ID: 1022457382

View in Genome Browser
Species Human (GRCh38)
Location 7:30569988-30570010
Sequence AAATTATAGAAATCTATCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022457382_1022457383 -9 Left 1022457382 7:30569988-30570010 CCTATGATAGATTTCTATAATTT No data
Right 1022457383 7:30570002-30570024 CTATAATTTTATGTTTGATTTGG 0: 15
1: 32
2: 36
3: 81
4: 566
1022457382_1022457384 25 Left 1022457382 7:30569988-30570010 CCTATGATAGATTTCTATAATTT No data
Right 1022457384 7:30570036-30570058 AATCTCCTCCTACTAGTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022457382 Original CRISPR AAATTATAGAAATCTATCAT AGG (reversed) Intergenic
No off target data available for this crispr