ID: 1022459388

View in Genome Browser
Species Human (GRCh38)
Location 7:30590566-30590588
Sequence CCGCGCCCGGCCGATTCCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022459388_1022459393 8 Left 1022459388 7:30590566-30590588 CCTAAGGAATCGGCCGGGCGCGG No data
Right 1022459393 7:30590597-30590619 GCCTGTAATCCCAGCACTTTGGG 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
1022459388_1022459401 24 Left 1022459388 7:30590566-30590588 CCTAAGGAATCGGCCGGGCGCGG No data
Right 1022459401 7:30590613-30590635 CTTTGGGAGGCCGAGGCGGGTGG 0: 39056
1: 119917
2: 190535
3: 147315
4: 99766
1022459388_1022459397 17 Left 1022459388 7:30590566-30590588 CCTAAGGAATCGGCCGGGCGCGG No data
Right 1022459397 7:30590606-30590628 CCCAGCACTTTGGGAGGCCGAGG 0: 114360
1: 259489
2: 214307
3: 130302
4: 170463
1022459388_1022459400 21 Left 1022459388 7:30590566-30590588 CCTAAGGAATCGGCCGGGCGCGG No data
Right 1022459400 7:30590610-30590632 GCACTTTGGGAGGCCGAGGCGGG 0: 84291
1: 218536
2: 234154
3: 158283
4: 172560
1022459388_1022459399 20 Left 1022459388 7:30590566-30590588 CCTAAGGAATCGGCCGGGCGCGG No data
Right 1022459399 7:30590609-30590631 AGCACTTTGGGAGGCCGAGGCGG 0: 87986
1: 182858
2: 138884
3: 74939
4: 51691
1022459388_1022459392 7 Left 1022459388 7:30590566-30590588 CCTAAGGAATCGGCCGGGCGCGG No data
Right 1022459392 7:30590596-30590618 CGCCTGTAATCCCAGCACTTTGG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861
1022459388_1022459395 11 Left 1022459388 7:30590566-30590588 CCTAAGGAATCGGCCGGGCGCGG No data
Right 1022459395 7:30590600-30590622 TGTAATCCCAGCACTTTGGGAGG 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022459388 Original CRISPR CCGCGCCCGGCCGATTCCTT AGG (reversed) Intergenic
No off target data available for this crispr