ID: 1022462635

View in Genome Browser
Species Human (GRCh38)
Location 7:30625617-30625639
Sequence TCTTATAACCTGAAACTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 214}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022462634_1022462635 25 Left 1022462634 7:30625569-30625591 CCTAAGCTGAAATACAGGTATTA 0: 1
1: 0
2: 1
3: 23
4: 231
Right 1022462635 7:30625617-30625639 TCTTATAACCTGAAACTGAATGG 0: 1
1: 0
2: 2
3: 24
4: 214
1022462633_1022462635 28 Left 1022462633 7:30625566-30625588 CCTCCTAAGCTGAAATACAGGTA 0: 1
1: 0
2: 0
3: 10
4: 92
Right 1022462635 7:30625617-30625639 TCTTATAACCTGAAACTGAATGG 0: 1
1: 0
2: 2
3: 24
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022462635 Original CRISPR TCTTATAACCTGAAACTGAA TGG Intronic
906627984 1:47341112-47341134 TCTTATAACTTAAAATGGAAAGG - Intronic
910097002 1:83534570-83534592 TCCAATAACCAGAAACTCAATGG + Intergenic
911336121 1:96582661-96582683 GCTTATAAACTAAACCTGAATGG + Intergenic
912486619 1:110034419-110034441 ACATCTAAACTGAAACTGAAAGG + Intronic
915048104 1:153036370-153036392 TCTAATATCCTGAATCTAAAAGG - Intergenic
916486513 1:165264631-165264653 TCTTATAAGGTGAAACTAAAGGG + Intronic
917143570 1:171863277-171863299 TCTTATCCACTGTAACTGAAAGG + Intronic
917336882 1:173932905-173932927 TCTTATAACTGGAAACTGTCAGG - Exonic
917346278 1:174031125-174031147 TCTTGTAGACTGAAAGTGAAGGG + Intergenic
918057399 1:181033966-181033988 TCTTTTAACCAAAAACTGACAGG - Exonic
919111758 1:193228694-193228716 ACTTAAAAGCTGAAACTGTAAGG + Intronic
920057070 1:203200552-203200574 ACATAAACCCTGAAACTGAAAGG + Intergenic
921427433 1:215020904-215020926 ACTTATAAAATGAAATTGAAAGG - Intronic
923367318 1:233275518-233275540 TCTTATAAGGTGATACTGAAAGG + Intronic
924363900 1:243269245-243269267 TCTTCTAATCTGAAACTGACTGG - Intronic
1065639480 10:27767276-27767298 TCTGAAAACCTGGAACTGAGGGG - Intergenic
1065673520 10:28148311-28148333 TCCTATAGCCTAAAATTGAATGG - Intronic
1067018768 10:42777022-42777044 TATTATGACTAGAAACTGAAAGG - Intergenic
1067970412 10:50963846-50963868 CCTATTAACCTGAAACTGAGAGG + Intergenic
1071217064 10:83418406-83418428 TCATATAGACTGAAAGTGAAGGG - Intergenic
1072379222 10:94850077-94850099 TCTTGTACCCTGAAACACAAAGG - Intronic
1075860390 10:125670467-125670489 TCTAATAACCAGAATCTGCAAGG - Intronic
1077087111 11:758936-758958 TCTTGTGACCTGAAATTCAAAGG - Exonic
1078329827 11:10409990-10410012 TCATATAACCTGATGCTAAAAGG - Intronic
1078601784 11:12738670-12738692 TTTTTTCATCTGAAACTGAAAGG - Intronic
1080366604 11:31581337-31581359 TCTAATAACTTGAGAGTGAATGG + Intronic
1081368790 11:42272324-42272346 TCTCATAATATGATACTGAATGG + Intergenic
1083129038 11:60605477-60605499 TCTGATATCCTGAAACTGTATGG + Intergenic
1085607268 11:77912977-77912999 CATTATTACCTGAAACAGAAGGG - Intronic
1086354209 11:85976285-85976307 TCTTATAACCTGATATTGTAGGG - Intronic
1086449880 11:86905515-86905537 TCTTAGAAGTTGAATCTGAAAGG - Intronic
1086721112 11:90122859-90122881 TCTTATTTCCTGCAAGTGAAAGG + Intergenic
1087300215 11:96424403-96424425 TCTTAAAACCAGAGACTCAAGGG - Intronic
1088298889 11:108333473-108333495 TCTTATTACTTGAAAACGAATGG + Intronic
1088838075 11:113595977-113595999 TCTTAAAACCTTCAACTGATTGG + Intergenic
1089379432 11:118017040-118017062 TTTTGTAACTTAAAACTGAAGGG - Intergenic
1090303264 11:125666852-125666874 ACATATAAACTGAAAGTGAAGGG - Intronic
1092043689 12:5408798-5408820 TCTCAGAACCTGAAACCGACTGG + Intergenic
1093224289 12:16463024-16463046 TCTTCTAATCTAAAACTTAAAGG + Intronic
1093291533 12:17330494-17330516 TGTTATATCCTGAAACAGATTGG + Intergenic
1093490555 12:19700172-19700194 TTTTATCTCCTGAAACTGGACGG - Intronic
1094225197 12:28037669-28037691 TCTTTTAACTTGATACTGTATGG - Intergenic
1096157986 12:49352035-49352057 TCTTAAAACCAGAGAGTGAAAGG + Exonic
1096316703 12:50573996-50574018 TCTTGCAATCTGAAAGTGAATGG + Intronic
1098084682 12:66829765-66829787 TTTCCTAACCTGAAACTGAGAGG - Intergenic
1098172326 12:67759389-67759411 ATTTATAACCTGGAACTGAGAGG - Intergenic
1098369404 12:69739999-69740021 GCTTTTAACCCGACACTGAACGG - Intronic
1099023287 12:77433305-77433327 TTTTATTACATGAAACTCAATGG - Intergenic
1100219249 12:92486122-92486144 TCTCATAACCTTAATCAGAAAGG + Intergenic
1101613103 12:106310020-106310042 TGGTATCACCTGACACTGAAGGG - Intronic
1102788282 12:115621898-115621920 TCTTATAGCCTTCAACTGATTGG + Intergenic
1103285991 12:119802198-119802220 TCTGAGAACCTGAAAGTGCAGGG + Intronic
1103447081 12:121001476-121001498 TCTTCTTACTTGGAACTGAAGGG + Exonic
1106629296 13:31453823-31453845 TCCTATAACCTGTGAATGAAAGG + Intergenic
1107468706 13:40671370-40671392 TCTACTAACCTGTAACAGAAGGG + Intergenic
1109009636 13:56923689-56923711 TCTTAAAAACTGTAACTGATGGG - Intergenic
1109495092 13:63159095-63159117 TCTAATAGCCAGAAACTGTAAGG - Intergenic
1109743738 13:66592131-66592153 TTTTATAACCTGAAAGTGATTGG + Intronic
1110051046 13:70899998-70900020 TCATATCAACTGAAACTGAATGG + Intergenic
1110910809 13:80960368-80960390 TTTTTTAAGCTGAAACTCAAAGG - Intergenic
1111139431 13:84095942-84095964 TTTTAAAACCTGAAACTAAAGGG - Intergenic
1111358396 13:87141440-87141462 TCTGATATCCTGAATCTAAAAGG + Intergenic
1111945680 13:94662896-94662918 TCTTATAAGGTAAAACTGAATGG - Intergenic
1114274016 14:21125415-21125437 ACATATAAACTGAAAGTGAAGGG + Intergenic
1115940669 14:38605422-38605444 TCTTATATCCTGAAAAAGAATGG + Intergenic
1116004107 14:39274211-39274233 TCTGATAAACTGAAATTTAAAGG - Intronic
1116793472 14:49364634-49364656 TCTTATCAACTGAATGTGAAGGG - Intergenic
1120509691 14:85398376-85398398 GCTTATAACCTAATACAGAAGGG - Intergenic
1120994527 14:90406739-90406761 TGTAATTACCTGAATCTGAAAGG + Exonic
1123877993 15:24643519-24643541 ACCTATAAACTGAAAATGAAGGG + Intergenic
1125269205 15:37919807-37919829 TCATATAAACTGAAACTAAAAGG - Intergenic
1126500688 15:49340642-49340664 TCTTATATCCAGAATCTGTAAGG - Intronic
1128846526 15:70902236-70902258 TCAAGTAACATGAAACTGAAGGG - Intronic
1128924996 15:71647268-71647290 TCTTGCAACTTTAAACTGAAAGG - Intronic
1131323877 15:91423520-91423542 TCATGTAACCAGAAAATGAAAGG - Intergenic
1132003761 15:98207447-98207469 TCCTAGAGCCTGAAACTAAAAGG + Intergenic
1132010542 15:98272255-98272277 TAATATAACCAGAAATTGAAAGG + Intergenic
1137903525 16:52295195-52295217 TCCTATACACTGAATCTGAATGG + Intergenic
1139240172 16:65383425-65383447 TCTGACAACCTGGAAATGAATGG + Intergenic
1140045701 16:71439238-71439260 TCACATAACCTGGAAGTGAAAGG + Intergenic
1141410180 16:83827862-83827884 GCTTACAACCTCAAACTGAGGGG - Intergenic
1143945567 17:10589050-10589072 TTTTATGACGTGAAACTCAAAGG + Intergenic
1146754388 17:35414662-35414684 TTTTGTATCCTGAAACTTAATGG - Intronic
1147328358 17:39681176-39681198 TCTTATAAGCAGAAACACAAGGG + Intronic
1148521646 17:48282155-48282177 TCTAATAAAATGAAACAGAAAGG - Intronic
1148750486 17:49942913-49942935 TCTTATCACCGGAACCTCAAAGG + Intergenic
1148966554 17:51440751-51440773 TCATCTAACCTGAAAGTCAATGG + Intergenic
1149257582 17:54844091-54844113 TCCTAAAACCTTAAATTGAAAGG + Intergenic
1150100259 17:62417033-62417055 TCCTATTCCCTGAAACTGAAAGG - Intergenic
1150500346 17:65644462-65644484 TCTTCTCACGTGAAACTGGATGG + Intronic
1151075515 17:71267770-71267792 TCTAATAATCTGGAAATGAATGG + Intergenic
1151913064 17:77097202-77097224 GCTTATAACTTGAAATTGACAGG + Intronic
1154239550 18:12639936-12639958 TCCTATAAACTGACACAGAATGG + Intronic
1155322751 18:24634370-24634392 TCATTTTACCTGAGACTGAAGGG - Intergenic
1155622229 18:27793045-27793067 TCTTATACCCTGACACAGCAGGG + Intergenic
1155933634 18:31731852-31731874 CCCTGAAACCTGAAACTGAAGGG + Intergenic
1157053828 18:44200843-44200865 ACTTATAAGCTCAAACTAAAGGG + Intergenic
1157073898 18:44443623-44443645 TCTTATCACCTGGGATTGAATGG + Intergenic
1157493189 18:48137969-48137991 TCTTTTACCCTGGAACTGACTGG + Intronic
1157982118 18:52393887-52393909 TCATGGAACCTGAATCTGAAAGG - Intronic
1158748017 18:60224682-60224704 ACATATAAACTGAAACTTAAAGG - Intergenic
1158980263 18:62753691-62753713 TGTTATATCCTGAAAAGGAAGGG - Intronic
1159355102 18:67329140-67329162 AATTAGAACCTGAAATTGAAAGG + Intergenic
1160220039 18:76968718-76968740 TCTTATAACCAGAAACATGAAGG - Exonic
1164837982 19:31370506-31370528 TCTTCTAACCTGAAACAGGACGG + Intergenic
1168156977 19:54479542-54479564 TATTAAAACCTAAAACTAAATGG + Intergenic
1168291116 19:55358207-55358229 TCTTAGAACTTGAAACTGTGAGG - Exonic
928052501 2:28014016-28014038 TCTTAAAAACAAAAACTGAAAGG + Intronic
929350894 2:40953363-40953385 TCTTAAAACCTTCAACTGATAGG + Intergenic
930463858 2:51719347-51719369 TCTTATACCATGATACTGAAGGG - Intergenic
930799006 2:55422807-55422829 TCTTCTAATCTGAAACTAAATGG + Intergenic
930828934 2:55722539-55722561 TCATATAACCTAAAACAGAAAGG - Intergenic
931251741 2:60537358-60537380 TGTTTTAACTGGAAACTGAAAGG + Intronic
931873911 2:66491349-66491371 TCCTTTAACCTGCAATTGAAAGG - Intronic
935774807 2:106463746-106463768 TGTTTTAAGCTGAAATTGAACGG + Intronic
935905261 2:107832166-107832188 TGTTTTAAGCTGAAATTGAACGG - Intronic
939119267 2:138097036-138097058 TCTAATAATCTTAAACAGAATGG - Intergenic
939580936 2:143945004-143945026 TTTTCTATCCTGAAACTAAATGG - Exonic
942003516 2:171674967-171674989 TCATATAACGTGTAATTGAAAGG + Intergenic
942868397 2:180704773-180704795 TCTCATAGTCTGAAAGTGAAGGG - Intergenic
944139733 2:196442946-196442968 TCTGATAAACCGAAACAGAAAGG + Intronic
946387768 2:219395624-219395646 AGTTATGACCTGAAACTGGAAGG - Intronic
1168777539 20:461008-461030 TCTTATGTTCTGATACTGAATGG - Intronic
1171240391 20:23563018-23563040 TCTTATAACCTGGGTCTGCAAGG + Intergenic
1171501540 20:25597393-25597415 TATTTTAACCAGAAACTGTAAGG - Intergenic
1175493483 20:59395248-59395270 TTTTATCACCTGCAACTAAAAGG - Intergenic
1177530452 21:22352087-22352109 TCTTGTAACCTCCAACTGCATGG + Intergenic
1177693578 21:24541727-24541749 TGCCATAACTTGAAACTGAAGGG - Intergenic
1178526487 21:33333954-33333976 ACATATAAACTGAAATTGAAGGG + Intronic
1183126393 22:35785510-35785532 TCTTTTAGCCTGAAAGTCAAAGG - Intronic
1184327603 22:43801991-43802013 TCGTATAGACTGAAAGTGAAGGG + Intronic
949707961 3:6840573-6840595 CCTTATTACCAGAAACTGTAGGG + Intronic
950821991 3:15770278-15770300 TATTATAATCTGAAACTTTAAGG - Intronic
951406643 3:22308034-22308056 TCTTTTGACCTGAAAGTAAATGG - Intronic
953247976 3:41213609-41213631 TGCTATGACCTGAAACTAAAAGG + Intronic
953492053 3:43360941-43360963 TCTTAGCCCCTGAATCTGAATGG - Intronic
954527672 3:51287078-51287100 TCTGATAACCAGAATCTGTAAGG + Intronic
957247147 3:77730107-77730129 TTTTATTACCTGAAACTCACTGG - Intergenic
957395720 3:79634512-79634534 TCTTATAATCTGAAGAAGAAAGG + Intronic
959347879 3:105221936-105221958 TCAAAGAACCTGAAATTGAACGG - Intergenic
959868645 3:111301347-111301369 TCTGATACCTTGAAACTCAAGGG - Intronic
962724551 3:138210498-138210520 TATGATAATCTGAAACTCAAAGG - Intronic
963037982 3:141049156-141049178 TCTTATAACCTAATATTGGAAGG + Intergenic
964580439 3:158228482-158228504 TCTTATATTCTGAAACTAATGGG + Intronic
966704528 3:182896229-182896251 ACTTAAAACCTGTATCTGAAAGG - Intronic
971583832 4:28378972-28378994 GCTTAGAAACAGAAACTGAATGG + Intronic
972072113 4:35034296-35034318 ACATATAACCTGTAAGTGAAGGG + Intergenic
973749142 4:53995365-53995387 CCTTTTTTCCTGAAACTGAAAGG - Intronic
973820067 4:54655273-54655295 TCTTATAACCAGAAAGTCCAGGG - Intergenic
974918462 4:68206198-68206220 TCTTAAAAAATGAAACTAAATGG + Intergenic
975013352 4:69381176-69381198 CCTCATCCCCTGAAACTGAAAGG + Intronic
975423520 4:74198010-74198032 TCATAAAACCTGAATCTAAAAGG - Intronic
977527783 4:98165863-98165885 TCTTAAAGCCTGCAACTGATTGG + Intergenic
978946071 4:114498155-114498177 TCTTACTATCTGAGACTGAAGGG - Intergenic
980856546 4:138447390-138447412 TCACATAACATGAAACTTAAGGG - Intergenic
981063040 4:140447568-140447590 TCTTATAAGCTCAAAATAAATGG - Intronic
981088802 4:140711277-140711299 TCTGAAAACCTAAAACTCAAAGG + Intronic
981590877 4:146359476-146359498 TTTTATTACCTGAAAATGACTGG + Intronic
983755766 4:171333389-171333411 TCTGATATCCAGAAACTGTAAGG + Intergenic
983975837 4:173933153-173933175 TCTTATACCTGGAAATTGAATGG + Intergenic
984358097 4:178691188-178691210 TAATATAACCTGTAACTCAAAGG + Intergenic
985379537 4:189377837-189377859 TCTCATGACCTAAAACTGAGAGG + Intergenic
987788258 5:22529833-22529855 CCTTAGATCCTGAAATTGAATGG - Intronic
988114012 5:26859634-26859656 TCTTAAAACTTAAAGCTGAACGG - Intergenic
988571521 5:32372027-32372049 GATTGAAACCTGAAACTGAAGGG + Intronic
990932847 5:61112619-61112641 TCATATAGCCTGAAAATAAAAGG - Intronic
991088162 5:62667429-62667451 TCTTGTAATCAGAAAATGAAAGG + Intergenic
993431569 5:87839093-87839115 ACATATAGACTGAAACTGAAGGG - Intergenic
994964474 5:106651431-106651453 TATTAAAATCTGAAAATGAATGG + Intergenic
996364714 5:122688878-122688900 TCTTATAACCATAAATTCAATGG - Intergenic
996679753 5:126219149-126219171 TCTAATATCCAGAAACTGTAAGG + Intergenic
998932802 5:147199869-147199891 CCTGATACCCTGAAACTGCAAGG + Intergenic
999354558 5:150913439-150913461 TTTTATAAATTGAAACTAAAAGG + Intergenic
1000758277 5:165187819-165187841 TTTTATAACATGAAAGTGCAAGG + Intergenic
1001604903 5:172952594-172952616 TCTTATAATCAAAATCTGAAGGG + Exonic
1002682464 5:180978008-180978030 TCTTAAAACCTGAAGAGGAAAGG - Intergenic
1006262383 6:32885890-32885912 TATCATAGTCTGAAACTGAAGGG + Intergenic
1011942840 6:92864387-92864409 TCTTATAATCGTAAATTGAAAGG + Intergenic
1013664190 6:112329829-112329851 TCTTGTAACCTGAGGCTGAATGG + Intergenic
1014481321 6:121941163-121941185 GCTTATAGGCTGAAAGTGAAAGG - Intergenic
1014863541 6:126499837-126499859 TCTAATAAACTAAAACTTAAGGG - Intergenic
1015736325 6:136403647-136403669 TCTTAAAACCTGAAAAGTAAGGG - Intronic
1017230351 6:152067115-152067137 TCTTTTAACCTGAAAGCGCAGGG - Intronic
1018706496 6:166467512-166467534 TCTCATAAGATGACACTGAATGG + Intronic
1020601301 7:10277552-10277574 TCTTAAAACCTGAAACAAAAAGG + Intergenic
1020654459 7:10912742-10912764 TCATATAAGCTGAAACCTAAAGG - Intergenic
1022462635 7:30625617-30625639 TCTTATAACCTGAAACTGAATGG + Intronic
1022556742 7:31305761-31305783 TATTATATCCTGAACCTAAAAGG - Intergenic
1022630112 7:32076790-32076812 TCATATAACCTAAAAGTCAATGG - Intronic
1022827655 7:34032693-34032715 TCTTAAAACTTGAGAATGAAAGG - Intronic
1023491811 7:40751137-40751159 ACTTATAACATGACACTGAGGGG + Intronic
1023804968 7:43866335-43866357 TCTTAAAAACTAACACTGAATGG + Intergenic
1024922420 7:54573326-54573348 TCCTATAACCTGAAGCTTGAAGG + Intergenic
1025014858 7:55430968-55430990 TCTTATATCTTGAAACTTTAAGG - Intronic
1025845737 7:65195246-65195268 CATTATAACCTGAAACAGAAGGG + Intergenic
1025895959 7:65700959-65700981 CATTATAACCTGAAACAGAAGGG + Intergenic
1030225744 7:107148267-107148289 TCTGACAATCTGAATCTGAACGG - Intronic
1030524724 7:110639395-110639417 TTTTTTAACATGAAACTGAAAGG - Intergenic
1030858670 7:114595326-114595348 TTTTATTACCAGAAACAGAAGGG + Intronic
1031016366 7:116580713-116580735 TCATATTTCCTGAAGCTGAAGGG + Intergenic
1031932882 7:127704168-127704190 TTTTAACACCTGAAATTGAATGG + Intronic
1032029392 7:128469888-128469910 TCTTATTCCCTGAAACTGAAAGG - Intergenic
1032130889 7:129226151-129226173 TATTATAATCTGAAAGTGATAGG + Intronic
1032134147 7:129259397-129259419 TCTTATGACTTGAAATTCAAAGG - Intronic
1033233795 7:139622540-139622562 TCTTATAAACCTAAAGTGAAAGG - Intronic
1034324395 7:150217414-150217436 TCTTCAAACCTGAGGCTGAAAGG + Intergenic
1034768799 7:153751817-153751839 TCTTCAAACCTGAGGCTGAAAGG - Intergenic
1038299302 8:26327311-26327333 TCCTGTAACCTGAGGCTGAAGGG - Intronic
1039462290 8:37755389-37755411 TCTTATATCCTGAGATTGAGGGG + Exonic
1039503900 8:38037689-38037711 ACTTATACCCTGCAACTGAAAGG - Intronic
1040452323 8:47560486-47560508 ACTTATAAGCAGAAACTGGAAGG - Intronic
1040744862 8:50629836-50629858 TCTTATAACCCAAAACTATAGGG + Intronic
1044164529 8:88965961-88965983 TCTAAAAATCTGAGACTGAAAGG - Intergenic
1044429512 8:92092191-92092213 CCTTATAACAAGAAAGTGAATGG - Intronic
1045176211 8:99727742-99727764 TCTTAAAACCTGATACTGTTTGG - Intronic
1045312587 8:101016019-101016041 TCTTATGAGCTGGAACTGAGAGG + Intergenic
1046496089 8:115015340-115015362 TTTTGTATCCTGAAACTGTATGG + Intergenic
1051502712 9:17795583-17795605 ACTTTGAACCTGAAAATGAAGGG + Exonic
1052210819 9:25901163-25901185 TCTAATATCCAGAATCTGAAAGG + Intergenic
1055387860 9:75783296-75783318 TCTAATACCCAGAAACTGTAAGG - Intergenic
1057057310 9:91973426-91973448 TCTAATATCCAGAAACTGCAAGG + Intergenic
1058268576 9:102939444-102939466 TCTTATCAATTGAAGCTGAATGG - Intergenic
1058424898 9:104867924-104867946 TCTTCTTACCTGACACTGAAAGG + Intronic
1186504413 X:10079345-10079367 TCTGACTACCTGAAACTCAATGG - Intronic
1189756206 X:44274169-44274191 TCTTATAACCTGTTCCTGTAAGG - Intronic
1189930824 X:46007809-46007831 TCTCATAACATAAAAGTGAAAGG - Intergenic
1190126174 X:47707648-47707670 TCTTAAAACCTGAAGCTTAGAGG - Intergenic
1191964620 X:66743718-66743740 ACATATAAACTGAAAGTGAAGGG - Intergenic
1193407732 X:81122791-81122813 TCTCAGAAACTGACACTGAAAGG - Intronic
1193611860 X:83641575-83641597 TCATATAACTTAAAAATGAAGGG - Intergenic
1194731663 X:97462742-97462764 TCTTATCACCAGGAACTAAATGG - Intronic
1194790554 X:98143789-98143811 TGTTATGTCCTGAAACTGAAAGG - Intergenic
1194814048 X:98421113-98421135 TCTTATAATCTCAAACTGAAAGG + Intergenic
1195031909 X:100934482-100934504 TCTTATTGCCTTAAACTGATTGG + Intergenic
1196672394 X:118382686-118382708 TCTTATAACCAAATACTGCAGGG + Intronic
1198435185 X:136610086-136610108 ACTAATATACTGAAACTGAAAGG - Intergenic
1198607041 X:138352277-138352299 TCTTATAACATAAAAGTGCAAGG + Intergenic
1198979243 X:142376029-142376051 TCTTAAAACTTGAAACTGGCCGG - Intergenic
1199239748 X:145532564-145532586 AGTTATAATGTGAAACTGAAAGG + Intergenic
1199247866 X:145627317-145627339 TCTTATAAGCTGGAAGAGAATGG + Intergenic
1201050075 Y:9923885-9923907 TCTTATACAATCAAACTGAAAGG - Intergenic