ID: 1022446351

View in Genome Browser
Species Human (GRCh38)
Location 7:30473785-30473807
Sequence GGGGTACTCACTGAGCAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 127}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022446351 Original CRISPR GGGGTACTCACTGAGCAGCT GGG Intronic
900088852 1:910513-910535 GGGGTCCTGGTTGAGCAGCTAGG + Intergenic
901127776 1:6941410-6941432 GGGGTGTTCATTGAGCAGCAAGG + Intronic
904347022 1:29879269-29879291 GGAGTCCTCACTGGGCAGATGGG - Intergenic
906013294 1:42550069-42550091 GGGCTATTCACTGAACAGATTGG - Intronic
908941655 1:69442311-69442333 GGTATACTCACTGAGCTGATGGG + Intergenic
909335182 1:74465201-74465223 GGGGTTCCCACGGTGCAGCTGGG - Intronic
910092744 1:83484547-83484569 GGGCTTCACACTCAGCAGCTGGG - Intergenic
911687159 1:100790679-100790701 GGGGTCCACAGTGAGCAGGTTGG + Intergenic
911780991 1:101878329-101878351 GGGGTCCACACAGAGCAGTTTGG - Intronic
911857274 1:102895354-102895376 GTTGTACTTACTGAACAGCTAGG + Intronic
913023806 1:114814405-114814427 GGGGCACTGACAGAACAGCTCGG - Intergenic
914406417 1:147378309-147378331 GTTGTACGCACTGAGAAGCTGGG + Intergenic
917797520 1:178542714-178542736 GGGGTACTGACTGGGCAGCGCGG - Intronic
917969754 1:180199041-180199063 GGGCTACACACTGTGCAGCCCGG - Exonic
919803443 1:201366969-201366991 GAGGGACTCACTGTGCAGATGGG - Intronic
923077403 1:230622371-230622393 GATGAACTCACTGAACAGCTGGG - Intergenic
924384670 1:243490030-243490052 AGGGCACTCACAGAGCACCTGGG - Intronic
1069718939 10:70538047-70538069 GGAGTAGTCCCTGAGCAGCTGGG + Intronic
1070827037 10:79397334-79397356 GGAGTGCTCAGTGGGCAGCTAGG + Intronic
1072035057 10:91555515-91555537 GGTGTAGTTACTGAGCAGCATGG - Intergenic
1074925248 10:118062424-118062446 GGGGTCCCCTCTGAGCAGCAGGG - Intergenic
1075438212 10:122460584-122460606 TGGGTCCACACTGAGCAGATGGG - Intergenic
1076248707 10:128967512-128967534 GGGGGTCTCAGTGAGAAGCTGGG + Intergenic
1076842751 10:133054284-133054306 GGGGTTATGAATGAGCAGCTGGG + Intergenic
1078056101 11:8010171-8010193 GGGGCACTCAATGAGCAGGTAGG - Intergenic
1078105078 11:8353300-8353322 TGGGTTCTGACTAAGCAGCTTGG + Intergenic
1081794235 11:45808650-45808672 GGGGTACCCACAGACCTGCTGGG - Intronic
1082798696 11:57397632-57397654 GGGGTAGTCAGTGGGCACCTGGG - Intronic
1084939550 11:72605170-72605192 GGGGTCCTCACACACCAGCTGGG + Exonic
1085668595 11:78439937-78439959 GTGGTCCTCCCTAAGCAGCTTGG + Intronic
1089682392 11:120125957-120125979 GGGGCTCTCACAGTGCAGCTGGG + Intronic
1090765187 11:129870239-129870261 GTGGCAATCACTGGGCAGCTTGG - Exonic
1095414476 12:41961349-41961371 TGGGTACTCTCTGTGCAGTTTGG - Intergenic
1098589403 12:72192219-72192241 TGGGGACTCACTCAGCAGGTTGG + Intronic
1104596877 12:130126081-130126103 GGTGGAGTCACTGAGCAGCTGGG + Intergenic
1105591356 13:21795621-21795643 GGGGTCCTCACTGAGGAGCAGGG + Intergenic
1106125441 13:26897004-26897026 GGGCCATCCACTGAGCAGCTGGG + Intergenic
1106546357 13:30734183-30734205 TGGGTACTCCCTGAGTACCTAGG - Intronic
1113857803 13:113458350-113458372 GGGGCACTCACCGAGCATCCGGG - Intronic
1116655761 14:47651646-47651668 GGGGTACTCACAGGGCAAATGGG + Intronic
1117479158 14:56125855-56125877 TAGGTACTCACTGAGCCTCTTGG + Intronic
1117933195 14:60869402-60869424 AGGTACCTCACTGAGCAGCTTGG - Intronic
1121645385 14:95514770-95514792 TGGGAACCCACTGGGCAGCTAGG - Intergenic
1122940356 14:104978397-104978419 GGGGTCCTAGCTGAGCGGCTGGG - Intergenic
1124702967 15:31933014-31933036 GGTGCACCCACTGAGGAGCTGGG + Intergenic
1124831737 15:33155301-33155323 TGGGGACTCACTGTGCAGCCTGG + Intronic
1128100221 15:64992496-64992518 GAGGTAATCACTTAGCTGCTTGG - Intergenic
1128804313 15:70519207-70519229 TGGGGACTCACTGGGCAGCGGGG + Intergenic
1134871399 16:17655320-17655342 GGGAAACTCACTGAGAAGCAGGG - Intergenic
1135544714 16:23357971-23357993 CGTGTTCTCACTGAGCAGATGGG - Intronic
1136110563 16:28062043-28062065 GGTGTCCACACTGAGGAGCTAGG + Intronic
1138233833 16:55362834-55362856 GAGTAACTCACAGAGCAGCTGGG + Intergenic
1138442485 16:57043374-57043396 GGGGTGCTCTCTGACCATCTTGG + Intronic
1139186004 16:64807072-64807094 GGAGTACTCACTGGACAGCTTGG + Intergenic
1141705395 16:85661785-85661807 GCGGCTCTCCCTGAGCAGCTCGG - Intronic
1141811238 16:86377815-86377837 CGGCTCCTCACAGAGCAGCTGGG - Intergenic
1141990059 16:87604144-87604166 TGGGCTCTCACTGAGCAGATGGG - Intronic
1142111692 16:88335378-88335400 GGGGTGCTCTGTGGGCAGCTGGG + Intergenic
1142189229 16:88710033-88710055 GGGGGTCTGACTGAGCAGCCTGG + Intronic
1142193259 16:88727546-88727568 GGGGCACTCACTGATGAGGTTGG + Exonic
1142266580 16:89066754-89066776 GGTGTCCTGACTGAGCAGCCGGG + Intergenic
1144201972 17:12949719-12949741 GGGGTACTCACTTGGAAGCCTGG - Exonic
1144569357 17:16386321-16386343 GGGGGTCTCACTGAGCACCGTGG + Intergenic
1144763567 17:17721039-17721061 AGGGTACTCACTGAGCGACCTGG + Intronic
1144763571 17:17721071-17721093 AGGGTACTCACTGAGCGACCTGG + Intronic
1145270667 17:21403062-21403084 GGAGTACTCACGGAGGAGCAAGG + Intronic
1145308872 17:21690452-21690474 GGAGTACTCACGGAGGAGCAAGG + Intergenic
1148344023 17:46891424-46891446 GGTGTCCTCACTGCACAGCTGGG - Intergenic
1148894275 17:50831018-50831040 AGGGTCCTCACTGAGCAGAGAGG - Intergenic
1149898178 17:60447570-60447592 GAGGTCCTCCCTCAGCAGCTCGG + Exonic
1150136554 17:62698632-62698654 GGGGTAGACATTGAGGAGCTGGG - Intergenic
1150467020 17:65402729-65402751 GGGGTATTCTCTGCCCAGCTAGG - Intergenic
1151518465 17:74612471-74612493 GGAGTCCTCAATGTGCAGCTTGG - Exonic
1155743091 18:29314860-29314882 GGTGTAATCACTGATTAGCTAGG + Intergenic
1160455882 18:78999614-78999636 TGGGACCTCTCTGAGCAGCTGGG + Exonic
1160943449 19:1630543-1630565 GGGGTACACGGTGAGCACCTGGG + Intronic
1162814229 19:13183668-13183690 GGGGTCCTCCCTGAGATGCTGGG + Intergenic
1163511701 19:17739440-17739462 GGAGGCCTCACTGAGCAGCTGGG + Intergenic
1164860801 19:31560839-31560861 GGGGTGGTCCCTGAGCAGCAGGG + Intergenic
1165636530 19:37345010-37345032 GAGGTACTCACTGAGAATCTAGG - Intronic
1166400095 19:42472141-42472163 TGGTTAGTCACTGAGCAGTTCGG + Intergenic
1168346491 19:55652562-55652584 GGGGGCCACAATGAGCAGCTCGG - Exonic
927467416 2:23347832-23347854 GCGGTCCTCAGAGAGCAGCTTGG + Intergenic
928655642 2:33447932-33447954 GGAATACTCACTGAGAATCTTGG - Intronic
934141604 2:89052578-89052600 TGGTTACTAACTGAGAAGCTGGG - Intergenic
934227639 2:90147968-90147990 TGGTTACTAACTGAGAAGCTGGG + Intergenic
937295397 2:120807047-120807069 GTGGGACTGACTGAGCAGCCAGG - Intronic
943213707 2:185003112-185003134 GGCGTAATCACAGAGCAGCCTGG - Intergenic
948542334 2:238699559-238699581 GGGGTGCTCAGAGTGCAGCTTGG + Intergenic
1168866704 20:1092796-1092818 TGGTTACTGAGTGAGCAGCTAGG + Intergenic
1172132521 20:32665058-32665080 GGGGAACTTACTTGGCAGCTTGG - Intergenic
1172639996 20:36435144-36435166 GGGGTACTCACTGAGGGGCATGG + Intronic
1176226583 20:64003563-64003585 TGAGCATTCACTGAGCAGCTGGG - Intronic
1177170619 21:17651517-17651539 GTGGTACTCACCGATAAGCTTGG - Intergenic
1179999218 21:44987555-44987577 GGGCCACCCACGGAGCAGCTGGG - Intergenic
1181430388 22:22877965-22877987 GGGGTCCCCACAGAGCAGCATGG + Intronic
1182278908 22:29206884-29206906 GGGCTATTCACTGAAGAGCTAGG + Intronic
1182299634 22:29330367-29330389 GGGGCTCTCACCGTGCAGCTGGG + Exonic
950503119 3:13376900-13376922 GGGGTGCTCACTGACGAGCCTGG + Intronic
950656407 3:14439723-14439745 TGAGTACTCACTGCGCAGCGGGG + Intronic
950662995 3:14478155-14478177 GGGCCACTCACTGAGCAGCTGGG + Intronic
954108327 3:48420837-48420859 GAGGAACTCACTGCGCAGATGGG + Exonic
960136225 3:114108319-114108341 GGGGAACTCACTGATCACCAAGG + Intergenic
965771490 3:172186458-172186480 GGGGTACTCACTGAGTCCCATGG - Intronic
965844499 3:172946213-172946235 GGAGTACTCACCGGGCACCTTGG + Intronic
968536135 4:1130960-1130982 GGGAAACACACTGAGCAGCTCGG - Intergenic
969680006 4:8637619-8637641 TGGGTGCTCTCTGAGCACCTAGG + Intergenic
992706398 5:79398762-79398784 GAAGTACTCACTGAGTATCTTGG - Intronic
993110949 5:83656758-83656780 TGGGGACTCACTGAACCGCTGGG + Intronic
993551353 5:89277672-89277694 GGGGTACTTATTGACCATCTTGG - Intergenic
994945502 5:106382912-106382934 GGGGTCCTCCATGTGCAGCTAGG + Intergenic
995198568 5:109400583-109400605 GGGGGAATCACTGAGCTTCTTGG - Intronic
998592198 5:143489602-143489624 GGATTACTCAGTGAACAGCTCGG - Intergenic
999294915 5:150453142-150453164 GGAGCACTCACTGAGCACCTAGG + Intergenic
999374534 5:151077636-151077658 GGGGTGCTCAAGGAGCAGCCCGG + Intronic
1004633626 6:17445721-17445743 GGGGATCTCACTGAGAAGTTTGG - Intronic
1006833216 6:36981487-36981509 GGGGAACTCACTGCGCAGCATGG - Intronic
1007404433 6:41625860-41625882 GGGGCACTCACTGAGTAGTGAGG + Intergenic
1007628443 6:43259573-43259595 GGGGCACGCACTGGGGAGCTGGG - Exonic
1009721524 6:67476788-67476810 GGGGTACTTACTTGGCAGTTTGG + Intergenic
1013718313 6:112990557-112990579 GAGGCCTTCACTGAGCAGCTAGG + Intergenic
1018395698 6:163376564-163376586 GTGGTCCTCACTGAGCCACTGGG - Intergenic
1018725728 6:166612171-166612193 AGGGAACTCACTGACCATCTGGG + Intronic
1018907157 6:168082298-168082320 TGGCCACTCACTGAGCAGCTTGG - Intergenic
1022446351 7:30473785-30473807 GGGGTACTCACTGAGCAGCTGGG + Intronic
1023810392 7:43906726-43906748 GGGGTCCTCTCGGAGCAGCCCGG + Exonic
1024622137 7:51169697-51169719 GGGGAACTCACTGGGGAGGTGGG + Intronic
1027309604 7:76941043-76941065 GGGCTTCACACTCAGCAGCTGGG - Intergenic
1029540707 7:101180413-101180435 GGGGTGCGCCCTGGGCAGCTGGG + Intergenic
1030063784 7:105643532-105643554 GGGGGACTAGCTGAGCAGCGGGG - Intronic
1035051352 7:156000711-156000733 CAGGTACTCACTGACCAGCTGGG + Intergenic
1035333648 7:158112404-158112426 GGTGAAGTCACAGAGCAGCTGGG + Intronic
1036236495 8:7043537-7043559 GTGGTGCTCTCTGAGGAGCTGGG - Intergenic
1046654577 8:116879172-116879194 GGGGAAATCACTGAGAAACTGGG + Intergenic
1049578723 8:143401244-143401266 GGTCTACGCACTGGGCAGCTGGG - Intergenic
1054812577 9:69446694-69446716 TGGGGACTCACTGGCCAGCTGGG + Intronic
1055420626 9:76137263-76137285 GAGGTGCTCACTGATGAGCTAGG + Intronic
1059175555 9:112166970-112166992 GGGGTAGTCACTGCAGAGCTGGG - Intronic
1059337627 9:113579188-113579210 CAGCTACTCACTGAGCAGCCAGG - Intronic
1059540179 9:115122601-115122623 GGAGTCCTCACAGACCAGCTGGG - Intergenic
1186770234 X:12811080-12811102 GGAGCACTCACCGAGCAGCTAGG - Intronic
1199687191 X:150274890-150274912 GGGGCACCCAGTGAGGAGCTGGG + Intergenic
1201763105 Y:17559505-17559527 GGCGTCCTCACTCAGCAGCAGGG + Intergenic
1201838447 Y:18346484-18346506 GGCGTCCTCACTCAGCAGCAGGG - Intergenic