ID: 1022461756

View in Genome Browser
Species Human (GRCh38)
Location 7:30615331-30615353
Sequence CTTCATCCCATTTCAAAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 6, 3: 34, 4: 271}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022461756_1022461757 24 Left 1022461756 7:30615331-30615353 CCATTCTTTGAAATGGGATGAAG 0: 1
1: 0
2: 6
3: 34
4: 271
Right 1022461757 7:30615378-30615400 AAAGACTTGCTAATGCTTTAAGG 0: 1
1: 0
2: 2
3: 15
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022461756 Original CRISPR CTTCATCCCATTTCAAAGAA TGG (reversed) Intronic
901115154 1:6837517-6837539 CTGCTTCCCATTTCTGAGAAAGG + Intronic
901278609 1:8013435-8013457 CTTCTTCCCATTTTCAATAATGG + Exonic
901613519 1:10518433-10518455 CGTCATCCCGTTTCACAGACTGG + Intronic
902291747 1:15440106-15440128 ATTCTTCACATTTCACAGAAAGG + Intronic
904500989 1:30912822-30912844 CTTCGTCCCATTTCACAGCTGGG + Intergenic
904774572 1:32898908-32898930 CTTCTTCCCATTTTACAGATGGG - Intronic
904807430 1:33141660-33141682 CTTCATCTAATTTCAAGGGAGGG + Intergenic
904933743 1:34111619-34111641 CTTCATCCCATTTAACAAATGGG + Intronic
905062989 1:35155404-35155426 CATCATCCCACATCAAACAAAGG - Intergenic
905245413 1:36609928-36609950 CTTCATCCCATTTTAGAGATGGG + Intergenic
906048549 1:42851912-42851934 CTTCATCCCACTTTGGAGAATGG + Exonic
907909787 1:58815672-58815694 CTTCTTCCCATTTTATAGAAGGG + Intergenic
908610036 1:65847861-65847883 CTTCATCCAAATTAAATGAATGG + Intronic
908610046 1:65848014-65848036 CTTCATCCAAATTAAATGAATGG + Intronic
910092232 1:83479018-83479040 CATCATCCCCCTTCACAGAAGGG + Intergenic
911036470 1:93555078-93555100 CTTCCTGGCATTTCAAAGCATGG + Intergenic
911272081 1:95814531-95814553 CTTCTTCCCATATAAATGAAAGG - Intergenic
911547604 1:99238232-99238254 CTTAATCCTATTTCAATAAATGG - Intergenic
913008006 1:114653923-114653945 CTTCATCGTATTTCAGAGTATGG - Intronic
913447474 1:118964986-118965008 TTCCAAACCATTTCAAAGAACGG - Intronic
914214452 1:145612324-145612346 TTTCCTCCCATTTCAGAAAACGG + Intronic
914466391 1:147932718-147932740 TTTCCTCCCATTTCAGAAAACGG + Intronic
915958645 1:160245094-160245116 TCTCATCCCATTTCATATAATGG + Intronic
917771094 1:178278905-178278927 CTTTCTCCCATTACAAGGAAGGG + Intronic
918691777 1:187489470-187489492 CTAAATCCTATTACAAAGAATGG - Intergenic
919315630 1:195968018-195968040 CTACATCCCATTTGAAAAACAGG + Intergenic
920736333 1:208536288-208536310 CTTCACCCCATGCCAGAGAAAGG + Intergenic
920888864 1:209962698-209962720 CTTCATTCCCCTTCAAAGACTGG - Intronic
921345653 1:214182268-214182290 CCTTCTCCCATTTCAGAGAATGG - Intergenic
922460645 1:225812230-225812252 CTTCTTCCCAATTCCAGGAAAGG + Intronic
1063847100 10:10142245-10142267 TTTCATCCCCATTCAAAAAAGGG + Intergenic
1065495586 10:26324177-26324199 GATCATCACATTTGAAAGAAAGG + Intergenic
1065540901 10:26766108-26766130 CTTCCTCTCATCTCAAAGAAAGG + Intronic
1066306353 10:34146571-34146593 TTTCATCACATGTCAAAGAAAGG - Intronic
1067909746 10:50333950-50333972 CATTATCCCATTTTACAGAAGGG + Intronic
1068681422 10:59824290-59824312 CTTCATCACATCCCAAAAAATGG + Intronic
1069593629 10:69656594-69656616 CTTCATCCCATTTGGCAGAGGGG - Intergenic
1070268789 10:74931639-74931661 TTCCATCCCTTTTAAAAGAAAGG - Intronic
1070341839 10:75505090-75505112 ATTCATCCCATTTCCAAGCCAGG - Intronic
1072396320 10:95046367-95046389 CTTCATCCTATTTCATTGCATGG + Intronic
1072615585 10:97047189-97047211 ATTGATCCTATTTCAAAGGAAGG + Intronic
1072873923 10:99151659-99151681 CTTCCTCCAATTTGAAACAATGG + Intronic
1073194336 10:101676163-101676185 CTTTTTCACATTTTAAAGAAGGG - Intronic
1074278684 10:112029521-112029543 GATGATCACATTTCAAAGAATGG + Intergenic
1074494454 10:113967700-113967722 GTTATTCCCATTTCAAAGATGGG + Intergenic
1074886900 10:117700998-117701020 CTTATTCCCATTTGACAGAAGGG - Intergenic
1075356883 10:121786959-121786981 CTTCTGCCTACTTCAAAGAAAGG - Intronic
1075836690 10:125459830-125459852 TTTCATCACATTTCACAGAAAGG + Intergenic
1077631948 11:3816966-3816988 ATTATTCCCATTTCACAGAAGGG - Intronic
1079759730 11:24313614-24313636 TTTCAACCCATTTCTAACAAAGG + Intergenic
1080240875 11:30125884-30125906 CTTCAGCCCATTTGCAATAACGG + Intergenic
1080951982 11:37044677-37044699 CTTCATCCCACTTCAATGAAGGG + Intergenic
1082248302 11:49951089-49951111 CTTGATCCCCTTGCAAAGCATGG - Intergenic
1082287373 11:50332336-50332358 ATTCCTCCCATTTTAAAGATGGG - Intergenic
1082562647 11:54637277-54637299 CTTAATCCCCTTCCAAAGCACGG + Intergenic
1083476262 11:62917536-62917558 GTTCACCCCATTCCACAGAAGGG - Intronic
1084233755 11:67772502-67772524 CTTCATGCCTTTTCAACCAAAGG + Intergenic
1085053393 11:73391021-73391043 CCCCATCCCATTTCACAGATGGG - Intronic
1086557406 11:88127350-88127372 CTCCCTCCCATCTCAAAGAAGGG + Intronic
1086856555 11:91872618-91872640 CTCTATCTCATTGCAAAGAAAGG + Intergenic
1087394147 11:97575075-97575097 CATCTTACCATTTAAAAGAAAGG - Intergenic
1088061239 11:105653492-105653514 CTTCATCACATGGCTAAGAATGG + Intronic
1089912288 11:122113240-122113262 ATTCATCCCATTTCATAGAAAGG + Intergenic
1089920834 11:122207939-122207961 CTTCATCCCATTTCAGAGGACGG + Intergenic
1090438168 11:126703921-126703943 ATTCCTCCCCTTTCACAGAAAGG + Intronic
1092733838 12:11560262-11560284 CTTCATCTCTTTTTAAATAAAGG - Intergenic
1094095005 12:26693928-26693950 CTTCATCCCATTACACAGGTGGG + Intronic
1094468405 12:30779204-30779226 CTTTATCCCAGTTCAAAGAAGGG + Intergenic
1095734341 12:45540128-45540150 CCCCTTCCCATTTCAAAGATGGG + Intergenic
1096950772 12:55467362-55467384 TTTCACCCAAATTCAAAGAAAGG + Intergenic
1097850704 12:64407021-64407043 CTTTTTCCCATGTCATAGAAAGG + Intronic
1097981879 12:65743644-65743666 TTTTATCCCATTTAAAGGAAAGG + Intergenic
1099726328 12:86432544-86432566 CTTCTTCCCATTGTAAATAAAGG + Intronic
1100250147 12:92812501-92812523 CTTCCTCCTATTACCAAGAAAGG + Intronic
1101590077 12:106117646-106117668 CTTCATCCCATTTCAGGGGAGGG + Intronic
1101618664 12:106362272-106362294 TTTCCTCCCACTTCAAAGGAAGG - Intronic
1102025195 12:109710572-109710594 ATTAATCCCATTTCAAAGATGGG + Intergenic
1107049785 13:36034848-36034870 CCTCTTCCCATTTGAAAGAAAGG + Intronic
1110171940 13:72511667-72511689 CTTCATCCCAGTTTAAAGATGGG + Intergenic
1111166159 13:84460403-84460425 CTTCTTCCCACTTCAAACCAAGG + Intergenic
1112957972 13:105085021-105085043 TTTCATCACATTACATAGAATGG - Intergenic
1115463470 14:33687652-33687674 ATACTTCCCATTTCACAGAACGG + Intronic
1116091473 14:40312541-40312563 TTTCATCACATTACTAAGAACGG + Intergenic
1117029747 14:51655917-51655939 CCACTTCCCATTTCAAAGACTGG + Intronic
1117376845 14:55125128-55125150 ATTCATCCCATATCAGAGAAGGG - Intronic
1117648119 14:57873876-57873898 CTTCATCACATTCCATGGAAAGG - Intronic
1118015633 14:61657639-61657661 CTTTCTCCCATTTGAAAGTAGGG - Exonic
1120162836 14:81163865-81163887 CTTCCTCATATTTGAAAGAAAGG - Intergenic
1120552899 14:85893051-85893073 CTTAATTTCAATTCAAAGAATGG - Intergenic
1122080078 14:99261040-99261062 GTTCACCCGATTCCAAAGAACGG + Intronic
1122094802 14:99363046-99363068 CTTCCTCCCATTTTACAGACTGG - Intergenic
1122112381 14:99511518-99511540 CTTCCACCCATAACAAAGAAAGG - Exonic
1122194878 14:100077382-100077404 CTGTTTCCCATTTCAAGGAATGG - Intronic
1122338005 14:101006515-101006537 CCTCTTCCCATTTCACAGATGGG - Intergenic
1122668715 14:103353635-103353657 GTTCATCCCACATCAAAGCAAGG - Intergenic
1124142941 15:27093330-27093352 CATCATCCCATTGCACAGATGGG - Intronic
1124145014 15:27116720-27116742 CTTAATCCCATTCACAAGAAAGG - Intronic
1125166139 15:36707045-36707067 CTTCATCCTAGATCTAAGAAAGG - Intronic
1126020002 15:44390884-44390906 CCTCATCCCATTTATAAGAGTGG + Intronic
1126710315 15:51447631-51447653 CTGTATCCCATTTCCTAGAATGG + Intergenic
1127605619 15:60584427-60584449 CTACATGCCATTTAAAACAAAGG - Intronic
1128713063 15:69886348-69886370 TTTCATCCCATTTCACAGATGGG - Intergenic
1129165797 15:73776591-73776613 CTTCTTCCTATTTCAAAAACGGG - Intergenic
1129271083 15:74419569-74419591 CTCCGTCCCATTTCACAGATGGG + Intronic
1129917972 15:79291355-79291377 CTTCTTTCCATTTCATCGAAGGG - Intergenic
1131272377 15:90955150-90955172 TTTCAGCCCATTTCACAGACCGG + Intronic
1131941031 15:97565492-97565514 ATTCATTCCATTTCAGAGAAGGG + Intergenic
1133607513 16:7402758-7402780 CTTAATCCCATTTGATAGGATGG + Intronic
1133743139 16:8666606-8666628 CATCATCCCATTTTACAGATGGG + Intergenic
1135048690 16:19174699-19174721 TATCATCCCATTTCACAGATGGG - Intronic
1135338014 16:21620452-21620474 CTTCGACCCACTTCAAAGCATGG - Intronic
1137660394 16:50200694-50200716 CTTCTGCCCATTTTAAAAAATGG + Intronic
1139096564 16:63711545-63711567 CTTGAGCCCATTGCAAAAAAAGG - Intergenic
1139197709 16:64940246-64940268 CTTATTTCCATTTCAAAAAAGGG + Intergenic
1139267554 16:65654458-65654480 CTTCATCCAATTTCAAAGTCTGG + Intergenic
1141558885 16:84853819-84853841 CGTGATCCCATTTTACAGAAAGG + Intronic
1141876085 16:86825436-86825458 CTTTATCCCCTTTCACAGAAGGG - Intergenic
1142196006 16:88739617-88739639 CCCCATCCCATTTGACAGAAGGG - Intronic
1144051575 17:11501549-11501571 CTTAATCCCATTTCTAGGAATGG + Intronic
1145035638 17:19538690-19538712 CTTCCTCACATGTAAAAGAAGGG + Intronic
1145260664 17:21352579-21352601 CTTGTTCCCATTTCACAGAAGGG + Intergenic
1145958901 17:28874083-28874105 CTTCGTCCCATCTGGAAGAACGG - Intergenic
1146286050 17:31574822-31574844 CTCCAGCCCATCTTAAAGAACGG - Intronic
1146560721 17:33867491-33867513 CTCCATCCAATTCCAAAGACTGG + Intronic
1149454780 17:56779073-56779095 CATCATCCCATTTTACAGATTGG - Intergenic
1150124004 17:62625131-62625153 CTTCATCTGCTTCCAAAGAAGGG - Intergenic
1151547127 17:74800006-74800028 CGTCATCCCATTTCACAGCAGGG + Intronic
1152041815 17:77908617-77908639 TTTTATCCCATTTAACAGAAAGG + Intergenic
1203159976 17_GL000205v2_random:40050-40072 CTTCTTCCCATAATAAAGAATGG - Intergenic
1154390116 18:13929524-13929546 GTTCCTCCCATCTCAAAGCAGGG - Intergenic
1154939583 18:21097980-21098002 CATCATCCCATTTCAGAGATGGG + Intronic
1155304882 18:24469334-24469356 TCTCATCACATTTCAAAGTATGG - Intronic
1155425949 18:25707676-25707698 CTTCAACACATTTCACAGAAAGG - Intergenic
1155726085 18:29085225-29085247 CTTAATCCCATTGAAAAGGAAGG - Intergenic
1156649433 18:39207093-39207115 ATTCCTTCCATTTTAAAGAAAGG - Intergenic
1156870487 18:41939762-41939784 CTTCATCCCCCTTCAAATGAGGG + Intergenic
1157912240 18:51627556-51627578 TTTCATCCCACTCCGAAGAAAGG - Intergenic
1159825526 18:73204534-73204556 CTTTCTCCCATTTCAAAGTCTGG + Intronic
1160131079 18:76225471-76225493 TTTCATCACATCTCAAAAAAAGG + Intergenic
1160195667 18:76753207-76753229 CATCATCCCATTCCCATGAAAGG + Intergenic
1161940088 19:7396824-7396846 CTTATTCCCATTTTAAAGATGGG - Intronic
1163587659 19:18172904-18172926 CTTCTCCCCATTACACAGAAGGG + Intronic
1164643738 19:29843917-29843939 CACCATCCTATTTCACAGAAGGG - Intergenic
1164861371 19:31564733-31564755 CATCATCCCAGTGCAATGAAGGG - Intergenic
1166855522 19:45781084-45781106 CCTCCTCCCATTTCACAGATGGG - Intronic
1167449268 19:49557299-49557321 CTTCCTCCCATTTCACAGGTAGG + Intronic
1168034655 19:53709816-53709838 CCTTGTCCCATTTCAAAGATAGG + Intergenic
926537588 2:14132726-14132748 CTTCTTCCCCTTTCACATAAAGG + Intergenic
927622349 2:24675305-24675327 TTTCATCCCATTTCCAAGCATGG - Intronic
928327379 2:30330212-30330234 CATCATCCAATTTTAAAGATGGG - Intergenic
928392327 2:30919099-30919121 TTCCATCCCAATTTAAAGAAAGG - Intronic
928676303 2:33654918-33654940 CTTTTCCCCATTTCTAAGAATGG - Intergenic
930042604 2:47139567-47139589 CTTCATTCCATCTCATGGAAAGG + Intronic
930144961 2:47992437-47992459 CTTATTACCATTTTAAAGAAGGG - Intergenic
930780623 2:55222085-55222107 GTTCATCCAATTTCTCAGAAAGG - Intronic
931152629 2:59591988-59592010 CTTAAACCTATTTCAAAGGATGG + Intergenic
931197985 2:60071504-60071526 CCTCCTCCCTTTTGAAAGAAGGG - Intergenic
932875294 2:75444871-75444893 ACTAATCCCATCTCAAAGAATGG + Intergenic
933128110 2:78636368-78636390 CTTCATCCCACTTCACAGGTCGG + Intergenic
937238134 2:120442830-120442852 CGTCATCCCATTTCGTAGATGGG + Intergenic
937638482 2:124184832-124184854 CTTCTTCCCAGTTTAAAGTATGG - Intronic
939302804 2:140368125-140368147 CTTTATGCCATTTCAAAATAAGG - Intronic
942959021 2:181807391-181807413 TTCCATCCCATTCTAAAGAATGG - Intergenic
943769867 2:191704934-191704956 CTTCATGCCATTTCACAGCACGG - Intergenic
944513909 2:200491858-200491880 TATGATCCCATTTCCAAGAATGG - Intronic
945363073 2:208915395-208915417 CTTCATCAAATTCCAAAGCATGG - Intergenic
945937441 2:215917212-215917234 CTTCCTCCCCTTTCACCGAAGGG - Intergenic
946212085 2:218155312-218155334 CTTCCTTCCAGTTCTAAGAATGG - Intergenic
946808355 2:223495940-223495962 TTTCATCACATTTCAATAAATGG - Intergenic
946984264 2:225254389-225254411 GTTCATCTCATTTAAAATAATGG + Intergenic
947117507 2:226787524-226787546 CTTCATCCCCTTTCAATAAAAGG + Intronic
948113903 2:235479593-235479615 CTTTTTCCCTTTTCAAATAAGGG - Intergenic
1168785890 20:540005-540027 CTCCATTCCATTTCAAAGCCTGG + Intronic
1169559646 20:6786317-6786339 CTTCATACCATCACCAAGAAAGG - Intergenic
1171155082 20:22864624-22864646 GTTTATCCCACTTCAAAGCAAGG - Intergenic
1171192618 20:23170037-23170059 ATTCTTTCCATTTCACAGAAAGG + Intergenic
1171566452 20:26195384-26195406 CTTCATACCATTTCCCAAAATGG - Intergenic
1172533687 20:35653797-35653819 GTTCATCCAATTACTAAGAAAGG - Exonic
1172994570 20:39060525-39060547 CTTCATCCCACTGCACAGCACGG - Intergenic
1175063000 20:56260570-56260592 ATTCATCCCATTTTACAGAAGGG - Intergenic
1177369742 21:20186557-20186579 TTTCATCACATTTAAAAAAATGG + Intergenic
1177831384 21:26142963-26142985 CTTTATTCCATGTCAAAGATAGG + Intronic
1178282699 21:31297088-31297110 CTTCATGCTATGTAAAAGAATGG + Intronic
1178420650 21:32440475-32440497 CTTCATGCCTTTTCAACCAAAGG - Intronic
1181959203 22:26610790-26610812 CTTCTCCCCATTTCAAAGATGGG + Intronic
1182853766 22:33499325-33499347 CCTCATCCCTGTTCAAAGTATGG + Intronic
1183365135 22:37402963-37402985 CTTGAGCCCACTTCCAAGAATGG + Intronic
1184495140 22:44836692-44836714 ATTCATCCCCTTTCAAATATTGG + Intronic
1184775980 22:46623152-46623174 CTTCATCCCTTTACAAGGACGGG + Intronic
949783877 3:7719304-7719326 CTTCATATCACTTCAGAGAATGG - Intronic
950106754 3:10393467-10393489 CCTCACCCCATTTCACAGATAGG + Intronic
950309761 3:11946788-11946810 CTTCATCCAATTTCCTACAAAGG + Intergenic
951152820 3:19312505-19312527 CTTCTTGGCATTTAAAAGAATGG + Intronic
953398087 3:42588957-42588979 TTTCATCCCATTTCACAGAGAGG - Intronic
953890107 3:46744902-46744924 CCTCTTCCCATTTCAGAGATGGG + Intronic
955558729 3:60165450-60165472 ATTCATGCCACTTCCAAGAATGG + Intronic
955600216 3:60636979-60637001 CTTCCTTCCATTTCCAAGACAGG + Intronic
955784237 3:62519527-62519549 CTTCATACTCTTCCAAAGAAAGG + Intronic
955995751 3:64678813-64678835 CTGCATCTGAATTCAAAGAAGGG + Intronic
956431812 3:69194073-69194095 CCTCTTCCCTTTTCAAGGAAGGG + Intronic
956717178 3:72088641-72088663 CTTCATCCCGTGCCAAAGGAGGG + Intergenic
958443523 3:94185711-94185733 CTTGATGGCATTTCAAAGCAAGG + Intergenic
961738914 3:129020330-129020352 CTTACTCCCATTTAAAAGATTGG + Intronic
963060199 3:141219593-141219615 CTTAATCCCATTTCATGTAAGGG - Intergenic
963700563 3:148620052-148620074 CTCCATCCCAAATGAAAGAAAGG + Intergenic
964023429 3:152042217-152042239 ATTCATGCCATTTCAATGCATGG + Intergenic
964722623 3:159782265-159782287 ATTCATCCCATTTTATAGACAGG + Intronic
964807530 3:160627886-160627908 CTGCTTCCTAATTCAAAGAATGG + Intergenic
967288771 3:187898953-187898975 GTTCATCCCTTTACAAAAAAAGG - Intergenic
967666809 3:192182467-192182489 CCTAATCCCATATAAAAGAATGG + Intronic
968598341 4:1496765-1496787 CTTCATACCATTCCCTAGAATGG + Intergenic
968958874 4:3732673-3732695 GTTCCTCCCATTTCACAGATCGG - Intergenic
969083224 4:4636336-4636358 TTTCCTGCCATTTCAAATAATGG - Intergenic
970481187 4:16477072-16477094 CTTCAGCACCTTTCAAAGATAGG - Intergenic
970546346 4:17134099-17134121 TTTCTTCTGATTTCAAAGAAGGG + Intergenic
974951869 4:68592682-68592704 ATTGATCCCATTTCAATGGAAGG + Intronic
975901167 4:79154987-79155009 CCTCAACCCATTTCACAGTAGGG - Intergenic
975922370 4:79407549-79407571 CTTTATCCCATTCCAAAGAATGG + Exonic
977551772 4:98450287-98450309 TTTCATTCCATTTGAAATAATGG - Intergenic
982256861 4:153459299-153459321 CTTCATCCCACCTCTAACAATGG + Intergenic
982959617 4:161820915-161820937 CTTAATCAGATTTCAAAGATTGG + Intronic
983122413 4:163903065-163903087 CTTCAGTCGATTTTAAAGAATGG - Intronic
983758561 4:171374974-171374996 CTGAGTCACATTTCAAAGAAGGG - Intergenic
984807520 4:183765392-183765414 CTTCAGCACATTTCAAAGAATGG - Intergenic
985121011 4:186642135-186642157 TTTCATCCCAATGCAATGAATGG + Intronic
986150649 5:5126855-5126877 CTTCATCCCAGTGAAAAGGAAGG + Intergenic
986531697 5:8743408-8743430 CTTGATAGTATTTCAAAGAATGG + Intergenic
986761893 5:10887757-10887779 ATTCTTCTCCTTTCAAAGAATGG + Intergenic
987738732 5:21877257-21877279 CTTCGTTCCATTTTAAAGACTGG + Intronic
987761796 5:22173615-22173637 CATCATACCATCTCATAGAAAGG - Intronic
987979664 5:25066143-25066165 CTTCAGCCCATTACACATAATGG + Intergenic
988654922 5:33200121-33200143 CCTCAACCCATTTCATTGAAGGG - Intergenic
989040595 5:37223925-37223947 CTTTATCACAAATCAAAGAAAGG + Intronic
992757633 5:79923657-79923679 CATCATCCCATGGCAAAAAATGG + Intergenic
993229337 5:85211770-85211792 CCTCATCACATTTCAAAGGATGG - Intergenic
995415830 5:111911925-111911947 CTTCACCCCATTTTACAGATGGG + Intronic
995973665 5:118004506-118004528 CTGTAGACCATTTCAAAGAATGG + Intergenic
996618465 5:125470340-125470362 CTTCATCTTATTTCAAATAATGG + Intergenic
996945478 5:129061997-129062019 ATTCATAACATTGCAAAGAAAGG - Intergenic
998497852 5:142606260-142606282 TTTAATCCCCTTTCAAAGAAAGG + Intronic
1000070120 5:157732627-157732649 TTTATTCCCATTTCACAGAAAGG + Intronic
1000836495 5:166161173-166161195 TTTAATCCCATTTCAAAGACAGG - Intergenic
1001532639 5:172474964-172474986 ATTCCTCCCATTTCACAGATGGG + Intergenic
1002095148 5:176826266-176826288 ATTCTTCCCATTTCATAGATGGG - Intronic
1003518492 6:6837271-6837293 CTTACTCTCATTTCAAAAAATGG + Intergenic
1004936919 6:20516900-20516922 CTTCTTCCCAATTCAGTGAAGGG + Intergenic
1005327647 6:24719099-24719121 CTTAATCCCTTTTCTAAAAAGGG - Exonic
1007037849 6:38694174-38694196 CTTCAGCAAATTTAAAAGAATGG - Intronic
1007465948 6:42050980-42051002 CTTCACACCATTTCATTGAAAGG - Intronic
1007749532 6:44063394-44063416 CTGCATCCCATTCCCAAGGAGGG + Intergenic
1008022190 6:46592164-46592186 ATTCATTCCATTTCCAGGAAAGG + Intronic
1008706163 6:54162426-54162448 CTTCATGCCATGGCAAATAAGGG - Intronic
1011034790 6:82961433-82961455 ATTCATCCCATTTTAAAAATAGG + Intronic
1012539078 6:100339491-100339513 GCTGATGCCATTTCAAAGAATGG + Intergenic
1012905552 6:105060557-105060579 CTTCATGCCATGTCACAGATCGG - Intronic
1015031751 6:128603738-128603760 CTCAATCACATATCAAAGAAAGG - Intergenic
1015359215 6:132317799-132317821 CTTCTTCCCATTTCAACCAAAGG + Intronic
1016400988 6:143679517-143679539 CTTCTTTTCATTTCAAGGAAGGG + Intronic
1016491779 6:144612774-144612796 CTTCATACCATTTTACATAATGG - Intronic
1016883506 6:148935061-148935083 CTTCTCCCCATTTCAAACCAGGG + Intronic
1018333111 6:162754056-162754078 CTTCATACCATTTCTCATAATGG + Intronic
1018833661 6:167466673-167466695 CTACAGCCCATTTGTAAGAATGG + Intergenic
1020317366 7:6915583-6915605 CTTCATGCCTTTTCAACCAAAGG + Intergenic
1020927229 7:14345637-14345659 GTTCATCACATTTTAAAAAACGG + Intronic
1021812249 7:24414477-24414499 CTTTTTCCCCTTTCAAAGGAGGG - Intergenic
1022461756 7:30615331-30615353 CTTCATCCCATTTCAAAGAATGG - Intronic
1022892047 7:34711377-34711399 CTTCATTCCATCTCATAGAGAGG - Intronic
1023147176 7:37163078-37163100 ATTCTACACATTTCAAAGAAAGG + Intronic
1024453948 7:49581283-49581305 CTCAATGCCATTCCAAAGAATGG - Intergenic
1024788943 7:52940593-52940615 CTTCCTCCCACTTAAAAAAATGG + Intergenic
1027309090 7:76935497-76935519 CATCATCCCCCTTCACAGAAGGG + Intergenic
1027714285 7:81650116-81650138 TTTCATGCCATTTCTAAAAATGG - Intergenic
1032427608 7:131834040-131834062 CTTCTCCCCATTTCTCAGAAAGG - Intergenic
1033669680 7:143478970-143478992 CTTTATAACATTCCAAAGAAGGG - Intergenic
1034356363 7:150453514-150453536 GTTCATACCTTTTCAAAAAATGG - Intronic
1037024556 8:14018000-14018022 TTTCATCAGATTTCAAAGAGAGG - Intergenic
1039048968 8:33475629-33475651 CCTCAACAAATTTCAAAGAATGG + Intronic
1041360515 8:57048275-57048297 GTTCATCATTTTTCAAAGAATGG + Intergenic
1041386783 8:57312658-57312680 CCAAATCCCATGTCAAAGAAAGG + Intergenic
1042661384 8:71158262-71158284 CCTCATACCCTTTCAAAGACTGG + Intergenic
1044191120 8:89318917-89318939 CTACCTCCAATTACAAAGAAAGG + Intergenic
1044769803 8:95619024-95619046 CTCCATCCCTTGTCAAAGAGAGG - Intergenic
1045165820 8:99603664-99603686 CTTCATCACACTACTAAGAATGG + Intronic
1046417025 8:113930549-113930571 CTTTATCACATTTTAAAAAAAGG + Intergenic
1046830743 8:118743069-118743091 CTTATTTCCATGTCAAAGAATGG - Intergenic
1048334064 8:133490189-133490211 CATAATCCCATTTTACAGAAGGG + Intronic
1048361922 8:133704916-133704938 GTTCATCCCATGCCAATGAAGGG + Intergenic
1049193649 8:141303580-141303602 ATTTTTCCTATTTCAAAGAAAGG - Intronic
1051039469 9:12789399-12789421 TTTTATCCTATTTCATAGAAGGG + Intronic
1051997781 9:23238778-23238800 CTTCTTCCCATTTTAAGGACTGG - Intergenic
1052557816 9:30041012-30041034 TTTCCTCCCATTTCAAATGAAGG + Intergenic
1053481696 9:38420943-38420965 CTCCTTCCCATTTGATAGAAGGG - Intronic
1055988643 9:82080896-82080918 CATCCTGCCATTTCAATGAATGG + Intergenic
1057006253 9:91563297-91563319 CTTCTTCCCATTTCAAATATGGG + Intronic
1058118787 9:101115714-101115736 CTGCATCCCATTTTAATGAAAGG + Intronic
1058118793 9:101115791-101115813 CTGCATCCCATTTTAATGAAAGG + Intronic
1058295574 9:103302679-103302701 ATTCGTTCCATTTCAAATAAGGG + Intergenic
1059914952 9:119088695-119088717 CTTCTTCTCATTTCAGAGACAGG + Intergenic
1060966151 9:127713326-127713348 CTTCAGCCCATTTTACAGATGGG - Intronic
1191055390 X:56234632-56234654 CTTCATCACTTCTGAAAGAAAGG + Intronic
1192115746 X:68409175-68409197 CTTGATCCCATTTCACATATAGG + Intronic
1192465907 X:71355743-71355765 GCTGATACCATTTCAAAGAATGG + Intergenic
1194936872 X:99960820-99960842 CTTCAACCCCCTCCAAAGAAGGG + Intergenic
1197459956 X:126728931-126728953 CTTCATCCCATCTTTAAAAAAGG + Intergenic
1197701022 X:129599747-129599769 CCTCATCTCATCTGAAAGAATGG - Intergenic
1198560995 X:137849995-137850017 CTTGCTCCCCTTTCAGAGAAGGG + Intergenic
1199406959 X:147473502-147473524 ATACCTCCTATTTCAAAGAAAGG + Intergenic
1199443832 X:147898263-147898285 CTTCATCCCATTACTCAAAATGG - Intergenic
1200848089 Y:7852223-7852245 TTTCAACCCATTGCAATGAAGGG + Intergenic
1201547239 Y:15178977-15178999 CTTAATCCAAACTCAAAGAAGGG - Intergenic
1202332848 Y:23772812-23772834 CTTCAGTCCATTTCAATGCAAGG + Intergenic
1202537921 Y:25897251-25897273 CTTCAGTCCATTTCAATGCAAGG - Intergenic