ID: 1022457383

View in Genome Browser
Species Human (GRCh38)
Location 7:30570002-30570024
Sequence CTATAATTTTATGTTTGATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 730
Summary {0: 15, 1: 32, 2: 36, 3: 81, 4: 566}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022457382_1022457383 -9 Left 1022457382 7:30569988-30570010 CCTATGATAGATTTCTATAATTT No data
Right 1022457383 7:30570002-30570024 CTATAATTTTATGTTTGATTTGG 0: 15
1: 32
2: 36
3: 81
4: 566

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022457383 Original CRISPR CTATAATTTTATGTTTGATT TGG Intergenic
900753553 1:4416919-4416941 CTTTAATTTCATGTTTAATGTGG + Intergenic
903525375 1:23989620-23989642 CTATAATTTTTTTTTTGAGACGG + Intergenic
903536383 1:24069198-24069220 CTTTATTTGTATGTATGATTTGG + Intronic
905232937 1:36526460-36526482 CTTTAATTTAATTTTTGAATAGG + Intergenic
905858975 1:41333742-41333764 ATATAATTTTTTGTGTGTTTTGG + Intergenic
906232642 1:44178792-44178814 CTATAATTTTATGTTTGATTTGG - Intergenic
906378394 1:45315770-45315792 TTGTAATTTTATGTTTGATTTGG - Intergenic
906564203 1:46786285-46786307 CTATAATTTTATGTTTGATTTGG - Intronic
906573301 1:46863131-46863153 TTGTAAATTTATTTTTGATTGGG - Intergenic
906868000 1:49443792-49443814 ATATATTTTTAATTTTGATTTGG + Intronic
906884594 1:49630717-49630739 CTAGAATTGGATGTTTGATAAGG - Intronic
906907157 1:49908277-49908299 CTATAATCTCATGTTGGAGTTGG + Intronic
907920330 1:58905535-58905557 CTTTAACTTTATGTTTGGATTGG + Intergenic
910516262 1:88063938-88063960 CAATAATTTTAAGTTTGAAGGGG - Intergenic
910581726 1:88834797-88834819 CTGTAGTTTTTTGTTTGTTTTGG + Exonic
911198792 1:95023072-95023094 CTGTGATTTTTTTTTTGATTAGG - Intronic
911250137 1:95567154-95567176 CTATTATTTTCTGTGTGTTTTGG + Intergenic
912276183 1:108261409-108261431 ATATAATTTTATTTTTGATGTGG + Intergenic
912292045 1:108432949-108432971 ATATAATTTTATTTTTGATGTGG - Intronic
912875332 1:113352184-113352206 ATATAATTTTATTATTGACTTGG - Intergenic
914214340 1:145611208-145611230 CTTTTATTTTATTTTAGATTTGG + Intronic
914466279 1:147931601-147931623 CTTTTATTTTATTTTAGATTTGG + Intronic
914784473 1:150816207-150816229 GTATTATTTTTTGTTTGTTTGGG - Intronic
914930487 1:151927304-151927326 CTATAATTTTATGTTTGACTTGG + Intergenic
915652562 1:157327269-157327291 CTATAATTTTATGTATGATTTGG + Intergenic
915834023 1:159159881-159159903 CTATAATTTTAAAGTTGCTTAGG + Intergenic
915982619 1:160430559-160430581 CTATTTTTTTTTGTTTGTTTGGG + Intergenic
916624443 1:166539774-166539796 CTATAATTTTATGTTTGATTTGG - Intergenic
916951121 1:169781293-169781315 CTTTAGTTTTATATTTCATTGGG - Intronic
917128153 1:171710343-171710365 TTTTTATTTTATGTTTTATTTGG - Intronic
917328728 1:173860534-173860556 CCAAAATTTTAGGTTTCATTTGG + Intergenic
917506457 1:175631655-175631677 ATATATTTTTCTGTCTGATTTGG - Intronic
917694303 1:177505349-177505371 CTATTATTTTAAGTTTGTTAAGG - Intergenic
917826149 1:178823122-178823144 CTATACTTTTATTTATGATTTGG + Intronic
918389166 1:184039943-184039965 CTATAATTCGATGTGAGATTTGG - Intergenic
918654281 1:187004483-187004505 CTATAATTTTATGTTTGATCTGG + Intergenic
919263072 1:195223381-195223403 ATTTAATTTTATTTTAGATTCGG - Intergenic
921016176 1:211193393-211193415 CTATAATTTTCTCTTTTTTTAGG + Intergenic
921959206 1:221016678-221016700 CTATAATTTTATCTTTATTTGGG + Intergenic
922122348 1:222684899-222684921 CTATAAATTTCTATCTGATTTGG - Intronic
922600626 1:226849247-226849269 GTTTAATTTTATGTTTAATTTGG + Intergenic
923509479 1:234637367-234637389 CTTTTATTTTATTTTAGATTCGG - Intergenic
923703834 1:236326806-236326828 CTATAATGTTAAATTTGAATTGG - Intergenic
923841235 1:237672685-237672707 GTTTAATTATATCTTTGATTAGG + Intronic
924162237 1:241245179-241245201 TTATAATTTGATGTGAGATTTGG - Intronic
1063737851 10:8781099-8781121 CTATCATTTTCTGTATAATTGGG + Intergenic
1065673572 10:28149391-28149413 CTATAATTTTATTTTGAACTTGG - Intronic
1065799816 10:29341942-29341964 CTACAAATTTTTGTTTGATTTGG + Intergenic
1065926302 10:30436103-30436125 GCATAATTTTCTGTTTGGTTAGG + Intronic
1065988007 10:30976122-30976144 TTAAAGTTTTATGTTTAATTTGG - Intronic
1066052395 10:31647754-31647776 CTAAAACATTATGTTTGACTAGG + Intergenic
1066057104 10:31692223-31692245 ATATAATTTGATGTGAGATTTGG - Intergenic
1066121435 10:32291312-32291334 GTATAATTTTAGGTATAATTTGG - Exonic
1066123490 10:32315373-32315395 ATATAATTTAATCTTTGTTTAGG - Intronic
1066326961 10:34370162-34370184 CTATACTTTTAACTTTGTTTGGG + Intronic
1067420088 10:46137670-46137692 CTGTAACTTTATGTTTGATTTGG - Intergenic
1067425931 10:46211851-46211873 CTGTAACTTTATGTTTGATTTGG + Intergenic
1067505435 10:46844160-46844182 CTGTAACTTTATGTTTGATTTGG - Intergenic
1067547103 10:47200361-47200383 CTAAAATTTTCTGTTCCATTAGG + Intergenic
1068248745 10:54408682-54408704 CTATGATTCTATGTATGATTGGG + Intronic
1068257296 10:54529439-54529461 CTATTATTTCACTTTTGATTTGG - Intronic
1068271031 10:54724517-54724539 TTTTAATTTTATTTTAGATTCGG - Intronic
1068407406 10:56608112-56608134 GTAAGATTTTATGTTTCATTGGG + Intergenic
1068531597 10:58194346-58194368 CTATAGTTTTATGTTTTAACGGG - Exonic
1068550358 10:58401107-58401129 CAATAATTTTAATTTTGATGGGG + Intergenic
1068819392 10:61356116-61356138 CTATTATTGTATGTTTTCTTTGG - Intergenic
1069131357 10:64708165-64708187 CTCTTATTTTTTGTTTGTTTGGG - Intergenic
1069181366 10:65363678-65363700 TTATTCTTTTATCTTTGATTTGG + Intergenic
1069905473 10:71729715-71729737 ATATATTTTAATATTTGATTGGG + Intronic
1070141070 10:73738401-73738423 CTAAAATGTTATGTTTGATTTGG + Intergenic
1070223213 10:74472951-74472973 CAATAGTTTTTTGTTTGTTTTGG + Intronic
1070444763 10:76486481-76486503 CTCTAATTTTGTGTATGATATGG - Intronic
1071229996 10:83574854-83574876 CTATTATTCTATGCTAGATTTGG + Intergenic
1071302049 10:84263292-84263314 TTAAAATTTTCTGTTTGACTTGG + Intergenic
1071355235 10:84786958-84786980 ATAGATTTTTATTTTTGATTAGG - Intergenic
1071610791 10:87029601-87029623 CTGAAATGTTATGTTTGATTTGG - Intergenic
1071615840 10:87075432-87075454 TTATCATTTTCTGTTTCATTTGG - Intronic
1071870844 10:89792733-89792755 CTATAGTTGTATGTTTGCCTTGG + Intergenic
1072543537 10:96416607-96416629 CTATAATTTAATGTATCATAAGG - Intronic
1072879029 10:99205230-99205252 TTAAAATTTTATTTTAGATTCGG - Intronic
1073314370 10:102568082-102568104 CAATAATGTTATATTTGTTTGGG - Intronic
1073728369 10:106261382-106261404 CTATTATTTTAAATTTGATAAGG - Intergenic
1073738247 10:106375549-106375571 ATTTAATTTTATGTTTAATTTGG + Intergenic
1073751982 10:106539318-106539340 TTTTATTTTTATATTTGATTTGG - Intergenic
1073811428 10:107156204-107156226 GTATAAGTTTATTTTTGAATGGG - Intronic
1073858215 10:107703051-107703073 CTGTCATATTATGTTTGCTTAGG + Intergenic
1073988715 10:109239375-109239397 CTTTTATTTGATCTTTGATTTGG - Intergenic
1074025799 10:109632640-109632662 CTGTAATTTTATGTTTGATTTGG + Intergenic
1074252678 10:111767878-111767900 CTATGAGTTTCTGTTTGATGTGG - Intergenic
1074649558 10:115505115-115505137 CTATAATTTTATGTTTAATTTGG - Intronic
1077513899 11:2989467-2989489 CTATATTTTTCAGTTTGTTTTGG - Intronic
1077685399 11:4286622-4286644 TTAAAATTTTTTATTTGATTTGG + Intergenic
1077738390 11:4817123-4817145 CTATGATTTTATATTTGTTTAGG - Intronic
1077756792 11:5038652-5038674 TTAAAATTATATGTTTGTTTTGG - Intergenic
1078042550 11:7882135-7882157 CTTTCATTTTATTTTTGATTTGG - Intergenic
1078225609 11:9388895-9388917 CTATAATTTTAAGTTTCTTGAGG + Intronic
1078809541 11:14744242-14744264 CTATTCTTTTTTCTTTGATTTGG + Intronic
1079065718 11:17289668-17289690 TTATAATTTAATGTTTAATATGG + Intronic
1079798494 11:24838617-24838639 TAATAATTTTAAGTTTTATTTGG + Intronic
1079855517 11:25598410-25598432 CTCTAATTTTATTTTTGTATTGG + Intergenic
1079881989 11:25940007-25940029 CAATAATTTTAAGCTTGACTAGG - Intergenic
1080305837 11:30834480-30834502 ATATATTTTTGTGTTTGTTTTGG - Intronic
1080726612 11:34904534-34904556 CAATGATTTTCTGTTAGATTGGG + Intronic
1081231872 11:40595190-40595212 GTAAAATTTTATCCTTGATTTGG - Intronic
1082704065 11:56471141-56471163 TTATAATTTCATGTTAGAGTTGG - Intergenic
1082942398 11:58721349-58721371 GTTTAATTTTATTTTTAATTTGG - Intronic
1082949591 11:58798195-58798217 CTATAATTTTATGTTTGACTTGG - Intergenic
1082950712 11:58812483-58812505 ATATAATTTTATGTTTGATTTGG + Intergenic
1083358492 11:62086441-62086463 CTATAATTTTATGTTCAATTTGG + Intergenic
1083383176 11:62285412-62285434 CTATCATTTCATGTTTAATTTGG - Intergenic
1086030431 11:82348564-82348586 CTATGATTTTATATATGAATTGG - Intergenic
1086165462 11:83772640-83772662 CTATAAAATTATTTCTGATTTGG + Intronic
1086247154 11:84767300-84767322 CTAAAATTTCATATTAGATTGGG + Intronic
1086896601 11:92320429-92320451 CTATAATTTTTTTTTTCTTTAGG - Intergenic
1087048019 11:93860142-93860164 TTATAATTTTATGTTTGATTTGG + Intergenic
1087049958 11:93876772-93876794 TCATAATTTTATGTTTGATTTGG - Intergenic
1087145789 11:94810201-94810223 CTGTAATTTTATGTTTGACTTGG - Intronic
1087266277 11:96065239-96065261 CTATTTTTTTATATTTGCTTTGG - Intronic
1087343832 11:96943560-96943582 CATTAATTTTTTGTTTTATTGGG + Intergenic
1087809814 11:102598358-102598380 CTATAATTTGATCTTTGATAAGG + Intronic
1088934490 11:114385364-114385386 CTAAATTTTTATGTATGATTAGG + Intergenic
1088978359 11:114836279-114836301 CTATAAATATATGATTTATTAGG + Intergenic
1089459254 11:118643084-118643106 CTAAAATTTCATGTTTCCTTGGG + Intronic
1090100590 11:123792669-123792691 TTATAATTTTATGTTTCATTTGG - Intergenic
1091474285 12:756114-756136 TTATAGTTTTATATTTGAATAGG + Intronic
1091865198 12:3828099-3828121 CTGTCATTTTCTGATTGATTTGG - Intronic
1091951160 12:4594172-4594194 CTATAATTTTATGTATGCGCAGG - Intronic
1092014554 12:5147614-5147636 CGTTAATTTTATTTTTGCTTTGG + Intergenic
1092395062 12:8118719-8118741 TTATAATTTGATGTGAGATTTGG + Intergenic
1092590435 12:9948407-9948429 TTATAATTTAATGTTTAATTTGG - Intergenic
1093329518 12:17818060-17818082 CTATAATGTTTTATTTGGTTTGG + Intergenic
1093585233 12:20828012-20828034 CTACAATTTCATGTTTGACTTGG - Intronic
1093596512 12:20968656-20968678 CTACAATTTCATGTTTGACTTGG - Intergenic
1093917002 12:24815333-24815355 CAATTATTTAATGTTTAATTGGG - Intronic
1093998787 12:25672132-25672154 GTATAATTCACTGTTTGATTTGG - Intergenic
1095481417 12:42639991-42640013 TTCTAATTTTATGTTTAGTTAGG - Intergenic
1095535660 12:43243754-43243776 CTAGAATTTTATGGATGAATGGG + Intergenic
1095634161 12:44412503-44412525 TTATTATTTTGTGCTTGATTTGG - Intergenic
1095777903 12:46029641-46029663 CAATGGTTTTATTTTTGATTTGG - Intergenic
1095914860 12:47467573-47467595 CAATTATTTTATTTTTGAATAGG - Intergenic
1096416158 12:51415902-51415924 ATTTAATTTTATTTTAGATTCGG - Intronic
1096620916 12:52864844-52864866 CTATATTTTTATATTTTAGTAGG - Intergenic
1096880758 12:54667743-54667765 CTATAATTTTATTTCAGATATGG - Intergenic
1097367994 12:58741452-58741474 CTATGATTTTAAGTTTGCTGAGG + Intronic
1097589876 12:61561682-61561704 CTATAATTATAAGTTGGCTTAGG - Intergenic
1098010727 12:66048488-66048510 CAATTATTTTATGTTAAATTTGG + Intergenic
1098163158 12:67666954-67666976 TTATAATTTTTTTTTTGTTTTGG - Intergenic
1099058855 12:77880224-77880246 CTCTTATTTTATTTTTCATTTGG + Intronic
1099311635 12:81033527-81033549 TTATACTTTTTTGTTTGGTTTGG - Intronic
1099695299 12:86011984-86012006 CTAGAATTTTTTCTTTGTTTTGG + Intronic
1099704591 12:86135636-86135658 CTATAATTTTGTGTTTGTTGCGG - Intronic
1099764569 12:86966629-86966651 TTTAAATGTTATGTTTGATTTGG + Intergenic
1100319785 12:93479905-93479927 CTTTATTTTTATGTTTTAATGGG + Intronic
1100718881 12:97335116-97335138 AATTAATTTTATGTTTAATTAGG - Intergenic
1101012807 12:100468496-100468518 ATATAATTTAATTTTTGATAAGG - Intergenic
1101711509 12:107271270-107271292 CTATATTTTTACCTTTGCTTGGG + Intergenic
1102683640 12:114707336-114707358 CAATAATTTTTTGTTTGGTTTGG - Intergenic
1102848490 12:116214501-116214523 TTTTGATTTTGTGTTTGATTAGG - Intronic
1105696640 13:22896033-22896055 CTGTAATTTTATGTTTGACTTGG + Intergenic
1105711681 13:23015626-23015648 CAATAATTTCATGATTGATATGG - Intergenic
1105796137 13:23855139-23855161 ATTAAATTTTATTTTTGATTAGG - Intronic
1107703106 13:43069454-43069476 TCATAATTTTATGTTTGAGATGG - Intronic
1107784930 13:43945743-43945765 CTATAATGGTATCTGTGATTTGG + Intergenic
1108780784 13:53829498-53829520 CTATAGTTTTTGGTTTGTTTTGG - Intergenic
1108944758 13:56007970-56007992 CTGTAATATTATATTTCATTTGG - Intergenic
1109039478 13:57314264-57314286 TTAAAATTTTCTGTTTTATTTGG - Intergenic
1109422663 13:62133556-62133578 CTATAATTTTATGTTTGATTTGG + Intergenic
1110057729 13:70997520-70997542 TTATATTTTTGTGTTTGTTTTGG - Intergenic
1111196435 13:84880594-84880616 ATAGAATTTTATGTTTGATTTGG - Intergenic
1111419057 13:87985774-87985796 CTGTAATTTTATGTTTGGCTTGG + Intergenic
1111584299 13:90263790-90263812 CACTAATTTTATGTATCATTGGG + Intergenic
1111928462 13:94488175-94488197 TTATAATTTAATGACTGATTTGG + Intergenic
1112877036 13:104055196-104055218 GTGTAATTATATGTTTGAATAGG - Intergenic
1112919024 13:104587482-104587504 TCATAATTTTATTTCTGATTTGG - Intergenic
1112993238 13:105540037-105540059 CTATAATTTTATGTTAGCTCTGG - Intergenic
1113271106 13:108675380-108675402 TTGTAATTTTATATCTGATTTGG - Intronic
1113490560 13:110688449-110688471 CTTTATTTTTATTTTTGTTTCGG - Intronic
1114052832 14:18936505-18936527 GTTTAATTTAATGTTTAATTTGG + Intergenic
1114109726 14:19465420-19465442 GTTTAATTTAATGTTTAATTTGG - Intergenic
1114976611 14:28108506-28108528 TTATAATTTTATTATTTATTTGG - Intergenic
1115134489 14:30092133-30092155 TTATAATTTGATGTGAGATTTGG + Intronic
1115583030 14:34781073-34781095 ATATAATTTTAGTTTTAATTTGG - Intronic
1115951098 14:38722359-38722381 CAAGAATTTTTTGTTTGTTTAGG - Intergenic
1116013663 14:39380721-39380743 CTATAATTTTATGTTTGACTTGG - Intronic
1116126322 14:40791064-40791086 GTATATTTTTATGGTTGATGAGG + Intergenic
1116263060 14:42655510-42655532 GTTTAATTTTAAGTTTAATTTGG + Intergenic
1116302651 14:43204594-43204616 CTATAATTCAATGTGAGATTTGG + Intergenic
1116690961 14:48104994-48105016 TTATAATTGGAAGTTTGATTTGG + Intergenic
1117187794 14:53259509-53259531 CTATAATTTTATGTTTGGTTTGG - Intergenic
1117680426 14:58198029-58198051 CTATTTTTTTTTGTTTGTTTTGG - Intronic
1118059972 14:62125417-62125439 CTATAAGTTTATTTGTCATTTGG + Intergenic
1118093920 14:62515253-62515275 CTATAATTTTAAGATTGCGTTGG + Intergenic
1118510579 14:66467548-66467570 CCACAATTTTACGTTTGATTTGG + Intergenic
1118634638 14:67736447-67736469 ATCTAACTTTATGTTTCATTTGG - Intronic
1119153822 14:72390055-72390077 TTATACTTTTCTGTTTTATTTGG - Intronic
1120390874 14:83906769-83906791 CTAATATTTTATTTTTGTTTTGG + Intergenic
1120416626 14:84227232-84227254 CAATAATATTATGCTTCATTAGG - Intergenic
1120485614 14:85109985-85110007 CTATATTTTTATTTTGGACTGGG + Intergenic
1122296250 14:100707859-100707881 TTAAAATTTTACTTTTGATTAGG - Intergenic
1122434263 14:101682834-101682856 CTATAATTTCATGTTTGATTTGG - Intergenic
1122966681 14:105132179-105132201 TTATAATTTTATTTTTGAGATGG - Intergenic
1124196247 15:27632773-27632795 ATATAATTTTATGTTTTGTAAGG + Intergenic
1124198934 15:27660001-27660023 GTATAATTTTATCCTTAATTGGG - Intergenic
1124876310 15:33598107-33598129 GTTTAATTTTATGTTTAATTTGG - Intronic
1125026249 15:35032464-35032486 TTATAATTTAATGTTATATTTGG + Intergenic
1125120473 15:36152568-36152590 CTTTAAAATTATGATTGATTTGG + Intergenic
1126025192 15:44439523-44439545 CTGTATTTTTATGTTTTTTTTGG + Intronic
1126196078 15:45933664-45933686 TTATAATTTTTTTTTTGTTTTGG + Intergenic
1126650595 15:50917785-50917807 CTATTAATTTCTGTTTGTTTCGG - Intronic
1127953440 15:63833220-63833242 TTATAATTTGTTGTTTTATTGGG + Intronic
1128289695 15:66468472-66468494 CTATAATTGTATGTTTGATTTGG - Intronic
1129130892 15:73494188-73494210 CTACTATTTTATATTTGTTTTGG + Intronic
1131001681 15:88943532-88943554 CTATCATTTTATGTTTGGCTTGG + Intergenic
1131604889 15:93892033-93892055 CCATAATTTTATCTTTCTTTGGG - Intergenic
1131896087 15:97030949-97030971 CTATTTTTTTCTGTTTGTTTTGG - Intergenic
1131986739 15:98050179-98050201 CTATAATTTTACCATTAATTTGG - Intergenic
1132115584 15:99133256-99133278 CTGCAATTTTATTTTTGAGTTGG + Exonic
1134131277 16:11651865-11651887 ATATATTTTTATGGTTCATTGGG - Intergenic
1134897092 16:17898025-17898047 CTATATTTTTATTTTTAATGAGG + Intergenic
1135148988 16:19988857-19988879 GTATATTTTTATATTTGAATAGG + Intergenic
1135681157 16:24458281-24458303 CTATTATTTTATGTTTAACGGGG + Intergenic
1137700273 16:50492890-50492912 AAATAATTTTATTTTAGATTTGG + Intergenic
1139030261 16:62872273-62872295 CTACAATTTTATTTTTATTTTGG - Intergenic
1139035685 16:62943654-62943676 CATTAATTTTATGTTTGAAATGG - Intergenic
1140008379 16:71103909-71103931 CTATATTTTTCTATTTGTTTAGG + Intronic
1140173671 16:72633463-72633485 CTTTTATTATATTTTTGATTAGG - Intergenic
1140458802 16:75121430-75121452 CTTTAATTTTATGTTTGATTTGG + Intergenic
1140705945 16:77629634-77629656 CTATAATTGAATGTCTCATTTGG - Intergenic
1140788242 16:78364172-78364194 CTATAATTTTATTTTGGGTTTGG + Intronic
1142370189 16:89675151-89675173 CTATAATTTTATCTTTGACTTGG + Intergenic
1144539393 17:16124886-16124908 ATGTAATTTAATTTTTGATTTGG - Intronic
1145873447 17:28296097-28296119 CTTTCATTTTATGTTTCATGGGG + Intergenic
1147433874 17:40394335-40394357 CTTTATTTTTATTTTTGAGTTGG + Intronic
1147575599 17:41597459-41597481 GTATAATTTAATTTTTGATGAGG + Intergenic
1148950244 17:51304614-51304636 CTATAATTTTATGTTTGATTTGG + Intergenic
1149472317 17:56927228-56927250 TTATAATTTTATGTTTGATCTGG + Intergenic
1151043000 17:70885794-70885816 GTATAGTTTTAATTTTGATTTGG + Intergenic
1151059610 17:71076686-71076708 CTATATTTTCATTTTTCATTTGG + Intergenic
1152316598 17:79584223-79584245 CTATTATTTTTTGATTGGTTGGG - Intergenic
1153108984 18:1561058-1561080 CTTGAATTTAATTTTTGATTTGG + Intergenic
1153109905 18:1573750-1573772 CTTTATTTTTATGATTGATGGGG - Intergenic
1153140575 18:1967853-1967875 TTTTCATTTTATGTTTGTTTAGG + Intergenic
1153556313 18:6317536-6317558 TTTTAAATTTTTGTTTGATTGGG - Intronic
1153620538 18:6973503-6973525 CTATAATATTATGGTTTGTTGGG - Intronic
1153846805 18:9057522-9057544 CTATAATTTTTTATTTTTTTGGG - Intergenic
1155131085 18:22934875-22934897 CTATAATTTCATTTTAGAGTTGG - Intronic
1155812653 18:30257794-30257816 ATACAATTTTATGTATAATTTGG - Intergenic
1156673845 18:39504047-39504069 CTATAGCTTTATGTTTATTTTGG - Intergenic
1156676587 18:39533971-39533993 TTGTAATTTTATGTTTTGTTAGG - Intergenic
1156925728 18:42575673-42575695 ATTCAATTTTATGTTTCATTGGG - Intergenic
1158131778 18:54160115-54160137 CTAGAATTTCATGTGTGATGAGG - Intronic
1158371562 18:56812386-56812408 CAATCATTTTATCTTTGAGTGGG + Intronic
1158624489 18:59059440-59059462 CCAAAATGTTATGTTTGATCTGG - Intergenic
1158746949 18:60211961-60211983 TTATAATTTTACCTTTGAATTGG + Intergenic
1159217523 18:65414244-65414266 CTGGTATTTTATGGTTGATTTGG + Intergenic
1159248269 18:65838213-65838235 CAATAATTTTATGTTAGGTCGGG - Intronic
1159457411 18:68678256-68678278 CTATATTTTTATGATTGCTTTGG + Intronic
1159533859 18:69690845-69690867 CTAAAATTTCATGTTTTAATTGG + Intronic
1160258743 18:77270591-77270613 CTAAAATTTGATGTTTCATGTGG - Exonic
1163219677 19:15908561-15908583 CTATAGTTTTATGTTTTAATGGG - Intergenic
1163941530 19:20499406-20499428 TTATAAATTTATGTTTGCTCCGG + Intergenic
1163953745 19:20614815-20614837 CTTTAATTTGACTTTTGATTTGG - Intronic
1164148543 19:22528789-22528811 CTTTAATTTGATTTGTGATTTGG - Intronic
1164397990 19:27882677-27882699 CAATAATTTTCTATTAGATTGGG + Intergenic
1165665564 19:37624494-37624516 TTATAAATTTCTTTTTGATTGGG - Intronic
1168438805 19:56345595-56345617 TTATAATTTTATGTTTGATTTGG - Intronic
1168697559 19:58413302-58413324 CCATAATTTTTTGTTTGTTGTGG + Intronic
927342057 2:21993543-21993565 CTATAATTCAATGTGAGATTTGG + Intergenic
928298722 2:30107336-30107358 CTATATCTTTTTGTTTGTTTTGG - Intergenic
928896074 2:36265002-36265024 TTAAAAGTTTCTGTTTGATTTGG + Intergenic
929201623 2:39243252-39243274 ATATAAATTCATGTTTGGTTTGG - Intergenic
929308435 2:40393835-40393857 TTATAATATTTTGGTTGATTGGG - Intronic
929326746 2:40621885-40621907 CTTTTATTTTATATTTAATTTGG - Intergenic
929534978 2:42776201-42776223 CTGTAATTTTATGTTTGACTTGG + Intronic
929984391 2:46712862-46712884 CTATAGTTTTTTGTTTGTTTTGG + Intronic
930004512 2:46885578-46885600 CAAGAATTTTATGTTTGTCTTGG + Intergenic
930767707 2:55101936-55101958 CTTTTCTTTTATATTTGATTTGG - Intronic
930950087 2:57130544-57130566 CTATTATTTTAAATTTGCTTAGG + Intergenic
931039719 2:58283849-58283871 CCATAATTGTATGTTTTCTTAGG + Intergenic
931173924 2:59833925-59833947 CTAGAATATTATGTTTCATGAGG + Intergenic
931735962 2:65194548-65194570 CTCTTATTTTATCTTTGAATTGG + Intergenic
932484449 2:72074674-72074696 CTATAAATTTATTTTTAACTTGG + Intergenic
933126614 2:78616320-78616342 TTATATTGTTTTGTTTGATTTGG + Intergenic
933498575 2:83083415-83083437 TTATTATTTTAAGTTTTATTCGG + Intergenic
933522924 2:83395718-83395740 TTAAAATGTTATATTTGATTAGG + Intergenic
933547064 2:83727983-83728005 TTCTAATTTTAGGTTTGGTTTGG + Intergenic
933903438 2:86865875-86865897 CAATATATTTTTGTTTGATTTGG - Intergenic
935152991 2:100455147-100455169 TTATGATTTTATGTTTGATTTGG + Intergenic
935533694 2:104267070-104267092 TTATTTTTTTATGTGTGATTTGG - Intergenic
935777074 2:106483079-106483101 CAATATATTTTTGTTTGATTTGG + Intergenic
935863078 2:107355011-107355033 AAATAATTTTATTTTGGATTTGG - Intergenic
935957817 2:108396264-108396286 CTATAATTTTATGTTTGATTTGG - Intergenic
936106090 2:109625818-109625840 CAATAATATTCTGTTTCATTTGG + Intergenic
936579118 2:113681081-113681103 TTATACTTTTATATTTGTTTTGG - Intergenic
938202914 2:129391117-129391139 CTATTATTTTAAGTTTGCTTTGG - Intergenic
939025479 2:137008569-137008591 CTATACTGTTTTGTTTGATGTGG + Intronic
939078939 2:137637033-137637055 CCATAATTTTATCTTTAATATGG + Intronic
939084544 2:137702693-137702715 CTTTAATTTGTTGATTGATTTGG - Intergenic
939155448 2:138519631-138519653 GCATAATTTTATGTCTGTTTTGG - Intronic
939183731 2:138834967-138834989 CTTTAATTTTTTGGTTGATGTGG + Intergenic
939339283 2:140872647-140872669 GTTTAATTTTATGTTTGATTTGG + Intronic
939423022 2:141998224-141998246 CTATAATTGTATGTTTAACTTGG + Intronic
939746837 2:145982872-145982894 TTTTAATTTTTTATTTGATTTGG + Intergenic
940121053 2:150266446-150266468 CTATAATTTAATGCTTCAGTAGG - Intergenic
940459838 2:153950908-153950930 TTATAATTTTATTTTAGATTCGG - Intronic
940988166 2:160070494-160070516 CTATAATTTTTTGTCTGATTTGG - Intergenic
941555222 2:166970731-166970753 CTATAAATTTATGTTAACTTAGG - Intronic
941705251 2:168651548-168651570 CTATAATTGTATGTTTCCTGAGG - Intronic
941781242 2:169448033-169448055 CTATAATATTGTGTTTTATTTGG + Intergenic
941845001 2:170123626-170123648 CAAAATTTTTATTTTTGATTTGG + Intergenic
941976523 2:171411222-171411244 CTTTAATTTTATAGATGATTTGG - Intronic
942782212 2:179657549-179657571 CTATAATTTAAAGTTAGATCTGG + Intronic
942879918 2:180846717-180846739 TTTTAATTTTATTTTTTATTAGG + Intergenic
943228642 2:185214695-185214717 CCATAATTTTAGGTCTTATTTGG + Intergenic
943799417 2:192039050-192039072 CTATAATGTTAAGTTAGATGGGG - Intronic
943857834 2:192821347-192821369 CTGTAATTGTTAGTTTGATTTGG - Intergenic
944023141 2:195129942-195129964 CTAAAAATTTCTGTTTGCTTTGG + Intergenic
944271636 2:197790059-197790081 CTATACTTTTATGTTTATCTTGG - Intergenic
944355464 2:198782525-198782547 CTAAAAAGTTTTGTTTGATTTGG - Intergenic
945494805 2:210497399-210497421 TTCAAATTTTATGTTAGATTTGG + Intronic
945692411 2:213054237-213054259 ATATAATTTTTTTTTTGAGTTGG - Intronic
945869052 2:215207140-215207162 CTGTAATTTTATGTTTGATTTGG + Intergenic
946082894 2:217140465-217140487 ATATATTTTTGTGTTTGCTTTGG + Intergenic
946951522 2:224880792-224880814 GTATAATTAAATATTTGATTTGG - Intronic
947085809 2:226451373-226451395 CTATAATTTTATAATTGATATGG - Intergenic
947340429 2:229132621-229132643 ATGTAATTAAATGTTTGATTAGG + Intronic
947366226 2:229397409-229397431 CTATAATTTTTTGTCTTGTTAGG - Intronic
948354770 2:237369260-237369282 ATATAATCTTAAGGTTGATTAGG - Intronic
949029431 2:241784940-241784962 TTATAATTTTATGTTTGATTTGG - Intronic
1170128319 20:12990014-12990036 CTATAAATATATGTATGTTTGGG + Intergenic
1170132447 20:13035529-13035551 TGATAATTTTATTTTTGTTTCGG - Intronic
1170135567 20:13069848-13069870 TTATAATTTTAGGTTTTATGAGG - Intronic
1170528083 20:17261018-17261040 CTAAGATGATATGTTTGATTGGG - Intronic
1171195350 20:23193180-23193202 CTATAATTTTTTAATTGATGGGG + Intergenic
1171308080 20:24123059-24123081 CTATAATATTACTTTTGCTTTGG - Intergenic
1171565914 20:26187206-26187228 CTATCTTTTCATGTTTGATTTGG + Intergenic
1173312348 20:41908922-41908944 CTTTAAATTTATAATTGATTTGG + Intergenic
1173355529 20:42284291-42284313 CAATACTTTTATTTTTGGTTGGG - Intronic
1174654942 20:52163375-52163397 CTATAATTTTTGTTTTGTTTTGG - Intronic
1176974142 21:15299632-15299654 ATATATTTTTATATTTGACTTGG + Intergenic
1177096731 21:16844922-16844944 CTATAATTTTATCTAGTATTTGG - Intergenic
1177295573 21:19169885-19169907 CTAAAATCTTCTGGTTGATTGGG - Intergenic
1177361084 21:20072389-20072411 CTATAATTTTATCCTTGAGAAGG - Intergenic
1177568274 21:22851959-22851981 CTATAAAAATATGTTAGATTGGG - Intergenic
1177589393 21:23143473-23143495 CTCTAATTTTATGTTTCATTTGG - Intergenic
1177784192 21:25652712-25652734 CTATAATGTTCTATCTGATTTGG + Intronic
1178048801 21:28726223-28726245 GTATATTTTTAAGTTTTATTTGG + Intergenic
1178071327 21:28970742-28970764 CTATAATCTTTTGTTTGGTTAGG - Exonic
1178113722 21:29395930-29395952 CAGTATTTTTATGTTTGAATAGG - Intronic
1178201543 21:30412630-30412652 ATATTATTTTATTCTTGATTTGG - Intronic
1178911322 21:36675921-36675943 TGATAATTTGATGTTTTATTTGG - Intergenic
1179130639 21:38633565-38633587 GAATTATTTTATGTTTGGTTGGG + Intronic
1180917839 22:19501193-19501215 CCATAATTTTTTGTTTGTTTTGG - Intronic
1184917527 22:47580761-47580783 TAATAATTTTATCTTTGATTTGG + Intergenic
949114235 3:300315-300337 CTAAAGTTTTTTGTTTGAGTTGG + Intronic
949192970 3:1271920-1271942 CTACAATTTAATGTGGGATTTGG - Intronic
950918902 3:16672773-16672795 CCATAACTTTATGTTTGATTTGG + Intergenic
951360345 3:21717577-21717599 CTACAATTTAATGTGAGATTTGG - Intronic
951531668 3:23704026-23704048 CTATAGCTTTATGTATTATTTGG - Intergenic
952238384 3:31504449-31504471 CTATGCTGTTATGTTTGAGTTGG + Intergenic
952348740 3:32513783-32513805 CAATACTTTTTTGTTTGTTTGGG + Intergenic
952607141 3:35162074-35162096 CTATATATATATATTTGATTTGG + Intergenic
952639226 3:35571667-35571689 CTATAATTTTATATTATTTTGGG - Intergenic
953009319 3:39009556-39009578 TTATAATTGTTTGTTTGCTTTGG - Intergenic
953261145 3:41340160-41340182 AAATTATTTGATGTTTGATTGGG + Intronic
953363225 3:42319263-42319285 CTTTTATTTTTTGTTTCATTTGG - Intergenic
953709904 3:45261191-45261213 TTATATTTTTATTTTTCATTAGG + Intergenic
954475168 3:50737488-50737510 ATATAATTTGATGTGAGATTTGG + Intronic
954597200 3:51836322-51836344 CTGTAATCTTAAATTTGATTTGG - Intergenic
954650633 3:52160087-52160109 CTATAATTTTATGTTTGATTTGG + Intergenic
954770655 3:52965162-52965184 CTAAAATTTTATTTTTGAGCTGG - Intronic
955042273 3:55329247-55329269 CTGTACTTTCATGTTTGCTTAGG - Intergenic
956927803 3:74008349-74008371 CTCTGATTTTTTGTTTTATTTGG - Intergenic
957589930 3:82183251-82183273 TTAAAATTTTATGTTTGCTTAGG + Intergenic
957774071 3:84733018-84733040 TAATATTTATATGTTTGATTTGG + Intergenic
958567846 3:95837182-95837204 CTATAATTTGATATAAGATTTGG + Intergenic
958568783 3:95852667-95852689 ATATAATTTTATGCTTGATTTGG + Intergenic
958576571 3:95956673-95956695 TTATATTTTTATTTATGATTTGG - Intergenic
958585535 3:96082420-96082442 ATATAATTTTGATTTTGATTTGG - Intergenic
958683431 3:97360571-97360593 CTTTAATTTTGTGTCTGGTTTGG + Intronic
959304096 3:104637679-104637701 CTATCAGTTTTTGTTTGTTTGGG - Intergenic
959702176 3:109308867-109308889 AAATAATTTTTTGTTTGTTTTGG - Intronic
960633530 3:119758005-119758027 CTATAATTTTTTGTTTTTTATGG + Intronic
960745904 3:120888326-120888348 CTATTATTTAATTTTTGACTTGG + Intergenic
961419973 3:126795560-126795582 CTAGAATTCTAGGTTTGAGTTGG - Intronic
961419977 3:126795587-126795609 TTAAGATTTTATGTTTGGTTTGG + Intronic
963054196 3:141171282-141171304 ATATATTTTTCTGTTTGCTTGGG + Intergenic
963341502 3:144040082-144040104 CTATAATTTTTTATGTTATTTGG + Intronic
963441840 3:145349874-145349896 CTATAATTTTGTGTTTCAAGTGG + Intergenic
963753671 3:149210577-149210599 TTATTTTTTTATATTTGATTGGG + Intronic
963760470 3:149283360-149283382 GTTTAATTTTATGTTTAATTTGG + Intergenic
963855379 3:150247893-150247915 CTCTAATTTGATGTTTGAATGGG + Intergenic
963896457 3:150690201-150690223 TTATAATTTTATGTTTGATTTGG + Intronic
964106311 3:153043638-153043660 CTATTTTTTTATGTGTTATTTGG + Intergenic
964457828 3:156887112-156887134 TTGTAATTTTCTTTTTGATTGGG + Intronic
964921289 3:161898782-161898804 CTACAATTTTATGTCTGAAATGG + Intergenic
964995956 3:162881608-162881630 TTATAATTTTATGTGAGAGTTGG - Intergenic
965107359 3:164373863-164373885 TTAGAATATTATGTTTAATTTGG + Intergenic
965205021 3:165711733-165711755 CTATTAGTTTATGTTTAATTGGG + Intergenic
965349044 3:167590761-167590783 CTGTACTTTTATATTTTATTTGG + Intronic
965700876 3:171458830-171458852 TTTTAATTTTATTTTTGGTTCGG + Intronic
966038049 3:175444887-175444909 CTAAAATATTATATTTGGTTTGG - Intronic
966284779 3:178282035-178282057 ATATAATTTTATGCTACATTTGG - Intergenic
966587795 3:181646766-181646788 ATATATTTTCATGTATGATTTGG - Intergenic
967244561 3:187472227-187472249 CTATAATTTTATATTTGATTTGG + Intergenic
967537124 3:190618676-190618698 TTATAAGTTTATGTCAGATTTGG - Intronic
967660335 3:192100182-192100204 CTGTAATTGTTTGTTTGTTTTGG - Intergenic
968025024 3:195434396-195434418 CTAATTTTTTTTGTTTGATTTGG + Intronic
968043185 3:195605301-195605323 GCATAATTTTATGTTTGATTTGG + Intergenic
970328108 4:14949510-14949532 CTATAATTCAATCTTTCATTAGG - Intergenic
970358911 4:15286847-15286869 CTATACTTTTAAATTTGTTTAGG + Intergenic
971076843 4:23158889-23158911 CTATAATTTTATGTGTTCTGAGG + Intergenic
971090492 4:23337738-23337760 CTGTAATCCTATGATTGATTAGG - Intergenic
971483856 4:27139840-27139862 CTTTAATTCTAAGTTTGATAAGG - Intergenic
971649446 4:29253768-29253790 CATTAATTTTATTATTGATTTGG + Intergenic
971692880 4:29860060-29860082 CTATAATTTTATGCTTCATTTGG + Intergenic
971700300 4:29964435-29964457 CTATAATTTTATTTTTTATTTGG + Intergenic
971703587 4:30012000-30012022 TTATAAATTTCTCTTTGATTGGG + Intergenic
971913583 4:32828677-32828699 CTATACTTTTATGTTTGATTTGG - Intergenic
972029391 4:34434175-34434197 CTATCTTTTCATGTTTTATTTGG + Intergenic
972405436 4:38741996-38742018 TTATTATTTTATTTTTCATTCGG - Intergenic
972645192 4:40961306-40961328 CTATATGTTTGTGTTTGAATAGG - Intronic
972650117 4:41009022-41009044 ATGTAATTTTATGTTTAGTTTGG - Intronic
972887249 4:43507909-43507931 CAATAATCTGATTTTTGATTAGG - Intergenic
973082192 4:46007321-46007343 ATATTATTTTATATTTGAGTGGG - Intergenic
973245787 4:48010200-48010222 CTATAATTTTATGTTTGATTTGG - Intronic
973306342 4:48655628-48655650 ATATAATTATATATTTGTTTGGG - Intronic
973797577 4:54444044-54444066 CTATAATTATATGGTTCCTTTGG - Intergenic
974139356 4:57864807-57864829 CTGTACTTTAATCTTTGATTTGG + Intergenic
974233594 4:59150121-59150143 CTATAATTTTAGATTTCATGAGG - Intergenic
974344522 4:60661924-60661946 CCATAATTGTAAGTTTGATGAGG + Intergenic
974678691 4:65132842-65132864 CTACAATTTGAGGTTTGGTTGGG - Intergenic
974935769 4:68407917-68407939 CTGTAATTTTATGTTTGATTTGG + Intergenic
975051376 4:69868862-69868884 CTGTAATTTTATGTTTGATTTGG + Intergenic
976012790 4:80511806-80511828 CTGTTATTTTATGCTTGGTTTGG - Intronic
976035547 4:80815708-80815730 ATTCATTTTTATGTTTGATTTGG - Intronic
976125679 4:81831713-81831735 CTGTAATTTTATCATTTATTTGG - Intronic
976162010 4:82211542-82211564 TTTTAATTTTTTTTTTGATTTGG - Intergenic
976431630 4:84968037-84968059 ATATATTTTTAGGTTTGTTTTGG - Intergenic
976618494 4:87102702-87102724 CTATAAATTTTTTTTTAATTAGG - Intronic
977427304 4:96883668-96883690 CTATAATTTTAAATCTGTTTTGG - Intergenic
978182997 4:105824309-105824331 CAATAATTTTGTGATTGAGTAGG + Intronic
978355198 4:107864865-107864887 CTATAAGTGTATGTTGGTTTGGG + Intronic
978357196 4:107889842-107889864 TTATAATTTTATGTTCGATTTGG - Intronic
978422460 4:108547245-108547267 TTATAAATTTCTTTTTGATTGGG - Intergenic
979318299 4:119293374-119293396 CTTTAATTTTATGTATCACTAGG - Exonic
979385619 4:120062334-120062356 CTATGCTTTTATGTTGGATTAGG - Intronic
979503451 4:121466745-121466767 CTTTGATTTTATGATTGTTTGGG + Intergenic
979881074 4:125961320-125961342 CAATATTTTTTTGTTTGGTTTGG - Intergenic
979922637 4:126519986-126520008 TTAGAATTTTATGTGTTATTTGG + Intergenic
980079413 4:128328161-128328183 CTGTAATTTTTTGTTTAAATCGG + Intergenic
980144511 4:128965102-128965124 CTATGATTATAGTTTTGATTTGG + Intronic
980298681 4:130958457-130958479 ATATGATTTGATTTTTGATTTGG + Intergenic
980471691 4:133261626-133261648 GTTTAATTTTATGTATAATTTGG - Intergenic
980523067 4:133956969-133956991 CTACAATTTTAGATGTGATTTGG + Intergenic
980581068 4:134751651-134751673 CTGTAATTATATGTTTAATTTGG - Intergenic
980673409 4:136041716-136041738 CTTTATTTTTATGTTTTATTAGG + Intergenic
981994450 4:150960704-150960726 CTTTAGTTTTATATTTGTTTTGG + Intronic
981998680 4:151002263-151002285 CTGTAAATTTGTTTTTGATTGGG - Intronic
982196898 4:152925534-152925556 CTATAATTTTATGTTTGATTTGG - Intergenic
982414982 4:155120421-155120443 ATATAATTTTATGTTTGACTTGG - Intergenic
982475568 4:155845717-155845739 CTATAATTTTATGTTAGATTTGG + Intronic
982556821 4:156877523-156877545 CTAACATTTTTTGCTTGATTTGG - Intronic
982756349 4:159223531-159223553 TTATTATTTTATGGTTCATTAGG + Intronic
982963603 4:161873422-161873444 CAATAATTTTATATTTGAGTTGG - Intronic
982998161 4:162378254-162378276 CTATAATTATTTTTTTAATTTGG - Intergenic
983133963 4:164056757-164056779 TAATAATTTTATATTTGAATTGG + Intronic
983394314 4:167174138-167174160 ATATAGTTGTATGTTTTATTTGG - Intronic
983450877 4:167909767-167909789 CTATGTTTATATGTTTGATTGGG - Intergenic
983585268 4:169347563-169347585 ATAGAATGTTATGTTTTATTGGG - Intergenic
983733847 4:171032571-171032593 CAATTTTTTTATGTTTTATTTGG - Intergenic
983787864 4:171757754-171757776 CTAAAATTTTAACTTTGTTTTGG - Intergenic
983810084 4:172050780-172050802 CTTTAATTCTATGTTTGGGTGGG + Intronic
984170745 4:176356519-176356541 GTATATTTTTACGTTTGATTTGG - Intergenic
984328071 4:178278789-178278811 CCACAATTTTATTTTTTATTTGG - Intergenic
984396633 4:179210276-179210298 CTATGATTTTTTTTTGGATTTGG + Intergenic
984416950 4:179473521-179473543 ATATAATTTCATGTATTATTTGG - Intergenic
984503520 4:180588538-180588560 CTATTACTTTATATTTGAGTAGG + Intergenic
984706729 4:182852709-182852731 CTTTATTTTCATGTTTGGTTGGG + Intergenic
986365873 5:7030967-7030989 CTATAGTTTTATGTTTAATTTGG - Intergenic
986535159 5:8778944-8778966 CTAATATTTTTTGTTTGTTTTGG + Intergenic
986956008 5:13150239-13150261 CTCTAAGTTTATGATTAATTGGG + Intergenic
986970189 5:13325397-13325419 CTATATTCTTAAATTTGATTTGG - Intergenic
987463217 5:18239933-18239955 CTTTTATTTTATATTTTATTTGG + Intergenic
988001576 5:25356527-25356549 CTATAAGTTTATGTTTTTATTGG + Intergenic
988158703 5:27491202-27491224 CAATAATTTGTTGTTTGTTTTGG + Intergenic
988207301 5:28156520-28156542 TTATAATATTATATTTTATTTGG + Intergenic
988405046 5:30813686-30813708 CTTTATCTTTATATTTGATTGGG - Intergenic
988633806 5:32959691-32959713 AGATAAGTTTATGTTGGATTTGG + Intergenic
988769149 5:34413555-34413577 CTATAATTTTATGTTTGACTTGG + Intergenic
988774854 5:34468600-34468622 CTGTAATTTTATGTTTGATTTGG - Intergenic
988789472 5:34594075-34594097 CTCTAACTTTTTGTTTCATTTGG + Intergenic
988904121 5:35768141-35768163 TTATTATATTATGTTTGATGTGG - Intronic
989316619 5:40087747-40087769 CTACAATTTTAAGTTTGATTTGG + Intergenic
989719429 5:44506468-44506490 GGATTATTTTATGTTTTATTTGG + Intergenic
989728732 5:44621858-44621880 TTTTAATTTTATTTTTTATTGGG - Intergenic
990162607 5:52958774-52958796 ATATAACTTTATGTTAGATCAGG - Exonic
990675952 5:58184869-58184891 TTTAAATTTTATTTTTGATTCGG - Intergenic
990749632 5:59000401-59000423 CTATGCTTTTATGTTGGATGAGG - Intronic
991307909 5:65200580-65200602 CTAGAATTTTGTTTTTGATTAGG - Intronic
991521224 5:67499231-67499253 TTATAATTTTATATGTTATTTGG - Intergenic
992429826 5:76698874-76698896 CTATAATTTTATGTATTCCTGGG + Intronic
993415102 5:87618303-87618325 CTGAAATCTTATGTATGATTTGG - Intergenic
993827855 5:92714645-92714667 CTCTAATTTTATGTTAAATGAGG + Intergenic
993922279 5:93820300-93820322 CTTTAATTTTTTATTTAATTTGG - Intronic
994465898 5:100130498-100130520 CTATCATTTTAAGTCTGACTAGG - Intergenic
995009231 5:107239356-107239378 CTACAATTTAATATGTGATTTGG - Intergenic
996579857 5:125019063-125019085 CTATACCTTTAAGTGTGATTGGG - Intergenic
997054706 5:130427867-130427889 CTATTATTTTAAATTTGATAAGG - Intergenic
999052669 5:148540359-148540381 CTAAAATTTTATTTTAGGTTTGG - Intronic
999358474 5:150959558-150959580 CTATAACTTAATGTTTGATTTGG + Intergenic
999750242 5:154623162-154623184 CTTTAATTTTCTGTTTTTTTAGG - Intergenic
999887930 5:155944247-155944269 CTATAATTTTTCCTTTGTTTGGG - Intronic
1000127178 5:158257193-158257215 CTATATGTTTAGGATTGATTAGG - Intergenic
1000481618 5:161783339-161783361 ATCTAATTTTTTGTTTGTTTTGG + Intergenic
1000572352 5:162930414-162930436 CTATTATTTTTTATATGATTAGG - Intergenic
1000759199 5:165201102-165201124 CTTTTATTATATTTTTGATTAGG + Intergenic
1000807467 5:165813782-165813804 CTATAATTTTAGTTTTCATAGGG - Intergenic
1005224783 6:23629723-23629745 TTATAATTTTATGTTGTATGTGG - Intergenic
1005332969 6:24766546-24766568 CTATAATTTTTTATTTGCCTGGG - Intergenic
1005370848 6:25130979-25131001 CTATAATTTTATGTTTAATTTGG + Intergenic
1006635896 6:35460877-35460899 ATTTAATTTTATTTTTGAATAGG + Intronic
1006714487 6:36107221-36107243 TTTTTATTTTATTTTTGATTTGG - Intronic
1007886066 6:45232069-45232091 GTGTAAATTTATTTTTGATTGGG + Intronic
1008174912 6:48255834-48255856 CAAAAATTTTAGGTATGATTAGG + Intergenic
1008373737 6:50767496-50767518 CTATAGTTTTACATTTGTTTGGG + Intronic
1008650641 6:53557823-53557845 CTATAATTTTATGTTTGATTTGG + Intronic
1008720813 6:54349009-54349031 CAATATTATTATGTTTGAATTGG + Intronic
1009286969 6:61830912-61830934 CTATTATTTTATATATCATTAGG + Intronic
1009544242 6:65004025-65004047 CTATAAATTTATATTTTTTTAGG + Intronic
1009550955 6:65090358-65090380 CCATAATTGTATGTTTCCTTAGG + Intronic
1009749106 6:67860565-67860587 CTCTAATTTTATGTTTGACGTGG - Intergenic
1009873215 6:69473765-69473787 CTATAATAATATCTTTGACTAGG - Intergenic
1010026017 6:71218094-71218116 CTATTATTTCATGTTGAATTGGG + Intergenic
1010424791 6:75716850-75716872 CAATTATTTTATTTTTAATTTGG + Exonic
1011131209 6:84053357-84053379 TTATCATTTTATTTTTGAGTTGG + Intronic
1011286317 6:85727972-85727994 CTATAATTTTATGATTGACTTGG - Intergenic
1011481028 6:87794247-87794269 CTATAATTTTTTGTTTATTTTGG + Intergenic
1011871025 6:91892879-91892901 CTACAATTTTCTGTTTGTTTTGG + Intergenic
1011965203 6:93147954-93147976 CTATAACTTTATCCTTCATTAGG + Intergenic
1012056115 6:94412873-94412895 ATTTCATTTTATGTTTGCTTCGG + Intergenic
1012095306 6:94949757-94949779 CTCTTATTTTATATTTGTTTTGG - Intergenic
1012853331 6:104472583-104472605 CCATAATTTTCTGTTTGAGATGG - Intergenic
1013703291 6:112799707-112799729 CTGTCCTTTTATGTGTGATTTGG - Intergenic
1014133285 6:117859256-117859278 GTTTAATTTTATGTTTAATTTGG - Intergenic
1014579335 6:123116430-123116452 CTATAATTTTATGTGTGTTAAGG - Intergenic
1014619206 6:123645001-123645023 CTATAATTTTGTTTTTGCTTTGG + Intergenic
1014633926 6:123821444-123821466 CTAAAATTTATTTTTTGATTTGG + Intronic
1014720032 6:124905155-124905177 TTATCATTTTATTTTTGTTTAGG - Intergenic
1014941115 6:127440143-127440165 AAATAATTTTTTGTTTTATTGGG - Exonic
1016068584 6:139709791-139709813 CTATATTTTTATTTTGGCTTTGG + Intergenic
1016268459 6:142259223-142259245 AAATATTTTTATGTTTTATTTGG + Intergenic
1016648768 6:146440033-146440055 CTAGAATCTTATATTTGATAAGG + Intergenic
1016711218 6:147174443-147174465 CTATAATTTTATGTATTTGTAGG - Intergenic
1017093626 6:150783882-150783904 CTAAATTTTTTTGTTTGTTTTGG + Intronic
1017363185 6:153600840-153600862 ACATGATTTTATGTTTAATTTGG + Intergenic
1017398923 6:154037123-154037145 CTATAAATTTATAGTTGCTTTGG - Intronic
1018179650 6:161210200-161210222 CTATGATTTTACATTTGATTTGG + Intronic
1018193379 6:161331519-161331541 CTATAGTTTCATGTTTGATTTGG + Intergenic
1018202839 6:161411188-161411210 CTATAATTCAATGTGAGATTTGG - Intronic
1018415243 6:163595419-163595441 CTCTAATTTTTTGTCTTATTTGG - Intergenic
1019069944 6:169337056-169337078 CTATACTTTTACGTTTGATCTGG - Intergenic
1020340656 7:7106235-7106257 GTTTAATTTTATGTTTCATTTGG + Intergenic
1020460795 7:8427448-8427470 TGGTAATTTTATGTTTGATGTGG + Intergenic
1020637035 7:10708911-10708933 GGATAATTTTATATTTGACTGGG + Intergenic
1020727907 7:11839940-11839962 GTATACTTTTTTGTTTGGTTTGG - Intergenic
1020817865 7:12928219-12928241 CTCTAATTATATGTTTGCTGTGG - Intergenic
1020856247 7:13428020-13428042 CTAACATTTTTTGTTTAATTTGG - Intergenic
1020992979 7:15224756-15224778 CCATAATTTTATATTTCCTTGGG - Intronic
1021119242 7:16779408-16779430 TTATAATTTTAAATTTAATTTGG + Intronic
1021161852 7:17283359-17283381 ATATAATGTTATCTTTGATATGG + Intergenic
1021205950 7:17781232-17781254 ATATATTTTTATGTATGATGTGG - Intergenic
1021208727 7:17817061-17817083 CTATGAGTTTATGTTTAATGTGG - Intronic
1021666794 7:22990275-22990297 CTATAATTTTATCTTTTCTTTGG + Intronic
1021877713 7:25064143-25064165 CTATAAATATATGTTTCATGAGG - Intergenic
1022457383 7:30570002-30570024 CTATAATTTTATGTTTGATTTGG + Intergenic
1022941709 7:35248450-35248472 CTTTAAGTTTATGTTTCGTTAGG - Intronic
1023235247 7:38079320-38079342 TTTTAATTTTATGTTAGATAAGG - Intergenic
1024169479 7:46769122-46769144 CTATAATTCTAGGTGAGATTTGG + Intergenic
1024702714 7:51922074-51922096 TTGTACTTGTATGTTTGATTTGG + Intergenic
1024821756 7:53338964-53338986 TAATAATTTTATGCTTGATTTGG + Intergenic
1024878662 7:54058491-54058513 ATTTAATTTTATGATTCATTTGG - Intergenic
1024906794 7:54392339-54392361 CTATAATTTTATGTTTGATTTGG - Intergenic
1024998897 7:55297167-55297189 CTATAATTTTATGTTTGATTTGG - Intergenic
1025797344 7:64751674-64751696 CTATAATCTTTTGTTTGATCTGG - Intergenic
1026650601 7:72212813-72212835 CTTTATTTTTATGTTTTCTTAGG - Intronic
1026654233 7:72242881-72242903 TTTTAATTTTATTTTTGAGTTGG - Intronic
1027641059 7:80734409-80734431 ACATAATTATTTGTTTGATTCGG + Intergenic
1027905271 7:84172839-84172861 CTATTGTTTTATTTTTGTTTTGG + Intronic
1028038065 7:86010675-86010697 ATGTAATTTGATGTTTCATTGGG + Intergenic
1028050732 7:86182129-86182151 TTAAAATTTTATGTTTATTTTGG - Intergenic
1028062249 7:86336837-86336859 CATAAATTTTATGTTTGTTTTGG + Intergenic
1028308188 7:89293394-89293416 CTTTTATTTTATTTTTAATTGGG - Intronic
1028334424 7:89634053-89634075 ATATAATATTTTGTTTGATATGG - Intergenic
1028334444 7:89634513-89634535 ATATAATATTTTGTTTGATATGG - Intergenic
1029256261 7:99271696-99271718 CTTAAATTTTATTTTTGAGTGGG + Intergenic
1030431154 7:109450908-109450930 CTCTGATTTTATATTTTATTTGG + Intergenic
1030752316 7:113242773-113242795 CAATGATTTTAAGTTTCATTAGG + Intergenic
1030942168 7:115666343-115666365 CCATAATTCTATATTTGATGGGG + Intergenic
1031021353 7:116631518-116631540 CTACTATTTTCTGTTTGATCTGG + Intergenic
1031122412 7:117737184-117737206 CTAAAATTCTATGTTTCTTTGGG + Intronic
1031160358 7:118160189-118160211 CTAGAATTTTATGTGTGACTTGG - Intergenic
1031289933 7:119921629-119921651 CTTTTATTTCATTTTTGATTTGG - Intergenic
1031403110 7:121349392-121349414 CTATATTTTTATGTAGAATTGGG + Exonic
1032200182 7:129815855-129815877 CCTTAATTTTATTTTTGGTTTGG + Intergenic
1032749360 7:134822237-134822259 CTAGAATTTTCTGTTTCATGAGG + Intronic
1033400477 7:141018459-141018481 ACATAATTTTATTTTAGATTTGG + Intergenic
1034045890 7:147926588-147926610 CTTTAATTTTAATTTTAATTTGG - Intronic
1034108224 7:148510111-148510133 CTAAAATTTTATTTAGGATTGGG + Intergenic
1034233319 7:149549389-149549411 TTATTATTTTTTGTTTGTTTCGG - Intergenic
1034758901 7:153652375-153652397 CCAGAATTTTATGTTTGTTATGG - Intergenic
1035865045 8:3072981-3073003 TTATGATTTTATTTTTCATTAGG - Intronic
1035965103 8:4182876-4182898 CTAGAACTGTATGTTTGAATGGG + Intronic
1036103367 8:5812442-5812464 CTAGAATTTCCTGTTTAATTTGG - Intergenic
1036712321 8:11088279-11088301 TTATCATTTTATGTCAGATTGGG - Intronic
1037361381 8:18078214-18078236 CTGTAATTTGATGTTTATTTTGG - Intronic
1037868739 8:22470925-22470947 ATATAATTCTATGTGTGCTTTGG - Intronic
1038063028 8:23933096-23933118 TTATTACTTTATGTTTGATTTGG + Intergenic
1038162156 8:25050034-25050056 CTATAAGTGTCTGTTTCATTAGG - Intergenic
1038204379 8:25451426-25451448 CTATCATTTTATGATTTATTTGG - Intronic
1038210592 8:25515994-25516016 CTAGAATTTTATGTTTCAAAGGG - Intergenic
1039358261 8:36845396-36845418 TTGTAATTCTTTGTTTGATTGGG - Intronic
1039535301 8:38305851-38305873 CTGTAATTTTCTTTTTTATTAGG - Intronic
1039663204 8:39489680-39489702 TTATTATTTTATGTTTTCTTTGG + Intergenic
1039809337 8:41031555-41031577 CTATAATTTTATCTTCAATGTGG + Intergenic
1040542142 8:48369292-48369314 CTATAATTTTCTTTCTGTTTGGG + Intergenic
1040671755 8:49699916-49699938 AAATAATTTTATATTTGATAGGG - Intergenic
1042095428 8:65210774-65210796 ATTTAATTTTATTTTGGATTTGG - Intergenic
1042451622 8:68954340-68954362 TTGTAATTTTATATTTGAGTGGG - Intergenic
1042676220 8:71325182-71325204 ATGTACTTTTATGTCTGATTTGG + Intronic
1042881875 8:73502173-73502195 CAATAATTTTTTATTTAATTGGG - Intronic
1042899593 8:73710240-73710262 CTACTATTTTATGTTTGTTTGGG + Intronic
1043071972 8:75648381-75648403 ATATAATTTTATTTTTTCTTTGG + Intergenic
1043548553 8:81342505-81342527 CCAGCATTTTATCTTTGATTAGG + Intergenic
1043693840 8:83193300-83193322 CTATACATTTATTTTTAATTTGG + Intergenic
1043778957 8:84307396-84307418 CTCTAATTTTCTGTTTCATCTGG - Intronic
1044083437 8:87913583-87913605 GTATATTTTTAGGCTTGATTCGG - Intergenic
1044350782 8:91163927-91163949 CTGAATTTTTATTTTTGATTTGG - Intronic
1045140584 8:99277771-99277793 TTAGAATTTTATGCTTCATTTGG + Intronic
1045668070 8:104512928-104512950 CTATGGTTTTGTTTTTGATTAGG - Intronic
1045847331 8:106653384-106653406 GTATAATATGATGCTTGATTTGG - Intronic
1045850361 8:106688996-106689018 CTACATTTTTATTTTTGCTTTGG - Intronic
1046117385 8:109800561-109800583 GTATACTTTTATATTTGAATTGG + Intergenic
1046339611 8:112836021-112836043 CTATACTTTTATATTGGATTTGG + Intronic
1046390082 8:113559655-113559677 ATATAAATTTAGGCTTGATTGGG - Intergenic
1046432480 8:114146556-114146578 CTTTAATTTTATTCTTGATTAGG + Intergenic
1047260333 8:123252638-123252660 ATATAAATTCATGTTTGCTTAGG - Intronic
1047560662 8:125984778-125984800 TTACAATTTTATTTTTGACTTGG - Intergenic
1047710680 8:127549065-127549087 CTTTAATTTTGTGTGTTATTTGG + Intergenic
1047728962 8:127710067-127710089 GTATAATATTTTGTTTGCTTAGG + Intergenic
1047910450 8:129522763-129522785 CTGTAATTTTATTTTTTTTTTGG - Intergenic
1048379868 8:133855852-133855874 CTATAATTTTATATTGGAGGAGG - Intergenic
1048570097 8:135645339-135645361 CTTAAATTTTATGTTTGAGTTGG + Intronic
1049448766 8:142647074-142647096 TATAAATTTTATGTTTGATTTGG - Intergenic
1049947042 9:607032-607054 TTCTAATTTTATGTTTTCTTGGG + Intronic
1050305693 9:4303831-4303853 CTATGAATTTATGTTTGTTATGG - Intronic
1050607101 9:7313819-7313841 CCATGAATTTATTTTTGATTAGG + Intergenic
1050861374 9:10436724-10436746 CTATTATTTCCTGTTTTATTTGG + Intronic
1051028920 9:12650036-12650058 CTTTAATTTCTTGTTTTATTTGG - Intergenic
1051609141 9:18944394-18944416 CTGTAAGATTATGTGTGATTGGG - Intronic
1052482948 9:29055563-29055585 CTTTAATTTTTTATTTGAATAGG + Intergenic
1053075338 9:35128380-35128402 TCATAGTTTTATGTTTGATCTGG + Intergenic
1053511328 9:38690229-38690251 CCATAACTTTATGTTTGACAAGG - Intergenic
1054786772 9:69217682-69217704 CTATAATTTTATTTTTTAAGAGG - Intronic
1055165787 9:73191256-73191278 TTATTATTTTATGTTTTCTTTGG + Intergenic
1055190607 9:73517392-73517414 CTTTAAGCTTATGTTTGGTTTGG - Intergenic
1056074981 9:83029199-83029221 GTATGATTTTATGGTTGATCAGG - Intronic
1056339420 9:85610639-85610661 CTGTAATTTTTTTTTTGATTGGG - Intronic
1057346153 9:94252538-94252560 TTCTACTTTTATGTTTTATTTGG - Intergenic
1057359252 9:94358346-94358368 CTATAATTTTTTTTTTGAGATGG + Intergenic
1057648512 9:96899244-96899266 CTATAATTTTTTTTTTGAGATGG - Intronic
1058200584 9:102034471-102034493 CTAAAATATGATGTATGATTGGG - Intergenic
1058271588 9:102978846-102978868 ATATAATTATGTGTATGATTTGG + Intergenic
1059818577 9:117946583-117946605 CTATAAACTTGTGTTTGGTTGGG + Intergenic
1060864585 9:126985463-126985485 CTATAATGTTATATTTGAATTGG - Intronic
1060888548 9:127173527-127173549 TTATAATTTTTTGTTGGTTTTGG + Intronic
1061342794 9:129996603-129996625 TTATATTTTTATATTTGAGTTGG - Intronic
1061719088 9:132540641-132540663 ATATATTTTTATGCTGGATTTGG + Intronic
1186268673 X:7860560-7860582 CTATAATTTTATCTCTTAGTGGG + Intergenic
1186394840 X:9197249-9197271 CTCTAATTTTCTATTTTATTAGG - Intergenic
1186602916 X:11057416-11057438 CTTTAACTTAATGTTTAATTAGG + Intergenic
1186783608 X:12938687-12938709 CTATAAATTTATGTTTGATTTGG - Intergenic
1187816340 X:23236260-23236282 CTGTAATTTTATGCTTGATTTGG + Intergenic
1188284097 X:28306673-28306695 CTACAATTTTATATTTGCTCGGG + Intergenic
1188570147 X:31574783-31574805 TGTTAATTTTATGTCTGATTTGG - Intronic
1188583748 X:31747816-31747838 GTTTAATTTTCTGTTTTATTAGG + Intronic
1188836662 X:34965799-34965821 TAATTATTTTATGTTTAATTAGG + Intergenic
1189349916 X:40268410-40268432 CTAAACTTTTTTGTTTGTTTTGG + Intergenic
1190826605 X:54023704-54023726 CTAAATTTTTTTGTTTGTTTTGG - Intronic
1190956318 X:55198077-55198099 CTGTAATTCTATGTTTAATTTGG - Intronic
1190990996 X:55550290-55550312 CTATATTTTTCTCTTAGATTAGG + Intergenic
1191167817 X:57409354-57409376 CTGTAATTTTATTTTTTATCTGG + Intronic
1193002717 X:76581212-76581234 CTATAATTTTACGTTTGCTGAGG + Intergenic
1193265121 X:79458679-79458701 CTATAATTTTATGTCTGATTCGG + Intergenic
1193319216 X:80100381-80100403 CTATAATTTTATGTTTGACTTGG + Intergenic
1193474850 X:81950596-81950618 CTATAATTTTATGTTTGATTTGG + Intergenic
1193508561 X:82372174-82372196 AGAGCATTTTATGTTTGATTAGG - Intergenic
1193532079 X:82667924-82667946 CTATAATTTTATGTTTGATTTGG - Intergenic
1193566994 X:83088834-83088856 CTAAAATTTTATTCTTGATTTGG + Intergenic
1193850770 X:86535114-86535136 GTTTAATTTTATGTTTTTTTAGG + Intronic
1193958623 X:87895328-87895350 ATAGAAATTTATGTTTGATTTGG + Intergenic
1194074686 X:89374873-89374895 CTATAATTAAATGTTACATTTGG - Intergenic
1194131023 X:90081883-90081905 ATATAATTTTATGTTTAACTTGG + Intergenic
1194200276 X:90945959-90945981 CTATAATTTCATGTTTGATTTGG + Intergenic
1194451451 X:94048833-94048855 CTATAATTTTGTGTTTGATTTGG - Intergenic
1194542619 X:95192869-95192891 ATATAATTTTATTTCTGATTTGG + Intergenic
1194817534 X:98462650-98462672 CTATCATTTTATCTAGGATTGGG + Intergenic
1195150402 X:102062244-102062266 ATATAATTTTACATTTGATTTGG + Intergenic
1195374703 X:104215477-104215499 AAATAATTTTATTTTAGATTCGG - Intergenic
1195581188 X:106504527-106504549 CTATAACTTTATGTTTGACATGG + Intergenic
1196066382 X:111469046-111469068 CTATGATTTTATGCTTGATCAGG - Intergenic
1196869986 X:120103760-120103782 TTACAATTTTATGTTTGATTTGG + Intergenic
1197330685 X:125150594-125150616 CTGTAATTTTATTTTAGGTTAGG - Intergenic
1197481104 X:126987029-126987051 CTATAATTTTATGTGTGACCTGG + Intergenic
1197565739 X:128083596-128083618 TTATAATTTTATGTTTGACTTGG - Intergenic
1197636939 X:128925889-128925911 CTATAATTTTAGATGAGATTTGG + Intergenic
1197643372 X:128991919-128991941 TCATAAATTTATATTTGATTGGG + Intergenic
1198169242 X:134089585-134089607 TTCTTATTTTATTTTTGATTTGG - Intergenic
1198835185 X:140796907-140796929 CTACAATTTAAGGTTAGATTTGG + Intergenic
1198854170 X:140998469-140998491 CTACAATTTTGTGTTTGATTTGG + Intergenic
1198877839 X:141246644-141246666 CTACAATTTTGTGTTTGATTTGG - Intergenic
1198908259 X:141585541-141585563 CTACAATTTTGTGTTTGATTTGG + Intronic
1199366878 X:146996865-146996887 CTATAATTTTCTGTTTAACTTGG + Intergenic
1199377435 X:147130552-147130574 GTTTAATTTTATGTTTAATTTGG + Intergenic
1199869081 X:151880298-151880320 CCATAATTTTATGTTTGATTTGG + Intergenic
1200357092 X:155563241-155563263 CCATAATTTTAAGTTTCATGAGG - Intronic
1200546272 Y:4522355-4522377 CTATAATTTCATGTTTGATTTGG + Intergenic
1200730288 Y:6729023-6729045 CTATAATTAAATGTTACATTTGG - Intergenic
1200878579 Y:8186569-8186591 ATAAAATTTTATTTTTAATTTGG - Intergenic
1202022479 Y:20479817-20479839 CTATTCTTTTATGTTTGCTGAGG - Intergenic