGTCTTCTGGG + Intergenic
1192584353 X:72307652-72307674 TTGGAGCCTGTCTGCCTTTTGGG + Intergenic
1192753111 X:74015567-74015589 TTTAAGCCTGGCTGTGTTCCTGG + Intergenic
1192789176 X:74364383-74364405 TTGGATACTGACTGTTGTCTAGG - Intergenic
1193149829 X:78113444-78113466 TTAGATCCTGGCTGGTATCTGGG - Intronic
1196326153 X:114405670-114405692 TTGGAGTTTGACTGGTTTCTTGG - Intergenic
1199416376 X:147587514-147587536 ATGGTGCCTGGCTGTTTTCCAGG - Intergenic
1200069259 X:153519705-153519727 ATGGAGACTGGCTGTGTCCTTGG - Intronic
1200137359 X:153881636-153881658 TTGGGGACAGGCTGGTTTCTTGG + Intronic
1200898586 Y:8403808-8403830 TTCGAGCATGTCAGTTTTCTGGG - Intergenic