ID: 1022451673

View in Genome Browser
Species Human (GRCh38)
Location 7:30521941-30521963
Sequence AACCACATTCTATTATTTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022451672_1022451673 18 Left 1022451672 7:30521900-30521922 CCTTTTACAACTTACTCTCAAAA 0: 1
1: 0
2: 4
3: 34
4: 361
Right 1022451673 7:30521941-30521963 AACCACATTCTATTATTTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022451673 Original CRISPR AACCACATTCTATTATTTAG AGG Intronic
No off target data available for this crispr