ID: 1022457384

View in Genome Browser
Species Human (GRCh38)
Location 7:30570036-30570058
Sequence AATCTCCTCCTACTAGTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022457382_1022457384 25 Left 1022457382 7:30569988-30570010 CCTATGATAGATTTCTATAATTT No data
Right 1022457384 7:30570036-30570058 AATCTCCTCCTACTAGTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022457384 Original CRISPR AATCTCCTCCTACTAGTGAG AGG Intergenic
No off target data available for this crispr