ID: 1022461755

View in Genome Browser
Species Human (GRCh38)
Location 7:30615330-30615352
Sequence TTCATCCCATTTCAAAGAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 437
Summary {0: 1, 1: 0, 2: 3, 3: 43, 4: 390}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022461755_1022461757 25 Left 1022461755 7:30615330-30615352 CCCATTCTTTGAAATGGGATGAA 0: 1
1: 0
2: 3
3: 43
4: 390
Right 1022461757 7:30615378-30615400 AAAGACTTGCTAATGCTTTAAGG 0: 1
1: 0
2: 2
3: 15
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022461755 Original CRISPR TTCATCCCATTTCAAAGAAT GGG (reversed) Intronic
900583214 1:3419428-3419450 GTCATCCCATTTCAAAGATGAGG + Intronic
901278610 1:8013436-8013458 TTCTTCCCATTTTCAATAATGGG + Exonic
901978492 1:13014542-13014564 TTCACCCCATTTCCATGGATAGG + Intronic
902003591 1:13214396-13214418 TTCACCCCATTTCCATGGATAGG - Intergenic
902291748 1:15440107-15440129 TTCTTCACATTTCACAGAAAGGG + Intronic
903445840 1:23422772-23422794 CTCTTCCCATTTCACAGAAGAGG + Intronic
904148423 1:28414887-28414909 TTCATCTCATTTCAGAGACCTGG + Intronic
905005441 1:34705965-34705987 TTGCTCCCATTTCACAGAAGAGG + Intergenic
905245414 1:36609929-36609951 TTCATCCCATTTTAGAGATGGGG + Intergenic
906293488 1:44634982-44635004 CTAATCCCATTTCACAGAAGAGG - Intronic
906840502 1:49133447-49133469 TTTATCCCTTTTTAATGAATTGG - Intronic
906922349 1:50078034-50078056 ATTATCCCATTTCAGAGAAGAGG - Intronic
906926714 1:50125627-50125649 TTTGTCCCATTTCACAGAATAGG - Intronic
908610037 1:65847862-65847884 TTCATCCAAATTAAATGAATGGG + Intronic
908610047 1:65848015-65848037 TTCATCCAAATTAAATGAATGGG + Intronic
909109501 1:71456888-71456910 TTCATCCCATTTCACCCAACTGG - Intronic
909341031 1:74531212-74531234 TTGCTCCCATTACAGAGAATGGG - Intronic
909732294 1:78908386-78908408 ATCAGCCCTTTTCAAACAATTGG + Intronic
909990759 1:82220387-82220409 TTCTTCCCATTTCACAGATTAGG + Intergenic
910989676 1:93042103-93042125 TTCTTCGCATTTTGAAGAATTGG + Intergenic
911107046 1:94141846-94141868 TTATTCTCATTTCAAAGATTAGG + Intergenic
912267198 1:108170340-108170362 TTCAACACATTTCAAAGAACTGG - Intronic
913325643 1:117626117-117626139 TTCATCACATTTCAAAGCTTTGG - Exonic
913465335 1:119135551-119135573 TTCATCCCATTTTATAAAAGAGG - Intronic
914214453 1:145612325-145612347 TTCCTCCCATTTCAGAAAACGGG + Intronic
914466392 1:147932719-147932741 TTCCTCCCATTTCAGAAAACGGG + Intronic
914854159 1:151338130-151338152 CCCAACACATTTCAAAGAATTGG + Intergenic
915947193 1:160162078-160162100 TTCATTCCATTTCGAAGATGAGG + Intronic
916630492 1:166607380-166607402 TTCACCCCATTTCCATGGATAGG + Intergenic
916852179 1:168714680-168714702 TTCATGCCATTTAAAATAAAAGG + Intronic
918142269 1:181729576-181729598 TTCTTCTCATTTCAAAGATGAGG - Intronic
918478521 1:184952027-184952049 TTCATCCCGTTTCACAGAACAGG + Intronic
919247845 1:195012377-195012399 GATATCCCATTTCAAAAAATTGG + Intergenic
920888863 1:209962697-209962719 TTCATTCCCCTTCAAAGACTGGG - Intronic
921498720 1:215873488-215873510 TTAATCTCATTACAAAGAAGAGG + Intronic
923927502 1:238649753-238649775 TTCAACCAATTTCAAATAATTGG + Intergenic
923965603 1:239135159-239135181 TTAATCCCATTTCATCTAATGGG - Intergenic
1063368934 10:5508391-5508413 TTAACCCCATTTCAGAGACTGGG + Intergenic
1064678784 10:17787950-17787972 TTCAGACCATTTCAAAGTATAGG + Intronic
1065189602 10:23197420-23197442 CTCATCCCATTTCCATTAATGGG + Intergenic
1065394641 10:25221405-25221427 TCCAGCCCATTTTGAAGAATAGG - Intronic
1065495587 10:26324178-26324200 ATCATCACATTTGAAAGAAAGGG + Intergenic
1066597245 10:37064331-37064353 GTCAACCCAATTAAAAGAATTGG + Intergenic
1068647390 10:59482595-59482617 TTAACCAGATTTCAAAGAATGGG - Intergenic
1069100414 10:64313176-64313198 TTCAGTCCATTTAAAATAATTGG + Intergenic
1069488203 10:68839051-68839073 TTCATCCCATATCCATGGATTGG + Intronic
1069715317 10:70517141-70517163 TTGTTCCCATTTCACAGAAGTGG + Intronic
1070073236 10:73110080-73110102 TTCTTCCAATTTAAAAGGATGGG - Intergenic
1070414313 10:76175333-76175355 TTAATCCTATTTCACAGACTAGG - Intronic
1070722632 10:78767366-78767388 TTCAACCCATTTCATAGATATGG + Intergenic
1070980458 10:80641522-80641544 TTAACCCCATTTCACAGATTAGG + Intronic
1071184188 10:83021616-83021638 GTCATACCATGTCAAAGCATTGG - Intergenic
1071980657 10:91001544-91001566 TTCATCCCACATCACAGATTTGG + Intergenic
1072038530 10:91586256-91586278 TTCTTCCCATTTTATAGATTAGG - Intergenic
1074160734 10:110834455-110834477 TTCCTCCCATTTAACAGATTAGG + Intronic
1074731561 10:116382679-116382701 TTCCTCCCATTTCAATAATTAGG - Intergenic
1077585573 11:3449544-3449566 TTCACCCCATTTCCATGGATAGG + Intergenic
1077631947 11:3816965-3816987 TTATTCCCATTTCACAGAAGGGG - Intronic
1078527015 11:12109220-12109242 ATCATCCCATTTCACAGATGTGG - Intronic
1078693304 11:13603578-13603600 TTCATCCCAAGTCAACCAATTGG - Intergenic
1082248301 11:49951088-49951110 TTGATCCCCTTGCAAAGCATGGG - Intergenic
1082287372 11:50332335-50332357 TTCCTCCCATTTTAAAGATGGGG - Intergenic
1082613088 11:55326295-55326317 TTCATGCCATTTCCATTAATGGG - Intergenic
1082959058 11:58901722-58901744 TTGATCCCATTTCACAGATTAGG - Intronic
1082974572 11:59059306-59059328 TTGCTCCCATTTCACAGATTAGG - Intergenic
1084118351 11:67054850-67054872 TTCCTCCCATTTTACAGATTTGG - Intergenic
1085659108 11:78346432-78346454 TTATTCCCATTTTACAGAATAGG + Intronic
1085925228 11:81010515-81010537 ATCATCCCATTTAAAAAAAATGG + Intergenic
1086483507 11:87271523-87271545 TACATCAGATTTCAAAGACTTGG + Intronic
1087261452 11:96017157-96017179 TTCCTCCCATTTCATAGATGAGG + Intronic
1088252930 11:107877295-107877317 TTAATCCCATTTCAAAGGGTAGG + Intronic
1088544686 11:110947523-110947545 CTCAACCCATTTGAAAGAAAAGG + Intergenic
1088753695 11:112867292-112867314 ATCATCCCATTTTATAGAAAAGG - Intergenic
1089461213 11:118655498-118655520 TTCACCCCATTTCCCAGATTTGG + Intronic
1091642130 12:2245461-2245483 GTCATCCCATTTCACAGACCAGG + Intronic
1091879918 12:3968647-3968669 TTCATCCCAGAGCAAAGGATGGG + Intergenic
1093467236 12:19462009-19462031 TTCTTTTCATGTCAAAGAATTGG - Intronic
1096355971 12:50941291-50941313 TTCCTCCCATTTAAAAAATTGGG - Intergenic
1096456044 12:51787857-51787879 TGTATCCCAGTTCAAAAAATTGG + Intronic
1097585896 12:61515909-61515931 TTCATCCCATGTCTAATAACTGG + Intergenic
1099413118 12:82356556-82356578 TTTTTCCCATTTTAAAGAAGAGG + Intronic
1099592224 12:84609393-84609415 TTCTTCTTATTTCAGAGAATTGG + Intergenic
1101567416 12:105921235-105921257 TTATTCCCATTTCACAGATTGGG + Intergenic
1102025196 12:109710573-109710595 TTAATCCCATTTCAAAGATGGGG + Intergenic
1103241177 12:119414453-119414475 TTCCTTCCAGTTCAAAGGATGGG + Intronic
1105055222 12:133092647-133092669 TTCACCCCATTTCCATGGATAGG + Intronic
1105221067 13:18327962-18327984 GTCACCCCATTCCAAAGCATGGG - Intergenic
1105771326 13:23614903-23614925 TTTTTCCCATTTCATAGATTGGG - Intronic
1106731331 13:32544450-32544472 TCAATCCCATTTAAAAAAATGGG + Intergenic
1106914889 13:34502671-34502693 CTAATCCTATTTCAAAGAAATGG + Intergenic
1106933587 13:34693728-34693750 TTCATCACATTTCAAAAGACTGG + Intergenic
1107049786 13:36034849-36034871 CTCTTCCCATTTGAAAGAAAGGG + Intronic
1107103235 13:36616844-36616866 TTCATTCCATTTCACAGATAAGG + Intergenic
1107106662 13:36650431-36650453 TTCAGCACATTTCAAAGCAGAGG + Intergenic
1107404296 13:40098405-40098427 TTCATTCCATTTCAAATAATTGG + Intergenic
1107521890 13:41191427-41191449 TTCATGACATTACTAAGAATGGG + Exonic
1108367962 13:49736000-49736022 TTCATAAGATTTAAAAGAATTGG - Intronic
1109332697 13:60949624-60949646 TTCATCCAATTCTTAAGAATTGG + Intergenic
1111891761 13:94091094-94091116 TTCATAGCATTGCAAAAAATGGG - Intronic
1115013319 14:28577477-28577499 ATCAGGCTATTTCAAAGAATTGG - Intergenic
1115100896 14:29698120-29698142 GTCTCCCCATTTCAAAGAGTTGG + Intronic
1115213308 14:30989862-30989884 ATCATCCCATTTCATAGATATGG - Intronic
1115347074 14:32354397-32354419 TTATCCCCATTTCACAGAATGGG - Intronic
1115463471 14:33687653-33687675 TACTTCCCATTTCACAGAACGGG + Intronic
1116271705 14:42778654-42778676 TGAATCCCAGTTCAAATAATTGG + Intergenic
1116651515 14:47599533-47599555 TTGATCCCATACCAAACAATAGG + Intronic
1116920935 14:50573506-50573528 TTCAACCAAGTTCAAAGCATGGG - Intronic
1117200787 14:53387966-53387988 TTCATTCAATTCCAAAAAATTGG - Intergenic
1117311520 14:54528973-54528995 TTGATCACATTTTAAAAAATAGG + Intronic
1117961807 14:61170843-61170865 TTGTTCTCATGTCAAAGAATTGG - Intergenic
1118590515 14:67397446-67397468 TTCATCCCATTTTACAGATGAGG + Intronic
1118690588 14:68335625-68335647 TTCATAGCATTTCAGAGAGTTGG + Intronic
1122080079 14:99261041-99261063 TTCACCCGATTCCAAAGAACGGG + Intronic
1122094801 14:99363045-99363067 TTCCTCCCATTTTACAGACTGGG - Intergenic
1122103136 14:99429478-99429500 TACATCCCGTTTAAGAGAATCGG - Intronic
1122668714 14:103353634-103353656 TTCATCCCACATCAAAGCAAGGG - Intergenic
1123937504 15:25201131-25201153 TTCCTCCCATTTCACAGTCTAGG - Intergenic
1124570123 15:30855433-30855455 TTCTTCCCAGGTCTAAGAATTGG - Intergenic
1124934028 15:34152586-34152608 TTCATCCCATCTTAGAGAAATGG + Intronic
1125205399 15:37148757-37148779 GACATCCCACTTCAAGGAATAGG - Intergenic
1126610714 15:50526842-50526864 TTATTCCCATTTTACAGAATAGG - Intronic
1126688539 15:51268881-51268903 TTTTTCCCATTTAAAAAAATGGG + Intronic
1127928484 15:63571785-63571807 TTCATGACATTTTAAAGATTAGG + Intronic
1128713062 15:69886347-69886369 TTCATCCCATTTCACAGATGGGG - Intergenic
1129271766 15:74422692-74422714 CTGATCCCATTGGAAAGAATGGG + Intronic
1129547579 15:76413687-76413709 TTTAGCCCATTTTAAAGATTGGG + Intronic
1130046182 15:80446658-80446680 TTCATCCCATTTTACAGATTAGG - Intronic
1131048983 15:89334241-89334263 GTAATCCCATTTTACAGAATAGG - Intronic
1131168642 15:90161013-90161035 TTATTCCCATTTCACAGATTAGG - Intronic
1131272378 15:90955151-90955173 TTCAGCCCATTTCACAGACCGGG + Intronic
1131603637 15:93877005-93877027 TGCATCCCTTTTCAAAAAATAGG + Intergenic
1132044430 15:98551343-98551365 TTAATCCCATTCCACAGATTGGG - Intergenic
1132645339 16:996965-996987 TTCACCCCATTTAACAGAAGAGG + Intergenic
1134914901 16:18061268-18061290 TTCATCCCATTTTAGAGATGAGG + Intergenic
1136058849 16:27710858-27710880 TTATTCCCATTTTAAAGAAGAGG + Intronic
1137497081 16:48978794-48978816 TTGATCCCCTGTGAAAGAATTGG - Intergenic
1137660395 16:50200695-50200717 TTCTGCCCATTTTAAAAAATGGG + Intronic
1138075044 16:54033841-54033863 TTCATCCCATTCCAGGGAATAGG + Intronic
1138183079 16:54956214-54956236 TTGATCTCATTTCACAGAAGAGG - Intergenic
1139752622 16:69118942-69118964 TTCGTCCCATTTCCTAGAGTGGG - Exonic
1140733429 16:77876674-77876696 TTTATCCCATTTGAAATAATAGG - Intronic
1140888765 16:79267688-79267710 TTAATCTCATTTCATAGAAGAGG - Intergenic
1141061082 16:80871112-80871134 TTCTCCCCATTTCAAAAATTGGG - Intergenic
1141717806 16:85736747-85736769 CTCATCCCATTTTAAAGATGAGG - Intronic
1141769191 16:86078746-86078768 ATCATCCCATTTCACAGAAGTGG + Intergenic
1141876084 16:86825435-86825457 TTTATCCCCTTTCACAGAAGGGG - Intergenic
1141908794 16:87044708-87044730 TTATTCCCATTTCACAGAAGAGG + Intergenic
1144051576 17:11501550-11501572 TTAATCCCATTTCTAGGAATGGG + Intronic
1145260665 17:21352580-21352602 TTGTTCCCATTTCACAGAAGGGG + Intergenic
1146560722 17:33867492-33867514 TCCATCCAATTCCAAAGACTGGG + Intronic
1147299536 17:39514404-39514426 TTTGTCTCATTTCAAAGCATAGG + Intronic
1147308617 17:39580302-39580324 TTCTTCCCATTTCATAGATGAGG - Intergenic
1147862304 17:43530732-43530754 TTCATTCCATTCCATAGGATAGG + Intronic
1148501314 17:48093636-48093658 TTCCTCCCATTTAAAACAAAAGG + Intronic
1150272395 17:63874891-63874913 ATCATCCCATTTCACAGATCAGG + Intronic
1150273763 17:63882919-63882941 ATCATCCCATTTCACAGATCAGG + Intergenic
1150275914 17:63897566-63897588 ATCATCCCATTTCACAGATCAGG + Intergenic
1152041816 17:77908618-77908640 TTTATCCCATTTAACAGAAAGGG + Intergenic
1154345260 18:13538415-13538437 TTTCACCCATTTTAAAGAATGGG + Intronic
1154390115 18:13929523-13929545 TTCCTCCCATCTCAAAGCAGGGG - Intergenic
1155304881 18:24469333-24469355 CTCATCACATTTCAAAGTATGGG - Intronic
1156438867 18:37164068-37164090 TTCTTTCCATTTTAGAGAATGGG - Intronic
1156476404 18:37408591-37408613 TTCTTCCCGTTTCCTAGAATTGG + Intronic
1157120326 18:44903776-44903798 TTCATCTAATTTCACAGAGTAGG + Intronic
1157505695 18:48224717-48224739 TTCTTCCCAATTCATGGAATTGG - Intronic
1157722259 18:49934358-49934380 TTCCTCCCAATACAAAGAAAAGG - Intronic
1158041432 18:53099557-53099579 CCCATTCCATTTCACAGAATAGG - Intronic
1158761724 18:60397642-60397664 TGCACCCCATTTAAAGGAATTGG + Intergenic
1159561883 18:70004181-70004203 TTCAAGACATTTCAAATAATAGG + Exonic
1160111234 18:76033784-76033806 TTCAACCCAATGCAAAGCATAGG - Intergenic
1160403255 18:78626990-78627012 TTCCTTCCATTTCAAAGAGTTGG - Intergenic
1160985407 19:1836336-1836358 GTCAGCCCATTTCAAAGATGAGG + Intronic
1161402224 19:4071914-4071936 TTCAGCACATTTCAGAGAAATGG - Intergenic
1161877379 19:6922186-6922208 TTAGACCCATTTCACAGAATGGG + Intronic
1162323702 19:9986087-9986109 TTCATCCCATTTTACAGACAAGG - Intronic
1163284046 19:16335289-16335311 TTACCCCCATTTCAAAGAAGAGG - Intergenic
1163477074 19:17532729-17532751 AACATCCCATTTCACAGAAGTGG - Intronic
1163632107 19:18422787-18422809 TTCACCCCATTTCACAGAGAAGG - Intronic
1163644687 19:18482183-18482205 TTTATCCCATTTTTAAAAATTGG + Intronic
1164828376 19:31301191-31301213 TTCATCCCTCTGCAAAGAAGCGG + Intronic
1165700150 19:37931379-37931401 TTCATCCCATTTCATAGATGAGG + Intronic
1166963484 19:46513891-46513913 TTCATCCCATTTCTCAGATGAGG - Intronic
925331849 2:3064499-3064521 TCCATCCCATTCCATAAAATGGG - Intergenic
926470710 2:13253678-13253700 TTAATTCCATTTTAAAGATTAGG - Intergenic
927559906 2:24062737-24062759 TTCACCCTCTTCCAAAGAATAGG - Intronic
928392326 2:30919098-30919120 TCCATCCCAATTTAAAGAAAGGG - Intronic
929327384 2:40633030-40633052 TTCATTCCATAAAAAAGAATGGG - Intergenic
930275861 2:49310418-49310440 TACATGCCATGTCAAAGAGTTGG + Intergenic
931084526 2:58814734-58814756 TGCATCCTATTTCCAAGGATGGG + Intergenic
931335139 2:61333531-61333553 TTTTTCCCATTTCTAGGAATTGG - Intronic
931745151 2:65285438-65285460 ATTATCCCATTTCACAGAAAAGG - Intergenic
932680387 2:73819478-73819500 TTCATCCCATTTCACAGATAAGG + Intergenic
934182990 2:89644506-89644528 GTCACCCCATTCCAAAGCATGGG + Intergenic
934293276 2:91718693-91718715 GTCACCCCATTCCAAAGCATGGG + Intergenic
934660231 2:96139252-96139274 TTATTCCCATTTCACAGATTTGG + Intergenic
935733604 2:106087581-106087603 TTCAACACATTTAAAAGAACTGG - Intergenic
938596097 2:132788537-132788559 TTCTCCCCATTTCACAGAAGAGG - Intronic
940686001 2:156851830-156851852 TTCCTCACCTTTCAAAGTATGGG + Intergenic
940719090 2:157261662-157261684 TTTATCCTCTTTCAAAGAAGAGG - Intronic
940765141 2:157782166-157782188 TTCTTCCCTCTTCAAAGAAGTGG + Intronic
941222123 2:162795565-162795587 TTCTTCTCATTTCACAGGATTGG - Intronic
942208529 2:173647721-173647743 TTGATGGCATTTCAAGGAATAGG - Intergenic
942599076 2:177621600-177621622 ATCATACCATTTCAATTAATAGG + Intergenic
942959020 2:181807390-181807412 TCCATCCCATTCTAAAGAATGGG - Intergenic
943434221 2:187843807-187843829 TTAATGCCATGCCAAAGAATTGG - Intergenic
943521472 2:188956181-188956203 TTCATACCATTAGGAAGAATAGG - Intergenic
943767841 2:191680816-191680838 TTATTCCCATTTCACAGAAGAGG - Intronic
944513908 2:200491857-200491879 ATGATCCCATTTCCAAGAATGGG - Intronic
945145147 2:206730353-206730375 TTCTTCTCACTTCCAAGAATAGG - Intergenic
946212084 2:218155311-218155333 TTCCTTCCAGTTCTAAGAATGGG - Intergenic
946984265 2:225254390-225254412 TTCATCTCATTTAAAATAATGGG + Intergenic
948599278 2:239099255-239099277 TTCATCCATTTTCAAAGGACCGG - Intronic
1168785891 20:540006-540028 TCCATTCCATTTCAAAGCCTGGG + Intronic
1170185473 20:13584985-13585007 TACAAACCTTTTCAAAGAATGGG + Intronic
1170710981 20:18790574-18790596 TTCTTCCCTTTTCAAAATATTGG - Intergenic
1171155081 20:22864623-22864645 TTTATCCCACTTCAAAGCAAGGG - Intergenic
1172047281 20:32089311-32089333 ATCATCCCATTTTACAGAATAGG + Intronic
1172182679 20:33013149-33013171 TTCATCCCATTTTACAGATGAGG - Intronic
1172267460 20:33628901-33628923 ATCATCCCATCACAAAGATTAGG - Intronic
1172569432 20:35957595-35957617 TGCATCCCTTTTCGAAGAAGAGG - Intronic
1172777066 20:37413943-37413965 TTCCTCTCATTTCAAAGAATTGG + Intergenic
1173721383 20:45261065-45261087 TATATCCCATTTTAAAGAAAAGG + Intergenic
1173954137 20:47017772-47017794 TTATTCCCATTTCACAGAAGAGG + Intronic
1174413914 20:50354604-50354626 GTCATCCCATTTTAAAGATGAGG - Intergenic
1174593589 20:51666217-51666239 TTCATCCCTGTTCAGAGCATGGG - Intronic
1176885863 21:14255205-14255227 TTCAACTCATTTAAAAAAATTGG + Intergenic
1179247710 21:39648215-39648237 TGCATCAGATTTAAAAGAATTGG + Intronic
1181959204 22:26610791-26610813 TTCTCCCCATTTCAAAGATGGGG + Intronic
1182114274 22:27746266-27746288 TTCATCCCATGTCACAGATGAGG - Intergenic
1182853767 22:33499326-33499348 CTCATCCCTGTTCAAAGTATGGG + Intronic
1183136164 22:35889936-35889958 TTGGTCCCATTTTAAAGATTAGG + Intronic
1183663122 22:39233142-39233164 TTAACCCCATTTCACAGAGTTGG - Intronic
1183989042 22:41585794-41585816 TTCAGCCCATTTTAAAGATGAGG + Intronic
1184495141 22:44836693-44836715 TTCATCCCCTTTCAAATATTGGG + Intronic
949373603 3:3362845-3362867 TTTATTCCATTTCATAGACTGGG + Intergenic
951152821 3:19312506-19312528 TTCTTGGCATTTAAAAGAATGGG + Intronic
951674253 3:25218763-25218785 CTATTCCCATTTCAAAAAATAGG + Intronic
951710410 3:25580884-25580906 TTCAGCCCATTTCACAGATAAGG - Intronic
952675238 3:36022356-36022378 TTCATTCCATTACAAAGGAATGG - Intergenic
953005364 3:38972523-38972545 TTCATCTCAGTTCAAAAACTTGG + Intergenic
953456118 3:43043580-43043602 TTGTTCCCATTTCAAAGATGAGG - Intronic
955057643 3:55470933-55470955 ATCATCCCATTTCACAGAGAAGG + Intronic
955080953 3:55657355-55657377 TTCCTCCCATCTCAAGGACTTGG - Intronic
955558730 3:60165451-60165473 TTCATGCCACTTCCAAGAATGGG + Intronic
955940216 3:64140173-64140195 GTCATTCCATTTCAAAGATGAGG + Intronic
957028977 3:75218082-75218104 TTCATCCCATTTTCAAAAAATGG + Intergenic
957069746 3:75557843-75557865 TTCACCCCATTTCCATGGATAGG - Intergenic
957216825 3:77330941-77330963 TTCATCCATTTTCAAAGAAAAGG + Intronic
957420472 3:79961656-79961678 TTCATCCCATTCCAGAGACAAGG - Intergenic
957585722 3:82129078-82129100 TTCATCCAAGTTCAGAGGATTGG - Intergenic
959003621 3:100993835-100993857 TTACTCCCATTTAAAAGAATTGG - Intergenic
959823968 3:110770825-110770847 TTCAGACCAAGTCAAAGAATGGG + Intergenic
960050928 3:113238750-113238772 GTCAACCCATTTCATAGATTAGG - Intronic
960359895 3:116698410-116698432 TGCATCCCATTCCATAGACTGGG - Intronic
960536312 3:118818244-118818266 TTGATCCCATTTCACAGACAAGG + Intergenic
961738915 3:129020331-129020353 TTACTCCCATTTAAAAGATTGGG + Intronic
961838396 3:129684627-129684649 CTCATCACATGTGAAAGAATTGG - Intronic
962952702 3:140234025-140234047 TTCATCCCTTAACAAAAAATAGG + Intronic
963030261 3:140964713-140964735 TTAATCTTATTTGAAAGAATTGG + Intronic
964215114 3:154271448-154271470 TTCATCTCATGTCAAATGATTGG - Intergenic
964432174 3:156618892-156618914 TTCGTTCCATTTCTAAGATTTGG - Intergenic
964722624 3:159782266-159782288 TTCATCCCATTTTATAGACAGGG + Intronic
964960739 3:162421468-162421490 TTTATCCAATTTTAATGAATGGG - Intergenic
964967310 3:162512044-162512066 TTCATCTCATTTTACAGATTAGG + Intergenic
968958873 4:3732672-3732694 TTCCTCCCATTTCACAGATCGGG - Intergenic
969000765 4:3979473-3979495 TTCACCCCATTTCCATGGATAGG + Intergenic
969753251 4:9129224-9129246 TTCACCCCATTTCCATGGATAGG - Intergenic
969813159 4:9665397-9665419 TTCACCCCATTTCCATGGATAGG - Intergenic
970286486 4:14522545-14522567 TTATTCCCATTTTACAGAATAGG + Intergenic
970416907 4:15867124-15867146 ATGATCCCATTTCAAAAACTGGG + Intergenic
970546347 4:17134100-17134122 TTCTTCTGATTTCAAAGAAGGGG + Intergenic
971211308 4:24619519-24619541 TATATCCCATATCAATGAATTGG - Intergenic
972028649 4:34422255-34422277 TATATCACATTTCAAACAATTGG + Intergenic
972471388 4:39408579-39408601 TTCTTCCCATTTAAAAGATGAGG + Intronic
972601521 4:40577071-40577093 TTCAGCCCACTCCAAGGAATGGG + Intronic
973099661 4:46250011-46250033 TTCATCTCATTTGGAAGAATAGG + Exonic
973659966 4:53094601-53094623 TTCAGCCCATAACAAAGTATTGG + Intronic
974483723 4:62478835-62478857 TTAATCTCATTTAAAAGAGTGGG - Intergenic
974671644 4:65037502-65037524 TTCATCTCATTTTACAGATTAGG - Intergenic
974952660 4:68601418-68601440 TTCACCCCATTTCCATGGATAGG - Intronic
977059990 4:92246037-92246059 TACACCAGATTTCAAAGAATTGG + Intergenic
977593668 4:98854119-98854141 TTTTTCCCATTTAAAAAAATTGG - Intergenic
977721096 4:100241367-100241389 TTCATCCCATGTTAAAAAAATGG + Intergenic
979472849 4:121122015-121122037 TACTGCCCATTTCAAAGACTTGG + Intergenic
981214940 4:142153270-142153292 TTCATACAATTAAAAAGAATTGG - Intronic
982256862 4:153459300-153459322 TTCATCCCACCTCTAACAATGGG + Intergenic
982439470 4:155418585-155418607 GAAATCACATTTCAAAGAATAGG + Intergenic
983122412 4:163903064-163903086 TTCAGTCGATTTTAAAGAATGGG - Intronic
983982494 4:174016092-174016114 TTAATCATATTTCAAAAAATAGG + Intergenic
984212664 4:176869712-176869734 TGCATACCATTTCAATAAATTGG - Intergenic
984692002 4:182737007-182737029 TTTATCCCATATGAAAGTATAGG - Exonic
984890214 4:184485303-184485325 TTCACTTCATTTCAAATAATTGG + Intergenic
985625938 5:987658-987680 AACATCGCTTTTCAAAGAATTGG + Intergenic
986531698 5:8743409-8743431 TTGATAGTATTTCAAAGAATGGG + Intergenic
986575121 5:9204605-9204627 TTCTTCCCATTTCACAGATGAGG + Intronic
986761894 5:10887758-10887780 TTCTTCTCCTTTCAAAGAATGGG + Intergenic
986951323 5:13088501-13088523 TTTATCCCATTTCATAGAGAAGG + Intergenic
987276937 5:16372701-16372723 TTGATCCCATTTCACAGATGAGG + Intergenic
987631704 5:20480771-20480793 TTCATCAGATTTAAAAAAATGGG + Intronic
988972840 5:36487143-36487165 TTTCTCCCACTTCAAAGAAAAGG - Intergenic
990092273 5:52066934-52066956 TTCATCCCATTTTACAGAGATGG + Intronic
990931629 5:61097683-61097705 TTGATCCCATTTTAGAGATTTGG - Intronic
991210182 5:64095532-64095554 TTTATTGCATTTCCAAGAATTGG + Intergenic
991410435 5:66340220-66340242 TTTTTCCCATTTCAAATAATAGG - Intergenic
992258543 5:74947040-74947062 TACATGGAATTTCAAAGAATAGG + Intergenic
992432043 5:76718911-76718933 TTCATTCCATGCCAGAGAATTGG - Intronic
992588257 5:78264222-78264244 TTCATCCTTTTTCAAAAAACTGG - Intronic
994044233 5:95290119-95290141 ATTATCCCATTTCAGAGACTGGG - Intergenic
994844394 5:104968324-104968346 ATTATCTCATTTAAAAGAATAGG - Intergenic
994923688 5:106085743-106085765 TTCATCTCATTTCACAGTTTGGG - Intergenic
995238781 5:109861611-109861633 TTCATCCCATCTTACAGAATAGG + Intronic
995794977 5:115931508-115931530 TTCATCTCACTTCCCAGAATTGG + Intergenic
995932385 5:117462909-117462931 TTCTTCTGATTTCAAAGCATGGG - Intergenic
996160215 5:120152633-120152655 TTCATCACATTACTCAGAATGGG - Intergenic
996207296 5:120756621-120756643 TCAATCCCATTTAAAAAAATGGG - Intergenic
996642156 5:125769385-125769407 TTCATCTCTTTCCAAAGACTTGG + Intergenic
996722371 5:126642492-126642514 TTCAAACCCTTTCAAAAAATAGG - Intergenic
996945477 5:129061996-129062018 TTCATAACATTGCAAAGAAAGGG - Intergenic
998466780 5:142352869-142352891 TTATTCCCATTTCAGAGAAGAGG + Intergenic
999199489 5:149805857-149805879 TTCCTCCCATTTCAAAGCCCAGG + Intronic
999752338 5:154638080-154638102 TTCACCCCATTTCCATGGATAGG + Intergenic
1000313203 5:160064364-160064386 ATGATCCCATTTCTAAGAAATGG + Intronic
1000339801 5:160268384-160268406 TTCTTCCCATTTCACAGATGAGG - Intronic
1000683184 5:164212903-164212925 TTCTTGCCATTTCAATGTATAGG - Intergenic
1001289036 5:170443402-170443424 TTCTTCCCACTTCCATGAATTGG - Intronic
1001355363 5:171017054-171017076 TTCATCCCATGTCCCAGAAAAGG + Intronic
1001486117 5:172120625-172120647 ATCATCCCATTTCACAGACCAGG - Intronic
1001532640 5:172474965-172474987 TTCCTCCCATTTCACAGATGGGG + Intergenic
1001811333 5:174630553-174630575 TTATTCCCATTTCACAGACTGGG + Intergenic
1001903538 5:175451866-175451888 TCCATCCCTTCTCAAAGCATTGG - Intergenic
1002057622 5:176607696-176607718 ATCATCCCATTTCACAGATGAGG + Intronic
1002095147 5:176826265-176826287 TTCTTCCCATTTCATAGATGGGG - Intronic
1002327595 5:178420214-178420236 TTCCCCCCATTTCATAGAAGAGG - Intronic
1002862174 6:1089365-1089387 TTATTCCCATTTCAAAGATTAGG + Intergenic
1004253267 6:14040221-14040243 CTTATTCCATTTCAAAGAGTTGG - Intergenic
1004518332 6:16339622-16339644 ATCACCCCATTTCAAAGACAAGG + Intronic
1004965660 6:20847992-20848014 TTCATCCCATGTAAATGAAATGG + Intronic
1007571625 6:42895754-42895776 TTCACCCCATTTCCAGGGATAGG + Intergenic
1007723444 6:43899990-43900012 TTCATCCCATTTTATAGATGAGG + Intergenic
1008022191 6:46592165-46592187 TTCATTCCATTTCCAGGAAAGGG + Intronic
1008241466 6:49118001-49118023 TTCTTACCATTTTAAAGACTAGG - Intergenic
1009864512 6:69380047-69380069 TGGATCATATTTCAAAGAATTGG - Intronic
1011067393 6:83342136-83342158 TTCACCCCATTTAAATGAAGTGG - Intronic
1011622047 6:89252139-89252161 TTCATTCCATTGCAAAGGAACGG - Intergenic
1012480233 6:99658764-99658786 TTCATAACATTTCAGAGAAATGG - Intergenic
1012539079 6:100339492-100339514 CTGATGCCATTTCAAAGAATGGG + Intergenic
1012851212 6:104447843-104447865 TTCATCCCATATCAATGAAGTGG + Intergenic
1013050112 6:106524832-106524854 TTCATGTCAGTTCACAGAATAGG - Intronic
1014784567 6:125603137-125603159 TTCTTATCTTTTCAAAGAATTGG - Intergenic
1014858990 6:126440335-126440357 TACCTTCCATCTCAAAGAATGGG + Intergenic
1015227887 6:130879150-130879172 TTCATCCCACTTTAAGGAACAGG + Intronic
1015441867 6:133257912-133257934 TTCATGCATTTTAAAAGAATCGG + Intronic
1017313725 6:153003512-153003534 CTCATCCCTTTCCAAAGAACTGG + Intergenic
1017998770 6:159559677-159559699 TTCAACACATTTAAAATAATTGG + Intergenic
1018230572 6:161671217-161671239 TTCAACACATCTCTAAGAATAGG + Intronic
1022461755 7:30615330-30615352 TTCATCCCATTTCAAAGAATGGG - Intronic
1023480361 7:40627361-40627383 TTCATCCCATGTAAATGAAGTGG + Intronic
1023555682 7:41420348-41420370 TCAATCCCATTTTAAAGAAGAGG - Intergenic
1024453947 7:49581282-49581304 TCAATGCCATTCCAAAGAATGGG - Intergenic
1024964563 7:55012222-55012244 TACATTCTATTTCAAGGAATTGG + Intergenic
1026315457 7:69223666-69223688 TTCATGCCATTGCAAATAACAGG + Intergenic
1027928688 7:84502025-84502047 GACAACCCATTTAAAAGAATGGG - Intergenic
1029228251 7:99044440-99044462 TTCATCCCTTTACAAATAATTGG + Intronic
1029953647 7:104614003-104614025 ATGATCATATTTCAAAGAATTGG + Intronic
1032669822 7:134072706-134072728 GTTATCCCATTTCAAAGATGAGG - Intergenic
1033706811 7:143896567-143896589 TTCAGCGAATTTAAAAGAATTGG + Intronic
1034356362 7:150453513-150453535 TTCATACCTTTTCAAAAAATGGG - Intronic
1035958605 8:4112000-4112022 TTCATGTCATTTAAAAGACTTGG - Intronic
1036217217 8:6890698-6890720 TTCCTCCCTTTTAAAAGAAGAGG + Intergenic
1036376459 8:8204556-8204578 TTCACCCCATTTCCATGGATAGG - Intergenic
1036853076 8:12218582-12218604 TTCACCCCATTTCCATGGATAGG + Intergenic
1036874450 8:12461104-12461126 TTCACCCCATTTCCATGGATAGG + Intergenic
1038867506 8:31455823-31455845 TACATCCCAGTTCACAGAATAGG - Intergenic
1039185650 8:34913158-34913180 TTCATGCCATGTTAAAGAAGAGG + Intergenic
1040316791 8:46266157-46266179 TTCACCCCATTTCCATGGATAGG + Intergenic
1041476138 8:58268565-58268587 ATCATCACTTTTCACAGAATTGG + Intergenic
1041686542 8:60649967-60649989 ATTATCCCATTTTAAAGATTTGG - Intergenic
1041956812 8:63565468-63565490 TTTATCAGATTTCAAGGAATAGG - Intergenic
1041964648 8:63661576-63661598 TTAAGCCCATTTTAAACAATTGG + Intergenic
1042235287 8:66605982-66606004 TTATTCCCATTTCACGGAATAGG + Intronic
1042375292 8:68044054-68044076 ATGATCCCTCTTCAAAGAATTGG - Intronic
1043542002 8:81274751-81274773 TTCATCCTATTTGAAATAGTTGG + Intergenic
1045773736 8:105776237-105776259 ATCATTCCATTTCACAGAAAAGG - Intronic
1046524060 8:115361413-115361435 TTCATCTCATTTAGAAAAATGGG + Intergenic
1046830742 8:118743068-118743090 TTATTTCCATGTCAAAGAATGGG - Intergenic
1048968211 8:139629118-139629140 TTCATCCCCTTTCTATGGATTGG + Intronic
1049876241 8:145023363-145023385 TTCACCCCATTTCCATGGATAGG + Intergenic
1050014880 9:1223102-1223124 GTCATCCCATTTTAAAGATGAGG - Intergenic
1050118654 9:2286393-2286415 TTGATCCCATTTTATAGAAGAGG + Intergenic
1050585049 9:7101927-7101949 GCCATCACATTTCAAATAATTGG + Intergenic
1050834145 9:10054598-10054620 TTGATACCATTTCAAAGGAATGG - Intronic
1051137741 9:13942008-13942030 TTCAACTCATTTCAAAGCAGAGG + Intergenic
1051147941 9:14048930-14048952 TTTCTCCCATTCCAAACAATGGG + Intergenic
1051214615 9:14782843-14782865 ATCATTCCATTTCAAAGAAGAGG + Intronic
1051667215 9:19476567-19476589 TTCCTTCCATTTCACAGATTTGG - Intergenic
1051741024 9:20252362-20252384 ATTATCCCATTTCACAGAAAAGG + Intergenic
1052576271 9:30295591-30295613 TTCATCATATTTCAAAGGACTGG - Intergenic
1053288240 9:36863710-36863732 GTTATCCCATTTCACAGAGTAGG - Intronic
1053447258 9:38162425-38162447 GTCATCCCCCTTCCAAGAATTGG - Intergenic
1055898557 9:81208482-81208504 TTCATCCCATCTGAAAAAATTGG + Intergenic
1055988644 9:82080897-82080919 ATCCTGCCATTTCAATGAATGGG + Intergenic
1057635173 9:96757993-96758015 TTCATCCCACTACTCAGAATCGG + Exonic
1058118788 9:101115715-101115737 TGCATCCCATTTTAATGAAAGGG + Intronic
1058118794 9:101115792-101115814 TGCATCCCATTTTAATGAAAGGG + Intronic
1058628824 9:106964551-106964573 CTCATTCCACTTCAAAGAAATGG - Intronic
1058786067 9:108389105-108389127 TTCTTGCCATTTAAAAAAATGGG - Intergenic
1058986870 9:110216498-110216520 TTCAATCCATTTGAAATAATAGG - Intergenic
1059439336 9:114296372-114296394 TTCTGCCCATTTAAAAAAATTGG - Intronic
1059974643 9:119702446-119702468 CTCATCCCATTTTACAGACTAGG + Intergenic
1060001074 9:119959055-119959077 TTCTTCTCATTTCATAGATTGGG - Intergenic
1061155132 9:128855327-128855349 TTCACCCCATTTCCATGGATAGG - Intronic
1061238434 9:129355377-129355399 TTCTTCCCATTTTACAGATTAGG + Intergenic
1185717998 X:2358662-2358684 TTCTTCCCATTTCATAGACGAGG + Intronic
1186028483 X:5340559-5340581 GTTATCCCATTTCACAGAAGAGG - Intergenic
1186084856 X:5976110-5976132 ATCATCTGATTTCAAAGTATGGG + Intronic
1187065574 X:15834083-15834105 GTCATCCTTATTCAAAGAATAGG - Intronic
1188047054 X:25438008-25438030 TTCTTCCCATTTTAGAGAAGAGG + Intergenic
1188112681 X:26210458-26210480 ATAATCCCATTTAAAAAAATGGG - Intergenic
1188116202 X:26245943-26245965 TTCTGCCCATTTTAAAAAATAGG + Intergenic
1188637865 X:32458084-32458106 ATCATCACATTTTAAAGATTGGG + Intronic
1188753174 X:33928550-33928572 TTTATTCCATTTCAAAGAATTGG + Intergenic
1189087697 X:38044182-38044204 TTCAACAAATTTCAAAGAAATGG + Intronic
1189482822 X:41406294-41406316 TTCATCTCATTTCACAGATGAGG + Intergenic
1191915279 X:66194381-66194403 TTCACCTCATCTCAAAGACTGGG - Intronic
1192465908 X:71355744-71355766 CTGATACCATTTCAAAGAATGGG + Intergenic
1192928180 X:75778297-75778319 TTGATTACATTTCAAAGAAATGG + Intergenic
1193353822 X:80493109-80493131 TATTTCACATTTCAAAGAATTGG - Intergenic
1194862562 X:99020116-99020138 TTGATCCTATTAGAAAGAATTGG + Intergenic
1195533863 X:105988129-105988151 TTCATCTCATTTCATTGCATTGG + Intergenic
1197229435 X:123987616-123987638 TTCATAACTTTTCAAGGAATAGG + Intronic
1197701021 X:129599746-129599768 CTCATCTCATCTGAAAGAATGGG - Intergenic
1200260105 X:154610519-154610541 TTCACCCCATTTCCATGGATAGG + Intergenic
1200752599 Y:6960513-6960535 TTCACCCCATTTCCATGGATAGG + Intronic
1200848090 Y:7852224-7852246 TTCAACCCATTGCAATGAAGGGG + Intergenic
1200907187 Y:8495874-8495896 ATCATCCCATTGTAAAGACTAGG - Intergenic
1201641674 Y:16185117-16185139 GTTATCCCATTTCACAGAAGAGG + Intergenic
1201661141 Y:16400207-16400229 GTTATCCCATTTCACAGAAGAGG - Intergenic